Dys-regulation of peripheral transcript levels of ecto-5’-nucleotidase in multiple sclerosis patients

Abstract

CD73, also entitled as ecto-5 ${}^{\prime}$ -nucleotidase (NT5E), is an ecto-nucleotidase that contributes in the breakage of extracellular ATP to adenosine and the preservation of immune balance. In spite of acknowledged role for immune response imbalance in the pathogenesis of multiple sclerosis (MS), data regarding NT5E expression in MS patients are scarce. In the current study, we assessed expression of NT5E in peripheral blood of MS patients and healthy subjects to unravel its role in the pathogenesis of MS. Results of Multilevel Bayesian model showed no significant difference in NT5E expression between total MS patients and healthy subjects. However, its expression was significantly lower in male MS patients compared with male controls ( $P=$ 0.031, 95% credible intervals: [ $-$ 6.93, $-$ 0.56]). No significant correlation was found between expression of NT5E and age in any study subgroups. Remarkably, NT5E transcript levels had 92.31% sensitivity and 80% specificity in diagnosis of MS disease. The diagnostic power of NT5E transcripts was 86.2% based on AUC values. Consequently, the current study indicates the role of NT5E in the pathogenesis of MS disease in male subjects. Moreover, expression level of this gene might be used as a putative marker especially in male MS patients.

Keywords

NT5E multiple sclerosis

1. Introduction

CD73, also entitled as ecto-5 ${}^{\prime}$ -nucleotidase (NT5E), is an ecto-nucleotidase that contributes in the breakage of extracellular adenosine triphosphate (ATP) to adenosine and the preservation of immune balance [1, 2]. Such enzymatic function regulates the time, extent, and chemical characteristics of purinergic signals conveyed to immune cells. Conversion of ATP to adenosine triggers a change from an ATP-induced proinflammatory situation to an anti-inflammatory setting induced by adenosine [2]. Researchers in the field of oncology have identified the NT5E-adenosine axis as one of the immunosuppressive pathways in tumor microenvironment. Notably, targeted suppression of this axis has enhanced anti-tumor immune responses [3]. Based on the critical role of NT5E in regulation of immune response, it is anticipated to participate in the pathogenesis of autoimmune disorders such as multiple sclerosis (MS). Previous studies have demonstrated contradictory results regarding its role in MS [4]. Nt5e knockout mice were resilient to the initiation of allergic encephalomyelitis due to decreased infiltration of inflammatory cells to brain tissues [5, 6]. Further studies have revealed Nt5e enhances the migration of inflammatory T cells into the central nervous system (CNS) through an adenosine-facilitated stimulation of chemokine C-X3-C motif ligand 1 in the epithelium of the choroid plexus [7]. A previous study has demonstrated high monocyte NT5E activity in patients with active relapsing MS, but decreased activity of this enzyme after treatment with interferon (IFN)- $\gamma$ [8]. Another study using radioisotopic assay has reported normal activity of this enzyme in lymphocytes and noncultured monocytes of MS patients. However, the enzyme activity in cultured monocytes was greater than normal in the majority of patients with active MS and less than normal in the majority of patients with chronic inactive MS [9]. On the other hand, the 31P nuclear magnetic resonance spectroscopy technique did not show remarkable difference in the enzyme activity between MS patients [10]. Conversely, another study in MS patients has shown lower NT5E activities in peripheral blood T cells in MS patients compared with controls. Such decreased activities were not associated with the disease course (relapsing-remitting vs. chronic progressive MS) [11]. IFN- $\beta$ as one of the widely used disease modifying therapies (DMTs) in MS enhances NT5E expression and therefore the endogenic levels of adenosine in the CNS venules or capillaries, in the blood brain barrier (BBB) and glial cells, and in sera of MS patients [12, 13].

Based on the putative role of NT5E as an immunosuppressive agent and its participation in the response of MS patients to IFN- $\beta$ , we conducted the current case-control study to compare its expression in the peripheral blood of relapsing-remitting (RR) MS patients and healthy controls to find whether its transcript levels can differentiate MS patients from healthy subjects.

2. Material and methods

2.1 Patients

A total of 50 MS patients and 50 healthy subjects were enrolled in the present study. All MS patients were under treatment with weekly injection of IFN- $\beta$ and were in remission phase during the 3-month period before sampling. The study protocol was approved by ethical committee of Shahid Beheshti University of Medical Sciences (ethical approval code IR. SBMU. MSP. REC. 1397.586).

2.2 Expression study

Peripheral blood samples were gathered from all study participants in EDTA tubes. Total RNA was isolated from total leukocytes using Hybrid-RTM blood RNA extraction Kit (GeneAll, Seoul, Korea). After assessment of RNA quantity and quality, first strand cDNA was produced using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Gent, Belgium). Finally expression of NT5E (relative to HPRT1) was assessed in Rotor Gene 6000 instrument using TaqMan ${}^{\@setsize{\scriptsize}{8pt}{\viipt}{\@viipt}\textregistered}$ Universal PCR Master Mix (Thermo Fisher Scientific, Gent, Belgium). Primers and probes used for expression study were as follow: HPRT1: F: AGCCTAAGATGAGAGTTC, R: CACAGAACTAGAACATTGATA and FAM-CATCTGGA-GTCCTATTGACATCGC-TAMRA; NT5E: F: CGG-CTCTTCACCAAGGTTCAG, R: GATCAGTCCTTCCACACCATTATC and FAM-CGCCGAACCCAAC-GTGCTGCTG-TAMRA.

Table 1
The general data of study participants

Variables	MS patients	Controls
Female/Male [no. (%)]	35 (70%)/15 (30%)	35 (70%)/15 (30%)
Age (mean $\pm$ SD, Y)	36.2 $\pm$ 2.7	35.3 $\pm$ 2.4
Age range (Y)	17 $-$ 55	22 $-$ 60
Age of onset (mean $\pm$ SD, Y)	31.41 $\pm$ 2.8	–
Disease duration (mean $\pm$ SD, Y)	4.58 $\pm$ 3.2	–
EDSS score (mean $\pm$ SD)	3.07 $\pm$ 2.5	–

Table 2

Results of Multilevel Bayesian model for assessment of association between NT5E expression and MS disease (RE: relative expression, $P$ value was estimated from Frequentist method)

		Controls number	Patients number	Posterior RE difference	Standard error	$P$ -value	95% credible interval for RE difference
Total		50	50	$-$ 1.27	0.65	0.073	[ $-$ 2.56, 0.04]
Male		15	15	$-$ 3.855	1.61	0.031	[ $-$ 6.93, $-$ 0.56]
Female		35	35	$-$ 0.495	0.731	0.413	[ $-$ 1.95, 0.96]
$\leqslant 50$	Male	5	13	$-$ 3.686	1.727	0.008	[ $-$ 7.12, $-$ 0.26]
	Female	27	30	$-$ 0.71	0.87	0.43	[ $-$ 2.36, 1]
$>$ 50	Male	10	2	$-$ 2.522	3.354	0.473	[ $-$ 8.96, 4.52]
	Female	8	5	0.367	1.551	0.947	[ $-$ 2.75, 3.39]

2.3 Statistical analyses

Relative expression of NT5E was compared between cases and controls using Multilevel Bayesian model. The observation effects were considered as random in this model. A t student/Gaussian prior distribution was presumed for parameters with 8000 iteration and 1000 warm-up. The effects of potential confounding variables were dignified through application of Quantile regression. The Box-Cox transformation was applied to normalize data. The model was established using Stan packages in R 3.5.1 environment. Correlation between expression of NT5E and age of study participants was assessed using Spearman correlation coefficients. Diagnostic power of NT5E transcripts in differentiation of disease status was assessed using Receiver Operating Characteristic (ROC) Curve analysis. The area under curve (AUC) value was calculated to assess how well expression levels can discriminate between two MS patients and healthy subjects.

3. Results

The general data of study participants are described in Table 1.

Results of Multilevel Bayesian model showed no significant difference in NT5E expression between total MS patients and healthy subjects (Table 2). However, its expression was significantly lower in male MS patients compared with male controls ( $P=$ 0.031, 95% credible intervals: [ $-$ 6.93, $-$ 0.56]).

Based on the results of Quantile regression and after controlling the effects of sex and age, there was no significant difference in NT5E expression between cases and controls ( $P$ value $=$ 0.073) (Table 3).

Table 3
Results of Quantile regression model for controlling the effects of the age and sex

Variable	Beta	SE	$t$	$P$ -value	95% CI
Group (case/control)	$-$ 2.86	1.58	$-$ 1.82	0.073	[ $-$ 5.99, 0.27]
Sex	$-$ 3.53	1.52	$-$ 2.32	0.023	[ $-$ 6.55, $-$ 0.51]
Age	$-$ 0.05	0.02	$-$ 2.61	0.011	[ $-$ 0.09, $-$ 0.01]
Group*sex	2.58	1.99	1.29	0.199	[ $-$ 1.38, 6.54]

No significant correlation was found between expression of NT5E and age in any study subgroups (Table 4).

Table 4

Spearman correlation coefficients between NT5E expression and other variables

	Group		Gender
	Case	Control	Male	Female
Age	0.0	0.042	0.205	$-$ 0.124

4. ROC curve analysis

NT5E transcript levels had 92.31% sensitivity and 80% specificity in diagnosis of MS disease. The diagnostic power of NT5E transcripts was 86.2% based on AUC values (Fig. 1).

Figure 1.

ROC curve analysis for assessment of diagnostic power of NT5E transcripts in MS disease.

5. Discussion

NT5E is a component of a pathway whose activity is dependent on the pathophysiological situation [2]. Modulation of this catabolic pathway can alter the progression or the consequences of numerous pathophysiological conditions including autoimmune diseases [2]. Based on these observations, ecto-enzymes are regarded as therapeutic targets in several diseases [2]. NT5E expression on the surface of Foxp3 ${}^{+}$ regulatory T cells (Tregs) have resulted in its designation as a marker of these cells [14]. Tregs are considered as crucial cells for the preservation of peripheral immune tolerance which is impaired in MS disease [15]. Moreover, human studies have shown that NT5E-derived adenosine participates in the favorable effects of IFN- $\beta$ therapy in MS patients [13]. In the current study, we evaluated expression of NT5E in peripheral blood of RRMS patients and healthy subjects. Its expression levels were not different between total MS patients and healthy subjects which can be attributed to the effects of IFN- $\beta$ therapy [7]. Previous studies have reported contradictory results regarding NT5E activity in MS patients ranging from high NT5E activity [8], to normal [9, 10] and low activity [11]. Such discrepancies might be explained by the different methods used for assessment of enzyme activity, different disease stages and courses and distinct population of cells used for enzyme assay.

We reported lower expression of NT5E in male MS patients compared with male controls. Based on the function of NT5E in modulation of immune response, such lower expression of NT5E in male patients in spite of administration of IFN- $\beta$ to these patients implies the worse disease outcome in male subjects and supports the previous finding regarding sex-based differences in disease course and progression [16]. This finding is also consistent with the proposed role of sex hormones in MS pathogenesis [17]. Such pattern of expression is in line with the previous reports of the effects of IFN- $\beta$ in up-regulation of NT5E expression in the endothelial cells of BBB and astrocytes. Moreover, IFN- $\beta$ treatment has decreased lymphocyte drifting through BBB [13]. Niemela et al. have also evaluated both NT5E expression on CD4 ${}^{+}$ T lymphocytes using immunohistochemical staining and serum ecto-5 ${}^{\prime}$ -nucleotidase activity in 11 MS patients (including one male patient) instantly before the beginning of IFN- $\beta$ treatment and 3 months afterward. Although they could not find any significant difference in NT5E expression in lymphocytes during IFN- $\beta$ therapy, serum enzyme activity has been increased in 9 out of 11 MS patients [13]. The failure to detect altered NT5E expression in T cells during IFN- $\beta$ therapy might be due to the small number of patients in their study. Alternatively, this changes might be cell-type dependent, and IFN- $\beta$ impact may be visible in endothelial cells and not in lymphocytes. Moreover, based on the low percentage of male patients in their sample, they could not assess the effects of sex on expression of NT5E. However, in the current study, based on the results of Quantile regression model we found association between transcript levels of NT5E and sex of study participants which was reflected in the observed difference in its expression between male patients and the corresponding controls. Spearman correlation analysis demonstrated no significant correlation between expression of NT5E and age in any study subgroups which implies transcript levels of this gene as an age-independent marker for MS.

Finally, ROC curve analysis showed that NT5E transcript levels had 92.31% sensitivity and 80% specificity in diagnosis of MS disease. The high diagnostic power of NT5E transcripts in MS might suggest this gene as a biomarker in a population of MS patients (i.e. male patients). Future studies are needed to confirm the current results in a larger sample of MS patients including both drug-naïve patients and those who are under treatment with various DMTs. The current study had a limitation of not assessing protein levels of NT5E, so we suggest future evaluation of the protein in the MS patients and healthy subjects to draw conclusive evidences regarding the role of NT5E in MS.

Footnotes

Acknowledgments

The current study was supported by a grant from Shahid Beheshti University of Medical Sciences.

Conflict of interest

The authors declare they have no conflict of interest.

References

Allard

Turcotte

and Stagg

, Targeting A2 adenosine receptors in cancer, Immunol Cell Biol 95 (2017), 333–339.

Antonioli

Pacher

Vizi

E.S.

and Hasko

, CD39 and CD73 in immunity and inflammation, Trends Mol Med 19 (2013), 355–367.

Allard

Gaudreau

P.O.

Chrobak

and Stagg

, CD73-adenosine: A next-generation target in immuno-oncology, Immunotherapy 8 (2016), 145–163.

Nazdik

M.K.

et al., Increased expression ratio of matrix metalloproteinase-9 (MMP9) and tissue inhibitor of matrix metalloproteinase (TIMP-1) RNA levels in Iranian multiple sclerosis patients, Human Antibodies 24 (2016), 65–70.

Mills

J.H.

et al., CD73 is required for efficient entry of lymphocytes into the central nervous system during experimental autoimmune encephalomyelitis, Proceedings of the National Academy of Sciences of the United States of America 105 (2008), 9325–9330.

Thompson

L.F.

et al., Regulation of leukocyte migration across endothelial barriers by ECTO-5’-nucleotidase-generated adenosine, Nucleosides, Nucleotides & Nucleic Acids 27 (2008), 755–760.

Mills

J.H.

Alabanza

L.M.

Mahamed

D.A.

and Bynoe

M.S.

, Extracellular adenosine signaling induces CX3CL1 expression in the brain to promote experimental autoimmune encephalomyelitis, Journal of Neuroinflammation 9 (2012), 193.

Armstrong

M.A.

Shah

Hawkins

S.A.

Bell

A.L.

and Roberts

S.D.

, Reduction of monocyte 5’nucleotidase activity by gamma-interferon in multiple sclerosis and autoimmune diseases, Annals of Neurology 24 (1988), 12–16.

Armstrong

M.A.

and Haire

, Ecto-5’nucleotidase activity in B and T lymphocytes and monocytes of patients with multiple sclerosis, Annals of Neurology 19 (1986), 94–96.

10.

Mendz

G.L.

Middlehurst

C.R.

Kuchel

P.W.

and Crossie

P.A.

, Determination of erythrocyte pyrimidine 5’-nucleotidase activity by 31P nuclear magnetic resonance: Comparison of normal controls and multiple sclerosis patients, Experientia 42 (1986), 1016–1018.

11.

Vivekanandhan

Soundararajan

C.C.

Tripathi

and Maheshwari

M.C.

, Adenosine deaminase and 5’nucleotidase activities in peripheral blood T cells of multiple sclerosis patients, Neurochemical Research 30 (2005), 453–456.

12.

Airas

Niemela

Yegutkin

and Jalkanen

, Mechanism of action of IFN-beta in the treatment of multiple sclerosis: A special reference to CD73 and adenosine, Annals of the New York Academy of Sciences 1110 (2007), 641–648.

13.

Niemela

et al., IFN-beta regulates CD73 and adenosine expression at the blood-brain barrier, European Journal of Immunology 38 (2008), 2718–2726.

14.

Schuler

P.J.

Harasymczuk

Schilling

Lang

and Whiteside

T.L.

, Separation of human CD4+CD39+ T cells by magnetic beads reveals two phenotypically and functionally different subsets, Journal of Immunological Methods 369 (2011), 59–68.

15.

Danikowski

K.M.

Jayaraman

and Prabhakar

B.S.

, Regulatory T cells in multiple sclerosis and myasthenia gravis, Journal of Neuroinflammation 14 (2017), 117.

16.

Harbo

H.F.

Gold

and Tintore

, Sex and gender issues in multiple sclerosis, Therapeutic Advances in Neurological Disorders 6 (2013), 237–248.

17.

Guerrero-Garcia

J.D.J.

Godinez-Rubi

and Ortuno-Sahagun

, Multiple sclerosis in search for biomarkers: Gender as a variable in the equation, Advances in Neuroimmune Biology 7 (2018), 53–64.