Investigating the impact of the genetic variant CXCR1 (rs2234671) in individuals with urinary tract infections

Abstract

BACKGROUND:

Urinary tract infections (UTIs) are currently posing a worldwide health concern by affecting millions of people. The genetic variant rs2234671 in the CXCR1-interleukin-8 receptor is closely related to a raised UTI risk.

OBJECTIVES:

In this work, the impact of CXCR1 (rs2234671) on UTI individuals was examined.

METHODS:

The demographic features of 30 recurrent UTI patients and 20 controls were thoroughly investigated. Bacterial isolation and identification were performed by the implementation of cultural and biochemical methods. DNA extraction, purification of all samples from both patients and healthy people, and IL-8 rs2234671 (C/G) SNP genotyping using T-ARMS-PCR were performed. The significance of the results was evaluated by carrying out a statistical analysis.

FINDINGS:

The patient’s average age was 34.63 $\pm$ 11.44 years, and controls averaged 30.30 $\pm$ 8.59 years ( $P=$ 0.156). No significant gender difference existed ( $P=$ 0.804). Escherichia coli (63.3%) was predominant, followed by Proteus mirabilis (26.7%), Enterococcus faecalis (23.3%), Klebsiella pneumoniae (10.0%), and Pseudomonas aeruginosa (20.0%). No significant association was found between bacterial species frequency, age, or sex. From the CXCR1 (rs2234671) frequency comparison, a higher GG genotype incidence in UTI patients than controls was extracted (26.7% vs. 15.0%), though not statistically significant. Risk analysis revealed that GG homozygous and C/G heterozygous genotypes were not UTI risk factors (OR $=$ 2.47 and OR $=$ 1.85, respectively). Moreover, the allele frequencies displayed no significant difference between the patients and controls (G allele: 66.7% vs. 66.7%; C allele: 33.3% vs. 33.3%).

MAIN CONCLUSIONS:

Although no significant association between CXCR1 (rs2234671) and UTI was found, the GG genotype may point to the increasing probability of UTI risk. Additional research is required to confirm and expand these conclusions.

Keywords

Urinary tract infections CXCR1 rs2234671 T-ARMS-PCR

1. Introduction

The rise of urinary tract infections (UTIs) between all ages and genders of patients has been accompanied by a sharp increase in the prevalence of pathogenic bacterial issues, which could be regarded as symptomatic or asymptomatic clinical signs of the patients [1, 2, 3]. However, UTIs are typically manifested more frequently in women than men [4, 5]. According to a recent work in the literature, it has been demonstrated that there are many bacterial infections, which could individually or together cause infection at different parts of the urinary tract (UT).

Escherichia coli (E. Coli) is a Gram-negative rod-shaped, anaerobic bacterium, which has been detected with UTI. Consequently, a strong relationship between E. Coli and UTI has been reported in the previously reported works in the literature, which confirmed that UT is mainly infected by E. Coli with high percent in comparison with other bacteria and can cause different diseases including cystitis, urethritis, and pyelonephritis [6, 7, 8, 9].

Another issue with this approach is that UTI could be induced by Proteus mirabilis [10, 11]. This bacterium is a Gram-negative rod-shaped bacterium and is characterized by motility and urease production [12], which could potentially increase the pathogenesis in the UTI. Before the infection, bacteria should be adhered to the epithelial cells or tissue of UT using MR/P fimbriae and the alkalinized urea by urease could lead to nephrolithiasis, and urolithiasis of UT [10, 13, 14]. Furthermore, Enterococcus faecalis (E. faecalis) is streptococcus and a Gram-positive, indicating that it normally inhabits the gastrointestinal tracts of humans and animals [15, 16]. It is considered the most common bacteria in UTI, and in cases is resistant to drugs and difficult to treat with antibiotics [17, 18]. E. faecalis possesses virulence factors after adhering to epithelial of UT that are associated with the aggregation substance and the expression of proteins’ surface, which mediate the adherence of the E. faecalis on renal epithelial cells [19, 20]. Moreover, Pseudomonas aeruginosa is facultative anaerobic, Gram negative, and rod in shaped bacterium, which is involved with UTI in particular elderly and catheterized patients [21, 22]. Furthermore, Pseudomonas aeruginosa is associated with asymptotic clinical signs and resistance to antibiotics [23]. Similarly, Klebsiella pneumoniae has been detected with UTI of patients, and is a Gram-negative, facultative anaerobic, rod-shaped bacterium, which could be encapsulated and lactose-fermenting non-motile [24, 25]. UTI with Klebsiella pneumoniae could be accompanied by severe clinical symptoms, and it is majorly outbroken among patients in hospitals [26]. Apparently, Klebsiella pneumoniae is a bacterium that displays high pathogenesis due to the existence of many virulence factors including capsule, lipopolysaccharide, iron acquisition systems, adhesins, biofilm formation, and it is also highly resistant to innate immune response [27, 28, 29]. However, many works in the literature have confirmed that the age of patients is not related to the average infection rate of Escherichia coli, Proteus mirabilis, Enterococcus faecalis, and Klebsiella pneumoniae [30, 31], and these bacterial infections might be connected with diverse other reasons associated with the medical history of the patients.

The risk associations of the rs2234671 polymorphisms of the CXCR1 gene with different diseases, which is a well-known example of breast cancer, have been investigated by many works in the literature. More specifically, perihilar cholangiocarcinoma, urinary tract infections, and metastatic colorectal cancer [32, 33, 34], and single nucleotides have been detected by the genotypes of GC, GG, CC, and G and C alleles, respectively [35, 36]. Although the risk factors of the rs2234671 polymorphisms of the CXCR1 gene concerning UTI have been explored, the genotype and allele frequency for the cxcr1 SNP (rs2234671) in relation to certain bacteria have not been specifically examined. Therefore, the purpose of this work was to assess the risk factor of the CXCR1 SNP (rs2234671) in patients with bacterial infections.

2. Materials and methods

2.1 Samples collection

The methods used to collect the demographic features of recurrent UTI patients and controls in the described study can be broken down into two main categories:

Medical records review: This likely involved reviewing the patients’ medical charts to extract information such as age, sex, date of UTI diagnosis, number of previous UTI episodes, and any relevant medical history. Patient interviews: Patients might have been interviewed to gather additional information about their lifestyle habits, diet, sexual history, and any potential risk factors for UTIs.

Thirty specimens were collected from patients diagnosed with recurrent UTIs between March and April 2023 at the Microbiology laboratory in Al-Diwanyiah Hospital, Qadisiyah province, Iraq. Among these patients, 10 males and 20 females ranged in age from 30 to 50 years. Additionally, 20 specimens were obtained from healthy individuals, comprising 6 males and 14 females, with ages ranging from 30 to 45 years. The blood specimens used to identify CXCR1 SNP (rs2234671) gene polymorphisms, and the patient’s urine samples were collected in clean containers for bacterial isolation. The whole blood specimens of 5 ml were collected from each patient and healthy individual.

2.2 Bacterial isolation method

A bacterial isolation method was used to isolate bacteria from urine specimens by using MacConkey agar and mannitol salt agar for the isolation of E. coli, Proteus mirabilis, Enterococcus faecalis, Klebsiella pneumoniae, and Pseudomonas aeruginosa. Particularly, the method involved streaking a sterile loopful of urine onto the surface of a MacConkey agar plate and a mannitol salt agar plate, followed by incubation at 37^∘C for 24 h. After incubation, the plates were examined for bacterial growth. E. coli colonies were large, pink to red with clear borders, while Proteus mirabilis colonies were swarming and colourless. On the contrary, Enterococcus faecalis colonies were small, and white with a narrow zone of salt tolerance, while and Klebsiella pneumoniae colonies were large, mucoid, pink to red. Pseudomonas aeruginosa colonies were green with a sweetish odour. Gram staining was also performed to determine if the bacterial colonies were Gram-positive or Gram-negative. On top of that, further biochemical assays (TSI, IMViC, Indole, MR-VP, Citrate Utilization, Urease and Motility Test) as well as Vitek2 system were conducted to validate the bacterial identification. The presence of any of the following bacteria in a urine specimen indicated a UTI.

2.3 Blood DNA Extraction

The genomic DNA was isolated from frozen blood samples using the gSYAN DNA extraction kit from Geneaid, USA, following the directions provided by the company. The obtained blood genomic DNA was assessed using Nanodrop (THERMO. USA), which determined the concentration of DNA (in ng/ $\mu$ L) and the quality of the DNA was evaluated by measuring its absorbance at 260/280 nm.

Table 1
The sequence and amplicon size of the Tetra-ARMS-PCR Primers used for IL-8- IL-8 rs2234671 (C/G) gene polymorphism (Macrogen Company. Korea)

T-ARMS-PCR Primer	Sequence (5’-3’)	Product size
Forward inner primer (C allele)	GATGTTGTTGCGGCGCTCACTGC	215bp
Reverse inner primer (G allele)	CATGAGGACCCAGGTGATCCAGGACAC	189bp
Forward outer primer	AACTCCTTGCTGACCAGGCCATGCA	354bp
Reverse outer primer	CGTGCCGCTGTTTGTCATGCTGTTC

2.4 Genotyping of CXCR1-interleukin 8-receptor (rs2234671) gene polymorphism

The IL-8 rs2234671 (C/G) SNP genotype was determined using the T-ARMS-PCR. The primer for genotyping the polymorphism was provided by (Macrogen Company. Korea) and is listed in Table 1. A reaction mixture of 25 $\mu$ L was prepared for IL-8 rs2234671 (C/G) amplification, containing 1 $\mu$ L each of the sense inner primer (C allele), antisense inner primer (G allele), sense & antisense external primer, 12.5 $\mu$ L G2 green master mix (Promega), 5 $\mu$ L of extracted DNA, and the remaining volume was completed to 25 $\mu$ L using Nuclease-Free Water. More details about these T-ARMS-PCR methods can be found in (39). The resulting PCR products yielded 215 bp for the (C) allele, 189 bp for the (G) allele, and 354 bp for the outer primers. The thermal cycling circumstances for the IL-8 rs2234671 (C/G) were as follows: an initial denaturation procedure was applied at 95^∘C for 5 min, then 35 cycles of denaturation took place at 95^∘C for 30 s, an annealing step was applied at 94^∘C for 30 s, extension was then implemented at 62^∘C for 30 s, and a last extension step at 72^∘C for 5 min was enforced. Subsequently, the product of PCR was exposed to electrophoresis on a 2% agarose gel and imagined under ultraviolet light. The electrophoresis was performed at 100 V and a current of 80 mA for 60 min.

2.5 Statistical analysis

The data were gathered, summarized, analysed, and presented using Statistical Package for Social Sciences (SPSS) version 26 and Microsoft Office Excel 2010 software packages. The numeric data were presented as mean and standard deviation after carrying out the Kolmogorov-Smirnov normality test. Various statistical tests, such as the independent sample t-test was used to compare the mean age of patients and control subjects and chi-square test was used to compare the frequency distribution of patients and control subjects according to age, gender, recurrent infection, and bacterial isolation results as well as to analyse typically and non-normally distributed variables and study the associations between categorical variables. Hardy-Weinberg equilibrium was applied to CXCR1-interleukin-8 receptor (rs2234671) genotype distribution within the control group. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated to assess the risk for UTI associated with different genotypes.

2.6 Ethical approval

The ethical principles derived from the Declaration of Helsinki were used to conduct the study. The patient’s verbal and analytical consent was obtained prior to the sample collection. The local ethics committee examined and approved the study protocol, subject information, and permission form as per Project No. B230201 on 7/2/2022 to obtain this approval.

Table 2
Demographic features of patients with recurrent urinary tract infection and control individuals

Characteristic	Patients (n $=$ 30)	Control (n $=$ 20)	P
Age (years)
Mean $\pm$ SD	34.63 $\pm$ 11.44	30.30 $\pm$ 8.59	0.156 †NS
Range	18–60	18–42
$<$ 30, $n$ (%)	10 (33.3%)	8 (40.0%)	0.831 $\yen$ NS
30–39, $n$ (%)	12 (40.0%)	8 (40.0%)
$\geqslant$ 40, $n$ (%)	8 (26.7%)	4 (20.0%)
Sex
Male, $n$ (%)	10 (33.3%)	6 (30.0%)	0.804 $\yen$ NS
Female, $n$ (%)	20 (66.7%)	14 (70.0%)
Male: Female	2:1

n: number of cases; SD: standard deviation; ^†: independent samples $t$ -test; $\yen$ Chi-square test; NS: not significant at $P>$ 0.05.

Figure 1.

The distribution of patients experiencing recurrent urinary tract infections was analysed based on their gender and age.

3. Results

3.1 Demographic features of patients and control individuals

The current study included 30 patients who had experienced multiple urinary tract infections and 20 control participants who were in good health. In Table 2, the demographic features of both patients and control persons are displayed The average age of patients was 34.63 $\pm$ 11.44, whereas the average age of the control individuals was 30.30 $\pm$ 8.59 years. There was also no statistically significant difference in the average age between patients and control participants ( $P=$ 0.156). Once again, no notable disparity in the frequency distribution of the patients and the control participants based on age ( $P=$ 0.831) was detected. The patients’ group consisted of 10 males (33.3%) and 20 females (66.7%), whereas the control group consisted of 6 males (30.0%) and 14 females (70.0%). Moreover, there was no significant difference in the distribution of both males and females between the patients and control participants ( $P=$ 0.804).

Table 3
Frequency distribution of patients based on repeated infection

Recurrent infection	Patients n $=$ 30
Positive, $n$ (%)	17 (56.7%)
Negative, $n$ (%)	13 (43.3%)

n: number of cases.

3.2 Frequency distribution of patients based on repeated infection

In Table 3 the frequency distribution of patients based on recurrent infection is presented. Out of the total number of patients, 17 (56.7%) had positive recurrent infections, while 13 (43.3%) had negative recurrent infections.

Figure 2.

Pie chart showing the frequency distribution of bacterial species according to the bacterial isolation results.

Table 4

Comparison of the frequency distribution according to the age and mean age of patients with repeated UTI based on bacterial isolation

Age (years)
Characteristic	Bacterial isolation results					p
	E. coli	P. mirabilis	E. faecalis	K. pneumonia	P. aeruginosa
$<$ 30, n (%)	6 (31.6%)	3 (37.5%)	1 (14.2%)	0 (0%)	1 (16.7%)	0.903 $\yen$
30–39, n (%)	9 (47.4%)	3 (37.5%)	3 (42.9%)	2 (66.7%)	3 (50.0%)	NS
$\geqslant$ 40, n (%)	4 (21.0%)	2 (25.0%)	3 (42.9%)	1 (33.3%)	2 (33.3%)
Total	19 (100.0%)	8 (100.0%)	7 (100.0%)	3 (100.0%)	6 (100.0%)
Mean $\pm$ SD	35.15 $\pm$ 11.33	33.25 $\pm$ 14.02	38.42 $\pm$ 9.88	38.0 $\pm$ 11.26	38.0 $\pm$ 11.61	0.892 †
Range	18–60 years	18–60 years	27–56 years	31–51 years	27–60 years	NS

SD: standard deviation; n: number of cases; $\yen$ chi-square test; ^†: one-way anova test; NS: not significant at $p>$ 0.05.

Table 5

Hardy Weinberg equation of rs2234671 SNP

Genotypes	Observed	Expected	$\chi^{2}$	P
Homozygote reference CC	13	11.3	4.356	0.113 $\yen$
Heterozygote CG	4	7.5		NS
Homozygote variant GG	3	1.3

$\yen$ Chi-square test; NS: Non-significant at $P>$ 0.05.

Figure 3.

An agarose gel electrophoresis image was used to analyse the T-ARMS-PCR product for the CXCR1-interleukin-8 receptor (rs2234671) gene polymorphism. The marker M has a size range of 2000 to 100 base pairs. The lane (CC) wild type homozygote exhibited solely the C allele in the 215 bp T-ARMS-PCR product. The homozygous lane (GG) mutant type only displayed the A allele at the 189 bp T-ARMS-PCR product. On the other hand, the heterozygous lane (CG) showed both the C and G alleles at the 215 bp and 189 bp T-ARMS-PCR products. The external internal controls were detected in the 354 bp T-ARMS-PCR product.

3.3 The results of bacterial isolation in patients with repeated UTI

The results of the frequency distribution of patients with repeated UTI based on bacterial isolation are shown in Fig. 2. As can be observed, the bacterial isolation for Escherichia coli was reported in 19 (63.3%), the Proteus mirabilis showed in 8 (26.7%); the Enterococcus faecalis showed in 7 (23.3%); the K. pneumonia and Pseudomonas aeruginosa were found in 3 (10.0%) and 6 (20.0%), respectively. A comparison of the frequency distribution according to the age and mean age of patients with repeated UTI based on bacterial isolation results is presented in Table 4. No significant association between the age and bacterial isolation results was detected in both frequency ( $p=$ 0.903) and mean age ( $p=$ 0.892). The frequency distribution of patients with repeated UTI according to the bacterial isolation results is presented in Table 5. As can be seen, no significant correlation between the sex and bacterial isolation results ( $p=$ 0.216) was found.

3.4 The of CXCR1-interleukin-8 receptor (rs2234671) gene polymorphism results

Table 6
Comparison of the frequency distribution according to the gender of patients with repeated UTI based on bacterial isolation results

Characteristic	Bacterial isolation results					p
	E. coli	P. mirabilis	E. faecalis	K. pneumonia	P. aeruginosa
Age (years)
Male, n (%)	6 (31.6%)	1 (12.5%)	4 (57.1%)	1 (33.3%)	4 (66.7%)	0.216 $\yen$
Female, n (%)	13 (68.4%)	7 (87.5%)	3 (42.9%)	2 (66.7%)	2 (33.3%)	NS
Total	19 (100.0%)	8 (100.0%)	7 (100.0%)	3 (100.0%)	6 (100.0%)

SD: standard deviation; $n$ : number of cases; $\yen$ chi-square test; NS: not significant at $p$ > 0.05.

The distribution of CXCR1 (rs2234671) gene polymorphism was detected by using the ARMS-PCR technique. The genotype distribution had no deviation from Hardy-Weinberg equilibrium. The Hardy-Weinberg equation was used to analyse the distribution of the CXCR1-interleukin-8 receptor (rs2234671) genotypes (CC, CG, and GG) within the control group. The results of this analysis are presented in Table 3.5. The homozygous wild genotype CC was observed in 13 out of 20 control subjects. The heterozygous CG genotype was observed in 4 out of 20 control patients, whereas the homozygous mutant GG genotype was observed in 3 out of 20 control subjects (Table 6). The distribution of the control patients based on CXCR1-interleukin-8 receptor (rs2234671) genotypes did not show a significant difference compared to the expected distribution ( $P=$ 0.113).

3.5 Genotypic and alleles analysis for the studied gene in patients and healthy control

In Table 7 a comparison of the genotypes and allele frequencies for the CXCR1-interleukin-8 receptor SNP (rs2234671) between patients and healthy control individuals is presented. In the co-dominant mode, no significant difference in the frequency distribution of genotypes between the patients and control groups ( $p=$ 0.425) was detected. The risk analysis showed that individuals with the homozygous GG genotype exhibited a non-significant risk factor (OR $=$ 2.47), indicating that they are approximately two times more likely to develop the disease compared to individuals with other genotypes. Similarly, individuals with the heterozygous C/G genotype also possessed a non-significant risk factor with an odds ratio (OR) of 1.85. In terms of the examination of the dominant mode and the recessive mode, no statistically significant difference was observed between the patients and control groups ( $p<$ 0.05). Regarding the allele analysis, no statistically significant difference was recorded between the patients and control groups ( $P=$ 0.120).

Table 7
CXCR1-interleukin-8 receptor (rs2234671) genotype frequency in patients and healthy control

Mode	Genotype	Patients n $=$ 30	Control n $=$ 20	P	OR	95% CI
Co-dominant	GG	8 (26.7%)	3 (15.0%)	0.425 $\yen$	2.47	0.53–11.4
	C/G	8 (26.7%)	4 (20.0%)	NS	1.85	0.45–7.66
	CC	14 (46.6%)	13 (65.0%)		Reference
Dominant	GG $+$ C/G	16 (53.4%)	7 (35.0%)	0.202 $\yen$	Reference
	CC	14 (46.6%)	13 (65.0%)	NS	0.471	0.15–1.51
Recessive	GG	8 (26.7%)	3 (15.0%)	0.329 $\yen$	2.06	0.47–8.96
	C/G $+$ CC	22 (73.3%)	17 (85.0%)	NS	Reference
Alleles	G	24 (40.0%)	10 (25.0%)	0.120 $\yen$	2.0	0.82–4.83
	C	36 (60.0%)	30 (75.0%)	NS	Reference

$\yen$ Chi-square test; NS: not significant at $P>$ 0.05.

Table 8

Comparison of the frequency distribution of socio-demographic features of patients with repeated UTI based on the results of ARMS-PCR

Characteristic	CC genotype $n=$ 14	CG genotype $n=$ 8	GG genotype $n=$ 8	P
Age
Mean $\pm$ SD	34.78 $\pm$ 9.16	34.50 $\pm$ 14.8	38.25 $\pm$ 14.84	0.786 †NS
$>$ 30, $n$ (%)	4 (28.6%)	4 (50.0%)	2 (25.0%)	0.350 $\yen$
30–39, $n$ (%)	7 (50.0%)	1 (12.5%)	4 (50.0%)	NS
$\geqslant$ 40, $n$ (%)	3 (21.4%)	3 (37.5%)	2 (25.0%)
Gender
Male, $n$ (%)	6 (42.9%)	1 (12.5%)	3 (37.5%)	0.333 $\yen$
Female, $n$ (%)	8 (57.1%)	7 (87.5%)	5 (62.5%)	NS

$n$ : number of cases; SD: standard deviation; ^†: Anova test; $\yen$ Chi-square test; NS: not significant at $P>$ 0.05.

3.6 The comparison between ARMS-PCR findings according to socio-demographic characteristics in patients with repeated UTI

A comparison of the frequency distribution of socio-demographic features of patients with repeated UTI according to results of ARMS-PCR is presented in Table 8. The average age of patients with CC genotype CT genotype, and GG genotype was 34.78 $\pm$ 9.16, 34.50 $\pm$ 14.8 years and 38.25 $\pm$ 14.84, respectively. In addition, there was no significant association between the age and results of ARMS-PCR in both the frequency ( $p=$ 0.350) and mean age ( $p=$ 0.786). There was also no significant correlation between the sex and the results of ARMS-PCR ( $p=$ 0.333).

Table 9
Comparison between the ARMS-PCR findings according to the bacterial isolation results

Characteristic	Bacterial isolation results					p
	E. coli	P. mirabilis	E. faecalis	K. pneumonia	P. aeruginosa
Age (years)
CC, n (%)	9 (47.4%)	3 (37.5%)	4 (57.1%)	1 (33.3%)	4 (66.7%)	0.266 $\yen$
CG, n (%)	7 (36.8%)	2 (25.0%)	0	2 (66.7%)	0	NS
GG, n (%)	3 (15.8%)	3 (37.5%)	3 (42.9%)	0	2 (33.3%)
Total	19 (100.0%)	8 (100.0%)	7 (100.0%)	3 (100.0%)	6 (100.0%)

SD: standard deviation; $n$ : number of cases; $\yen$ chi-square test; NS: not significant at $p>$ 0.05.

3.7 The comparison between ARMS-PCR findings according to the bacterial isolation results

The frequency distribution of the ARMS-PCR findings in patients with recurrent urinary tract infections was compared based on the bacterial isolation results. The results are presented in Table 9. The current findings indicate that there was no statistically significant correlation between the ARMS-PCR findings and the outcomes of bacterial isolation ( $p=$ 0.266).

4. Discussion

According to epidemiology studies, the urinary tract infections studies are considered a common disease for different ages and gender [37, 38]. Nonetheless, there is a growing body of evidence suggesting that age has no influence on the infection of UTI. Taking into account that age could affect the renal functional exacerbation of the urinary system [39], it was recently found that there is no statistically significant disparity in the age distribution between patients and control subjects. However, this study only covered adult patients.

The sex of the patients’ group did not show any significant variation in the frequency distribution of patients and control groups. However, it affected women patients, which is in direct agreement with the respective works in the literature where it has been found that UTIs in women are more significant than men [40]. In any case, the clinical signs of bacterial infections in men are similar in women [41].

Equally important is also the fact that there is a strong correlation for patients between recurrent urinary tract infection and anatomical or functional abnormality of the urinary tract, and genetic factors [42, 43]. These cases have been recorded with children suffer from micturition and hypertension of urine, which may lead to different PH of urine and could be predisposed with the right conditions for bacterial infections and susceptibility to recurrence. Besides, in elderly women, in addition to young women, genetic factors may play a role in the recurrence of UTI and kidney diseases [44, 45, 46]. The frequency distribution of patients with recurrent infection did not show any significant differences between patients in this work, perhaps due to the variation in parameters and conditions.

It is also interesting to notice that in this work, the highest infection of the urinary system of the patients was Escherichia coli (63.3%), and more bacteria with less infected percentage were identified including Proteus mirabilis (26.7%), Enterococcus faecalis, Klebsiella pneumonia (10.0%) and Pseudomonas aeruginosa (20.0%) respectively. This outcome is also consistent with the literature [47, 48, 49]. This result confirmed that Escherichia coli is considered the underlying reason for the majority of patients with UTI. However, age, gender, and recurrent urinary tract infections among patients have not been associated with different species of bacteria.

The correlation between polymorphisms in the interleukin 8-receptor gene (CXCR1 and CXCR2) and urinary tract infection has been also examined by various works in the literature [50, 51], In this work, the study centers on the associations of the distribution of CXCR1-interleukin-8 receptor SNP (rs2234671) among patients in relation to age and gender were explored, and three genotypes CC, GC, GG and two alleles C and G were detected. Nevertheless, our result indicated that SNP (rs2234671) was not different among patients with UTI according to the age and gender even though our work was conducted on adult patients. In any case, it coincided with previous studies for children [52]. However, in another work for children in the literature, it was demonstrated that the CXCR1 +2608 C allele, AA genotype and A allele of the IL-8 SNP might increase the susceptibility to acute pyelonephritis [53, 54].

Furthermore, our work noticed that genotypes and alleles of interleukin 8-receptor (CXCR1) SNP (rs2234671) have no alterations between the group of patients suffering from UTI and the healthy subject, which confirmed that CXCR1-interleukin-8 receptor SNP (rs2234671) has no associated risk factor for susceptibility to UTI of patients [50]. However, this result contradicts the respective outcomes in the literature suggesting that the patient’s carrier of rs2234671 C allele has more risk of acute pyelonephritis for Iraqi women [33]. These controversies could be explained by taking into account that the different works in the literature do not study accompanied diseases of patients with UTI in relation to interleukin 8-receptor (CXCR1) SNP (rs2234671). Therefore, more parameters should be studied and compared to attain more reliable results. Furthermore, no piece of evidence in the present work confirmed that particular bacterial reasons have a risk factor and association with genotypes or any alleles of (CXCR1) SNP (rs2234671) among patients.

5. Conclusions

In this work, it was demonstrated that age and sex do not affect recurrent infection and UTI, and there are many bacteria that could be caused by UTI including Escherichia coli, Proteus mirabilis, Enterococcus faecalis, Klebsiella pneumonia and Pseudomonas aeruginosa. Correspondingly, CXCR1-interleukin-8 receptor SNP (rs2234671) does not reveal any risk factor for patients with UTI. While the finding mentions the non-significant association between CXCL1 (rs2234671) and UTI, it could be further enriched by exploring potential biological mechanisms that might explain this lack of association. For example, maybe there are other genetic factors or environmental influences that could be modulating the effect of CXCL1 on UTI susceptibility. So, the finding suggests further research is needed. It could be strengthened by providing specific recommendations for future studies, such as investigating the role of other CXCL1 polymorphisms, exploring gene-environment interactions, or focusing on specific subgroups of patients. However, further investigations are needed to better understand the underlying origins of UTIs. Sexual activity, hygiene practices, and underlying medical conditions could be explored in future research. Personalized risk assessment: Identifying individual risk factors beyond age and gender could help healthcare professionals tailor preventive strategies for patients susceptible to recurrent UTIs.

Footnotes

Acknowledgments

The authors would like to thank the staff members of Veterinary medicine College and College of Biotechnology college for their assistance. In addition, we intend to acknowledge the arbitrators for their sober understanding of the article and their insightfulness observation.

Conflict of interest

There is no conflict of interest to report.

Author contributions

HHN, MJK and HA – Conceptualisation; HHN, MJK and HA – Interpretation or analysis of data; HHN and MJK – Formal analysis and investigation; HHN – Resources, funding acquisition and supervision; HHN – Writing original draft preparation; HHN, MJK and HA – writing review and editing.

References

Schnarr

and Smaill

, Asymptomatic bacteriuria and symptomatic urinary tract infections in pregnancy, Eur J Clin Invest 38(2) (2008), 50–57.

Mody

and Juthani-Mehta

, Urinary tract infections in older women: a clinical review, JAMA 11(8) (2014), 844–854.

Tornic

et al., The Challenge of Asymptomatic Bacteriuria and Symptomatic Urinary Tract Infections in Patients with Neurogenic Lower Urinary Tract Dysfunction, J Urol 203(3) (2020), 579–584.

Czajkowski

Broś-Konopielko

and Teliga-Czajko-wska

, Urinary tract infection in women, Prz Menopauzalny 20(1) (2021), 40–47.

Dielubanza

E.J.

and Schaeffer

A.J.

, Urinary tract infections in women, Med Clin North Am 95(1) (2011), 27–41.

Firoozeh

et al., Detection of virulence genes in Escherichia coli isolated from patients with cystitis and pyelonephritis, Int J Infect Dis 29 (2014), 219–222.

Moreno

et al., Relationship between Escherichia coli strains causing acute cystitis in women and the fecal E. coli population of the host, J Clin Microbiol 46(8) (2008), 2529–2534.

Fihn

S.D.

Johnson

and Stamm

W.E.

, Escherichia coli urethritis in women with symptoms of acute urinary tract infection, J Infect Dis 157(1) (1988), 196–199.

Dan

et al., Sexually transmitted Escherichia coli urethritis and orchiepididymitis, Sex Transm Dis 39(1) (2012), 7–16.

10.

Armbruster

C.E.

Mobley

H.L.T.

and Pearson

M.M.

, Pathogenesis of Proteus mirabilis Infection, EcoSal Plus 8(1) (2018), doi: 10.1128/ecosalplus.ESP-0009-2017.

11.

Chen

C.Y.

et al., Proteus mirabilis urinary tract infection and bacteremia: risk factors, clinical presentation, and outcomes, J Microbiol Immunol Infect 45(3) (2012), 228–236.

12.

Schaffer

J.N.

and Pearson

M.M.

, Proteus mirabilis and urinary tract infections. Urinary tract infections: Molecular pathogenesis and clinical management, (2017), 383–433.

13.

Dumanski

A.J.

et al., Unique ability of the Proteus mirabilis capsule to enhance mineral growth in infectious urinary calculi, Infect Immun 62(7) (1994), 2998–3003.

14.

Zeng

et al., Optimal perioperative antibiotic strategy for kidney stone patients treated with percutaneous nephrolithotomy, Int J Infect Dis 97 (2020), 162–166.

15.

Palmer

K.L.

et al., Comparative genomics of enterococci: variation in Enterococcus faecalis, clade structure in E. faecium, and defining characteristics of E. gallinarum and E. casseliflavus, mBio 3(1) (2012), e00318–11.

16.

Fisher

and Phillips

, The ecology, epidemiology and virulence of Enterococcus, Microbiology (Reading) 2009, pp. 1749–1757.

17.

Kafil

H.S.

and Mobarez

A.M.

, Spread of Enterococcal Surface Protein in Antibiotic Resistant Entero-coccus faecium and Enterococcus faecalis isolates from Urinary Tract Infections, Open Microbiol J 9 (2015), 7–14.

18.

Lee

, Ciprofloxacin Resistance in Enterococcus faecalis Strains Isolated From Male Patients With Complicated Urinary Tract Infection, Korean J Urol 54(6) (2013), 388–393.

19.

Vanek

N.N.

et al., Enterococcus faecalis aggregation substance promotes opsonin-independent binding to human neutrophils via a complement receptor type 3-mediated mechanism, FEMS Immunol Med Microbiol 26(1) (1999), 49–60.

20.

Tendolkar

P.M.

Baghdayan

A.S.

and Shankar

, Pathogenic enterococci: new developments in the 21st century, Cell Mol Life Sci 60(12) (2003), 2622–2636.

21.

Leal

S.M.

Jones

and Gilligan

P.H.

, Clinical Significance of Commensal Gram-Positive Rods Routinely Isolated from Patient Samples, J Clin Microbiol 54(12) (2016), 2928–2936.

22.

Mahabubul Islam Majumder

Md.

et al., Microbiology of Catheter Associated Urinary Tract Infection [Internet]. Microbiology of Urinary Tract Infections – Microbial Agents and Predisposing Factors, IntechOpen; 2019.

23.

Zilberberg

M.D.

and Shorr

A.F.

, Secular trends in gram-negative resistance among urinary tract infection hospitalizations in the United States, 2000–2009, Infect Control Hosp Epidemiol 34(9) (2013), 940–946.

24.

Vaghasiya

and Chanda

, Screening of some traditionally used Indian plants for antibacterial activity against Klebsiella pneumonia , J Herb Med Toxicol 3(2) (2009), 161–164.

25.

Paneru

T.P

, Surveillance of Klebsiella pneumoniae and antibiotic resistance a retrospective and comparative study through a period in Nepal, Danish J. Med. Biol. Sci, (2015), 29–36.

26.

Podschun

and Ullmann

, Klebsiella spp. as nosocomial pathogens: epidemiology, taxonomy, typing methods, and pathogenicity factors, Clinical Microbiology Reviews 11(4) (1998), 589–603.

27.

Piperaki

E.T.

et al., Klebsiella pneumoniae: virulence, biofilm and antimicrobial resistance, The Pediatric Infectious Disease Journal 36(10) (2017), 1002–1005.

28.

et al., Molecular pathogenesis of Klebsiella pneumoniae Future Microbiology 9(9) (2014), 1071–1081.

29.

Wang

et al., The characteristic of virulence, biofilm and antibiotic resistance of Klebsiella pneumoniae , International Journal of Environmental Research and Public Health, 17(17) (2020), 6278.

30.

Lagha

et al., Antibacterial and biofilm inhibitory activity of medicinal plant essential oils against Escherichia coli isolated from UTI patients, Molecules 24(6) (2019), 1161.

31.

Magliano

et al., Gender and age-dependent etiology of community-acquired urinary tract infections, The Scientific World Journal 26 (2012).

32.

Gerger

et al., Pharmacogenetic angiogenesis profiling for first-line Bevacizumab plus oxaliplatin-based chemotherapy in patients with metastatic colorectal cance, Clinical Cancer Research 17(17) (2011), 5783–5792.

33.

Abbas

H.M.

and Al-Mathkhury

H.J.

, Association between the rs2234671 polymorphism and the risk of recurrent urinary tract infections in Iraqi women, Meta Gene 26 (2020), 100763.

34.

Gallegos-Arreola

M.P

et al., The rs1008562, rs2234671, and rs3138060 polymorphisms of the CXCR1 gene are associated with breast cancer risk in a Mexican population, European Review for Medical & Pharmacological Sciences 24(19) (2020).

35.

Lurje

et al., Genetic variant of CXCR1 (rs2234671) associates with clinical outcome in perihilar cholangiocarcinoma, Liver Cancer 11(2) (2022), 162–173.

36.

Wang

et al., Genetic association of polymorphism rs2230054 in CXCR2 gene with gout in Chinese Han male population, Central European Journal of Immunology 45(1) (2020), 80–85.

37.

Gond

D.P.

Singh

and Agrawal

N.K.

, Testing an association between TLR4 and CXCR1 gene polymorphisms with susceptibility to urinary tract infection in type 2 diabetes in north Indian population, Gene 641 (2018), 196–202.

38.

Han

S.S.

et al., Association between interleukin 8-receptor gene (CXCR1 and CXCR2) polymorphisms and urinary tract infection: evidence from 4097 subjects, Nephrology 24(4) (2019), 464–471.

39.

Lurje

et al., Genetic variant of CXCR1 (rs2234671) associates with clinical outcome in perihilar cholangiocarcinoma, Liver Cancer 11(2) (2022), 162–73.

40.

Hellström

et al., Association between urinary symptoms at 7 years old and previous urinary tract infection, Archives of Disease in Childhood 66(2) (1991), 232–234.

41.

Smellie

J.M.

Rigden

S.P.

and Prescod

N.P.

, Urinary tract infection: a comparison of four methods of investigation, Archives of Disease in Childhood 72(3) (1995), 247–250.

42.

Berg

U.B.

and Johansson

S.B.

, Age as a main determinant of renal functional damage in urinary tract infection, Archives of disease in childhood. 58(12) (1983), 963–969.

43.

Kolawole

A.S.

et al., Prevalence of urinary tract infections (UTI) among patients attending Dalhatu Araf Specialist Hospital, Lafia, Nasarawa state, Nigeria, International Journal of Medicine and Medical Sciences 1(5) (2009), 163–167.

44.

Lipsky

B.A.

, Urinary tract infections in men: epidemiology, pathophysiology, diagnosis, and treatment, Annals of Internal Medicine 110(2) (1989), 138–150.

45.

Sheerin

N.S.

, Urinary tract infection, Medicine 39(7) (2011), 384–389.

46.

Medina

and Castillo-Pino

, An introduction to the epidemiology and burden of urinary tract infections, Therapeutic Advances in Urology 11 (2019), 1756287219832172.

47.

Scholes

et al., Risk factors for recurrent urinary tract infection in young women, The Journal of Infectious Diseases 182(4) (2000), 1177–1182.

48.

Dwyer

P.L.

and O’Reilly

, Recurrent urinary tract infection in the female, Current Opinion in Obstetrics and Gynecology 14(5) (2002), 537–543.

49.

Hooton

T.M.

, Recurrent urinary tract infection in women, International Journal of Antimicrobial Agents 17(4) (2001), 259–268.

50.

Johnson

J.R.

, Virulence factors in Escherichia coli urinary tract infection, Clinical Microbiology Reviews 4(1) (1991), 80–128.

51.

Naqid

I.A.

et al., Bacterial strains and antimicrobial susceptibility patterns in male urinary tract infections in Duhok province, Iraq, Middle East Journal of Rehabilitation and Health Studies 7(3) (2020).

52.

Farrell

et al., A UK multicentre study of the antimicrobial susceptibility of bacterial pathogens causing urinary tract infection, Journal of Infection, 46(2) (2003), 94–100.

53.

Hussein

et al., Impact of cytokine genetic polymorphisms on the risk of renal parenchymal infection in children, Journal of Pediatric Urology 13(6) (2017), 593–e1.

54.

Javor

et al., Genetic variations of interleukin-8, CXCR1 and CXCR2 genes and risk of acute pyelonephritis in children, International Journal of Immunogenetics 39(4) (2012), 338–345.

55.

Cheng

C.H.

et al., Genetic polymorphisms and susceptibility to parenchymal renal infection among pediatric patients, The Pediatric Infectious Disease Journal 30(4) (2011), 309–314.