Expression analysis of Inhibitor Of DNA Binding 1 (ID-1) gene in breast cancer

Abstract

BACKGROUND:

ID-1 gene codes for a helix-loop-helix (HLH) protein that inhibits the DNA binding and transcriptional activation function of these proteins.

METHODS:

We analyzed ID-1 expression in microarray and RNA Sequencing databases as well as 61 breast cancer tissues compared with adjacent non-cancerous tissues (ANCTs).

RESULTS:

Expression analysis of ID-1 gene in two microarray datasets and RNA sequencing data showed down-regulation of ID-1 in tumoral tissues compared with normal tissues. However, ID-1 expression analysis in tumoral tissues and ANCTs obtained from 61 patients revealed its over-expression in tumoral tissues. A negative association was detected between ID-1 expression levels and ER status.

CONCLUSION:

ID-1 expression may be implicated in the pathogenesis of breast cancer especially in patient with ER negative status.

Keywords

Breast cancer estrogen receptor ID-1

1. Introduction

In human there are four genes code for Inhibitor Of DNA Binding (ID) proteins. These proteins are helix-loop-helix (HLH) proteins that can make heterodimers with members of the basic HLH family of transcription factors. As these proteins have no DNA binding domain they can inhibit the DNA binding and transcriptional activation function of basic HLH proteins following interaction with them. Consequently, they exert regulatory functions in gene expression [1]. Moreover, some evidences support the oncogenic function for ID proteins [2] especially in vascularization of tumors [3]. Up to now studies on cervical, ovarian and breast cancers have shown clinical relevance of ID-1 expression in these cancers leading to speculation of a potential for this protein as a cancer biomarker and therapeutic target [4, 5, 6, 7].

Previously, elevated levels of ID-1 mRNA have been detected in aggressive and metastatic breast cancer cells. In addition, ID-1 has been recognized as a principal mediator of the sex steroid hormones functions in luminal A subtype of breast cancer cells. The results of in vitro studies in addition to the observed predominant expression of ID-1 protein in infiltrating carcinomas compared with ductal carcinomas in situ implied its role in the development of malignant phenotype in breast cancer cells [1]. However, except for the above-mentioned studies data regarding the association between ID-1 expression and breast cancer features are scarce. Consequently, in the present study, we first analyzed ID-1 expression in available microarray and RNA Sequencing databases. In addition, we assessed its expression in breast cancer tissues in association with microRNA (miRNA)-100 expression as well as clinicopathologic characteristics of patients.

2. Material and methods

2.1 In silico identification of microRNAs (miRNAs) that target ID-1

miRTarBase [8] was used for identification of miRNAs that target ID-1 gene. This database has gathered thousands of miRNA-target interactions (MTIs) through manual search of relevant literature and filtering research articles that functionally validated MITs.

2.2 Extraction of microarray data

By using the Gene Expression Omnibus (GEO) repository at the National Center for Biotechnology Information (NCBI) archives [9] we get access to GSE80999 and GSE81000 microarray gene expression data which encompassed gene expression profile of 425 normal subjects and breast cancer patients. Expression of ID-1 gene was compared between breast cancer patients and normal samples using GEO2R web tool (https://www.ncbi.nlm.nih.gov/geo/info/geo2r. html). In addition, the correlations between expression of ID-1 and expression of miRNAs identified as regulators of ID-1 by miRTarBase have been assessed in the mentioned microarray datasets.

2.3 Analysis of RNA sequencing data using gene expression profiling interactive analysis (GEPIA)

The relative expression of ID-1 gene and its association with ESR1 expression have been assessed using GEPIA which is a recently established interactive web server for analyzing the RNA sequencing expression data obtained from the TCGA and the GTEx projects [10].

2.4 Patients’ samples

Sixty one female patients diagnosed with invasive ductal carcinoma of breast entered the study. Exclusion criteria were the presence of familial breast cancer and administration of any anticancer treatments before removal of the tissues. Breast cancer tissues and the corresponding adjacent non tumoral tissues (ANCTs) were removed during surgery and frozen in liquid nitrogen immediately. Written informed consent was obtained from all patients. The study protocol was approved by the ethical committee of Shahid Beheshti University of Medical Sciences (IR.SBMU.MSP.REC.1395.525).

2.5 RNA extraction and real time PCR

TRIzol™ Reagent (Invitrogen, Carlsbad, CA, USA) was used for extraction of total RNA from tissues. Subsequently, cDNA was synthesized by RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, Lithuania). The relative transcript level of ID-1 was quantified by using SYBR ${}^{\@setsize{\scriptsize}{8pt}{\viipt}{\@viipt}\textregistered}$ Premix Ex TaqTM (TaKaRa, Japan) based on the company protocol using B2M expression levels for normalization of expression data. The nucleotide sequences of primers are as follows: ID1-F: CGTATCTGC TTCGGGCTTCC, ID1-R: CTGCCACTGGCGACTTTCAT, B2M-F: AGAT GAGTATGCCTGCCGTG and B2M-R: GCGGCATC TTCAAACCTCCA. All experiments were performed in the rotor gene 6000 corbett Real-Time PCR System.

2.6 Estrogen receptor (ER), progesterone receptor (PR), Her2/neu and Ki-67 status

The results of ER, PR, Her2/neu and Ki-67 status were retrieved from patients’ laboratory reports which were performed by immunohistochemistry (IHC). For ER, PR and Ki-67 staining of $>$ 20% of tumor cell nuclei were supposed as positive results. For Her2/neu, a test result of 3+ or more was regarded as positive.

2.7 Statistical analysis

R software (version 3.3.1) was used for statistical analyses. Data were presented as mean $\pm$ standard deviation (SD). Student’s paired and un-paired t-tests were used for analysis of differences in gene expression between paired and unpaired samples. Chi-square test was used for evaluation of the association between clinicopathologic features and ID-1 expression levels. The expression fold change was measured using 2- $\Delta\Delta$ Ct method. The cut-offs of the fold changes values were assigned using the median values of fold changes. For all statistical tests, the level of significance was set at $p<$ 0.05.

3. Results

3.1 Identification of miRNAs that target ID-1 and assessment of correlation between their expression and expression of ID-1

Seven miRNAs have been found to target ID-1 gene through in silico analysis using miRTarBase software. Subsequently, we assessed the correlation between ID-1 expression and expression of these miRNAs using the mentioned microarray datasets in 344 breast tumor samples and 44 normal breast samples. Table 1 shows the relative expression of these miRNAs in tumoral tissues compared with normal tissues and the correlation between their expression and ID-1 expression.

Table 1
The relative expression of miRNAs found by miRTarbase to affect ID-1 expression in tumoral tissues compared with normal tissues and the correlation between their expression and ID-1 expression in GSE80999 and GSE81000 microarray dataset (FC: Expression fold change in tumor samples compared with normal samples)

miRNAs	LogFC	$p$ -value	Pearson correlation
			coefficient
hsa-miR-125b-5p	$-$ 0.801	0.00	0.353
hsa-miR-100-5p	$-$ 0.685	0.00	0.052
hsa-miR-520h	$-$ 0.746	0.03	0.115
hsa-miR-215-5p	0.755	Not significant	$-$ 0.125
hsa-miR-192-5p	1.49	0.00	$-$ 0.216
hsa-miR-26b-5p	0.673	0.00	$-$ 0.107
hsa-miR-381-3p	$-$ 1.31	0.00	0.239

3.2 Expression analysis of ID-1 gene in GSE80999 microarray dataset

Expression analysis of ID-1 gene in the mentioned dataset showed significant down-regulation of ID-1 in tumoral tissues compared with normal tissues (logFC $=$ $-$ 0.707, $p=$ 0.00).

3.3 Analysis of RNA sequencing data using GEPIA

ID-1 has been shown to be significantly down-regulated in tumoral tissues compared with paired normal samples in RNA sequencing data provided by GEPIA. Figure 1 shows the relative expression of ID-1 in tumoral tissues compared with paired normal samples as provided by GEPIA.

Figure 1.

The relative expression of ID-1 in tumoral tissues compared with paired normal samples as provided by GEPIA (X axis: Tumoral and normal tissues respectively; Y axis: log ${}_{2}$ (transcripts per million $+$ 1).

Subsequent analysis of ID-1 and ESR1 expression levels showed a significant inverse correlation between their expression levels. Figure 2 shows the correlation between ID-1 and ESR1 expression levels as provided by GEPIA.

Figure 2.

The correlation between ID-1 and ESR1 expression levels as provided by GEPIA.

3.4 Expression analysis of ID-1 in patients’ samples

ID-1 expression analysis in tumoral tissues and ANCTs obtained from 50 patients revealed over-expression of ID-1 in tumoral tissues compared with ANCTs (Cancer vs. Normal: 1.96 $\pm$ 1.23 vs. 0.11 $\pm$ 1.51, $p=$ 0.04 (Fig. 3)).

Figure 3.

Relative expression of ID-1 in tumoral tissues compared with ANCTs.

3.5 Association between ID-1 expression levels and patients’ characteristics

The associations between expression levels of ID-1 gene and clinicopathologic data of patients have been shown in Table 2. Nine out of total 10 patients who were ER negative had high expression of ID-1 in their tumoral tissues compared with the corresponding ANCTs. Except for the observed significant inverse association between ID-1 expression levels and ER status ( $p=$ 0.007), no other significant association was found between the expression levels of this gene and clinicopathological data.

Table 2
Association between ID-1 expression levels and patients’ clinicopathologic data

Features	Total number
of cases (%)	ID1 high expression
cases ( $n=$ 35)	$p$ value
Age			NS
$\leqslant$ 55	38 (62%)	23
$>$ 55	23 (38%)	12
TNM stage			NS
Low	39 (64%)	20
High	22 (36%)	15
Tumor grade			NS
Low	41 (68%)	23
High	20 (32%)	12
Tumor size			NS
$>$ 2	12 (19%)	6
$\leqslant$ 2	49 (81%)	29
Lymphatic metastasis			NS
$+$	8 (16%)	5
$-$	14 (84%)	10
History of abortion			NS
$+$	13 (21%)	8
$-$	48 (79%)	27
ER			**0.007
$+$	49 (80%)	24
$-$	12 (20%)	11
PR			NS
$+$	47 (78%)	26
$-$	14 (22%)	9
Her2/neu			NS
$+$	44 (72%)	25
$-$	17 (28%)	10
Ki67			NS
$+$	52 (85%)	31
$-$	9 (15%)	4

4. Discussion

Breast cancer as the most common cancer among women [11] has attracted researchers to find biomarkers with the ability to detect cancer in its early course [12, 13, 14, 15, 16], predict patients’ clinical outcome [17] or be served as therapeutic targets [18, 19]. The heterogeneity of breast cancer has complicated the identification of a single marker with these capacities. With the hope to find the clinical relevance of ID-1 in breast cancer patients, we analyzed available microarray and RNA sequencing data of breast cancer patients to evaluate expression levels of ID-1. We detected down-regulation of ID-1 in breast cancer tissues compared with normal breast tissues and paired normal tissues assessed by microarray and RNA sequencing respectively. However, we detected up-regulation of ID-1 in 50 breast cancer tissues compared with ANCTs by the means of real time RT-PCR. Such discrepancy between the results of our experiments and those of mentioned high throughput techniques might be due to the heterogeneity of tissues assessed by latter techniques or different sources of control tissues in the case of microarray analysis. The observed up-regulation of ID-1 in our cohort of breast cancer patients is in line with the three previous studies which assessed its expression in breast cancer. Lin et al. have evaluated ID-1 expression by immunohistochemistry in 10 cases of ductal carcinoma in situ and 12 infiltrating grade III ductal carcinoma formalin-fixed paraffin-embedded sections and found more prevalent expression of ID-1 in the latter cases [1]. Fong et al. have demonstrated remarkable less invasive and metastatic capacity in human metastatic breast cancer cells following ID-1 silencing. They confirmed the results of in vitro experiments in 4T1 breast cancer cells bearing BALB/c mice and proposed the possibility of developing novel therapeutic modalities to target ID-1 expression to diminish breast cancer metastasis in humans [20]. Schoppmann et al. have evaluated ID-1 expression in 191 consecutive formalin-fixed, paraffin-embedded cases of lymph node negative breast cancer using immunohistochemistry and found inverse correlations between ID-1 expression and overall as well as disease-free survival and concluded that overexpression of ID-1 protein is a strong independent prognostic marker in node negative breast cancer which implies the practical value of targeted therapies against this protein [7].

Besides, in the present study we demonstrated an inverse association between ER status and ID-1 expression levels which is in line with the observed inverse correlation between ESR1 and ID-1 genes expressions in RNA sequencing data. The role of ID-1 in steroid hormone response has been assessed previously. In vitro studies have shown the positive effect of estrogen on ID-1 expression which was contrary to the repressive effect of progesterone on its expression [1]. In addition, ID-1 silencing has diminished the ability of estrogen to stimulate cell proliferation, while ID-1 over-expression made cells unresponsive to growth inhibition by progesterone [1]. Moreover, Schoppmann et al. have observed more significant effect of ID-1 expression on clinical outcome of patients with ER negative status compared to those with ER positive status who took receptor antagonists as adjuvant therapy. However, they failed to find any dissimilarity in estrogen receptor density between tumors with absent/low and moderate/strong ID-1s expression [7].

Finally, we found no correlation between ID-1 and miR-100 expression levels in breast cancer tissues. ID-1 has been demonstrated to be a target of miR-100 in oral cancer cells [21]. However, it was not identified as a miR-100 target implicated in breast cancer pathogenesis through application of our novel bioinformatics-based approach [22]. Consequently, our data regarding lack of correlation between the expression levels of these two genes supports the efficacy of our previously suggested approach for identification of miR-100 targets in breast cancer.

5. Conclusions

We demonstrated up-regulation of ID-1 mRNA in breast cancer tissues compared with ANCTs which is consistent with the results of previous studies on ID-1 protein expression and supports its role in the pathogenesis of breast cancer. However, such results have not been confirmed by evaluation of data obtained from high throughput methods. Future studies are needed to elaborate the reason of such discrepancy.

Footnotes

Acknowledgments

This article has been extracted from the thesis written by Roshanak Shams in School of Medicine, Shahid Beheshti University of Medical Sciences. The present article is financially supportedby “Research Department of the School of Medicine Shahid Beheshti University of Medical Sciences” (Grant no 9652).

Conflict of interest

The authors declare they have no conflict of interest.

References

Lin

C.Q.

et al., A role for ID-1 in the aggressive phenotype and steroid hormone response of human breast cancer cells, Cancer Research 60 (1 Mar 2000), 1332.

Lasorella

and Iavarone

, Id proteins at the cross-road of development and cancer, Oncogene 20 (20 Dec 2001), 8326.

Lyden

et al., Id1 and Id3 are required for neurogenesis, angiogenesis and vascularization of tumour xenografts, Nature 401 (14 Oct 1999), 670.

Arnold

J.M.

Mok

S.C.

Purdie

and Chenevix-Trench

, Decreased expression of the Id3 gene at 1p36.1 in ovarian adenocarcinomas, Brit J Cancer 84 (2 Feb 2001), 352.

Schindl

et al., Overexpression of ID-1 protein is a marker for unfavorable prognosis in early-stage cervical cancer, Cancer Research 61 (1 Aug 2001), 5703.

Schindl

et al., Level of ID-1 protein expression correlates with poor differentiation, enhanced malignant potential, and more aggressive clinical behavior of epithelial ovarian tumors, Clin Cancer Res 9 (Feb 2003), 779.

Schoppmann

S.F.

et al., Overexpression of ID-1 is associated with poor clinical outcome in node negative breast cancer, Int J Cancer 104 (10 May 2003), 677.

Hsu

S.-D.

et al., miRTarBase: a database curates experimentally validated microRNA – target interactions, Nucleic Acids Research 39 (2010), D163.

Barrett

and Edgar

, [19] Gene Expression Omnibus: Microarray Data Storage, Submission, Retrieval, and Analysis, Methods in Enzymology 411 (2006), 352.

10.

Tang

et al., GEPIA: a web server for cancer and normal gene expression profiling and interactive analyses, Nucleic Acids Research (12 Apr 2017).

11.

Dianatpour

et al., Expression of Testis Specific Genes TSGA10, TEX101 and ODF3 in Breast Cancer, Iranian Red Crescent Medical Journal 14 (Nov 2012), 722.

12.

Iranpour

et al., Expression analysis of four long noncoding RNAs in breast cancer, Tumour biology: The journal of the International Society for Oncodevelopmental Biology and Medicine 37 (Mar 2016), 2933.

13.

Kazemi-Oula

Ghafouri-Fard

Mobasheri

M.B.

Geranpayeh

and Modarressi

M.H.

, Upregulation of RHOXF2 and ODF4 Expression in Breast Cancer Tissues, Cell Journal 17 (Fall, 2015), 471.

14.

Ghafouri-Fard

Oskooei

V.K.

Azari

and Taheri

, Suppressor of cytokine signaling (SOCS) genes are downregulated in breast cancer, World J Surg Oncol 16 (2018), 226.

15.

Yaghoobi

Azizi

Oskooei

V.K.

Taheri

and Ghafouri-Fard

, Assessment of expression of interferon gamma (IFN-G) gene and its antisense (IFNG-AS1) in breast cancer, World J Surg Oncol 16 (2018), 211.

16.

Seifi-Alan

et al., Expression analysis of two cancer-testis genes, FBXO39 and TDRD4, in breast cancer tissues and cell lines, Asian Pacific Journal of Cancer Prevention: APJCP 14 (Jan 2014), 6625.

17.

Nikpayam

et al., Expression analysis of long non-coding ATB and its putative target in breast cancer, Breast Disease (2 Jun 2017).

18.

Ghafouri-Fard

Shamsi

Seifi-Alan

Javaheri

and Tabarestani

, Cancer-testis genes as candidates for immunotherapy in breast cancer, Immunotherapy 6 (2014), 165.

19.

Tasharrofi

et al., Comparative expression analysis of hypoxia-inducible factor-alpha and its natural occurring antisense in breast cancer tissues and adjacent noncancerous tissues, Cell Biochemistry and Function 34 (Dec 2016), 572.

20.

Fong

et al., ID-1 as a molecular target in therapy for breast cancer cell invasion and metastasis, P Natl Acad Sci USA 100 (11 Nov 2003), 13543.

21.

Henson

B.J.

Bhattacharjee

O’Dee

D.M.

Feingold

and Gollin

S.M.

, Decreased expression of miR-125b and miR-100 in oral cancer cells contributes to malignancy, Genes, Chromosomes & Cancer 48 (Jul 2009), 569.

22.

Shamsi

et al., A bioinformatics approach for identification of miR-100 targets implicated in breast cancer, Cellular and Molecular Biology (Noisy-le-Grand, France) 63 (31 Oct 2017), 99.

Expression analysis of Inhibitor Of DNA Binding 1 (ID-1) gene in breast cancer

Abstract

BACKGROUND:

METHODS:

RESULTS:

CONCLUSION:

Keywords

1. Introduction

2. Material and methods

2.1 In silico identification of microRNAs (miRNAs) that target ID-1

2.2 Extraction of microarray data

2.3 Analysis of RNA sequencing data using gene expression profiling interactive analysis (GEPIA)

2.4 Patients’ samples

2.5 RNA extraction and real time PCR

2.6 Estrogen receptor (ER), progesterone receptor (PR), Her2/neu and Ki-67 status

2.7 Statistical analysis

3. Results

3.1 Identification of miRNAs that target ID-1 and assessment of correlation between their expression and expression of ID-1

3.3 Analysis of RNA sequencing data using GEPIA

Table 2 Association between ID-1 expression levels and patients’ clinicopathologic data

5. Conclusions

Footnotes

Acknowledgments

Conflict of interest

References

Table 2
Association between ID-1 expression levels and patients’ clinicopathologic data