Aging as a Precipitating Factor in Chronic Restraint Stress-Induced Tau Aggregation Pathology,and the Protective Effects of Rosmarinic Acid

Animals and chronic restraint stress

Adult (6 months) and middle-aged (13 months) male C57BL/6 mice were from the Shanghai Experimental Animal Center of the Chinese Academy of Science, and housed in a 12 h light/dark cycle with food and water ad libitum. All animal experiments were performed according to the Guide for the Care and Use of Medical Laboratory Animals and the guidelines of the Shanghai Medical Laboratory Animal Care and Use Committee. The chronic restraint stress method was modified according to procedures described previously [29]. Repeated stress involved placing mice in 50 ml conical tubes with holes for ventilating, 30 min each day for 18 consecutive days. The stress environment was a room with the same temperature, illumination, and background noise as the animal house. Nonstressed control mice were housed with same-sex littermates and were transported to/from testing rooms but were not otherwise handled.

Rosmarinic acid (Aladdin, China), a primary constituent of a Chinese herbal medicine, purity 97% , was dissolved in saline. Mice were administered an intraperitoneal injection of RA (2 mg/kg) or saline 30 min before chronic restraint stress.

Antibodies

The following primary antibodies were used: AT8 (Thermo Scientific, USA); PS396 and Tau-5 (Invitrogen, USA); Thr181, Ubiquitin and HDJ2 (Abcam, USA); β-actin, GAPDH, tubulin and FLAG (Santa Cruz, USA); CRF and CRFR1 (Bioworld, USA); Pin1 and HSP90 (Cell Signaling Technology, USA); TCP1α (Proteintech, USA); HSP70 and HSC70 (Affbiotech, USA).

Different soluble fractions of brain tissues

20 min after last stress treatment, mice were anesthetized with chloral hydrate (40 mg/kg) and decapitated. Cerebral cortex was homogenized in reassembly buffer (RAB: 0.1 M MES, pH 7.6, 0.75 M NaCl, 1 mM EGTA, 0.5 mM MgSO₄, 2 mM NaF, 2 mM PMSF, and protease inhibitors) at 4°C. Aliquot parts of homogenized samples were retained for analyses the protein expression and phosphorylation as total protein. To determine tau solubility, sequential fractionation procedures were performed which was modified according to described previously [30, 31, 30, 31]. RAB homogenized samples were centrifuged at 40,000 × g for 40 min at 4°C. The supernatants as RAB soluble fractions were collected. The pellets were extracted with Radio-Immunoprecipitation Assay Buffer (RIPA: 50 mM Tris-HCl, pH 7.4, 0.1% SDS, 1% NP-40, 0.25% sodium deoxycholate, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA and protease inhibitors) at 4°C, centrifuged at 40,000 × g for 20 min to obtain detergent soluble fractions. The RIPA-insoluble pellets were extracted at 4°C with SDS buffer (100 mM Tris-HCl, pH7.0, 4% SDS, 20% glycerol, 1%  Triton X-100 and protease inhibitors). After centrifuging at 25,000 × g for 60 min, the supernatants were collected as SDS soluble fraction. SDS insoluble pellets were washed once with phosphate-buffered saline (PBS) by centrifuged at 25,000 × g for 60 min. Collected pellets were solubilized in 70% formic acid (FA) by sonication to recover the most insoluble proteins named FA soluble fraction.

Immunoblotting

The protein concentrations were determined using the bicinchoninic acid Protein Assay Kit (Beyotime, China). Laemmli sample buffer was added, then samples were heated to 100°C for 5 min. Equal amounts of protein were separated by SDS-PAGE electrophoresis and transferred to nitrocellulose membranes(Millipore, USA). The membranes were incubated with blocking buffer (Odyssey, USA) for 1 h at room temperature (RT) and then incubated with primary antibodies overnight at 4°C. After washing with TBST (Tris-buffered saline with 0.1% Tween),IRDye-labeled secondary antibodies (LI-COR, USA) were applied for 1 h at RT. After 3 additional washes, blots were scanned and analyzed by the Odyssey IR Imaging System (Li-COR, USA).

Immunoprecipitation of FA soluble fraction

The SDS insoluble pellets were washed with PBS, and then extracted in 70% FA and sonicated till clarified. After FA evaporating by vacuum freeze-drying, samples were dissolved in IP buffer (50 mM Tris-HCl, 150 mM NaCl, 0.5 mM EGTA, 1 mM Na₃VO₄, 1 mM NaF, pH 7.6) with 30% acetonitrile. After standing at RT for 1 h, the aqueous phase would separate from organic phase. The aqueous phases were collected and dialyzed against IP buffer without acetonitrile. The dialyzed samples were pre-cleared with Protein A/G agarose beads (Roche, US), then ubiquitin antibody was added at the concentration of 5 μg/ml and incubated overnight at 4°C. Protein A/G agarose beads were added to capture the ubiquitinated proteins. Immunoprecipitated proteins and the dialyzed samples treated with or without immunoprecipitation were subject to western blot analysis with AT8 antibody.

Immunohistochemistry

Mice were deeply anesthetized with 10% chloral hydrate and perfused through the heart with 0.9% saline, followed by 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.2). Brains were removed and post-fixed in 4% paraformaldehyde overnight and coronal brain sections of hippocampal tissue were cut at 30 μm with a freezing microtome (Leica, Germany). Sections were blocked with normal goat serum (NGS, 10% ) diluted in PBS (pH 7.4), then incubated with AT8 antibody diluted in PBS containing 1% NGS and 0.2% Triton X-100 overnight at 4°C. Following several washes in PBS, sections were incubated with anti-mouse IgG antibody conjugated to horseradish peroxidase for 10 min at RT. Following additional washes, sections were developed with diaminobenzidine chromogen (Superpicture kit, Invitrogen, CA) for 5 min.

Immunoelectron microscopy

The SDS insoluble fractions were examined by immunogold electron microscopy to probe the structural changes of tau. SDS insoluble fractions were extensively dialyzed against distilled water in 50-kDa cut-off dialysis tubing. Preparations were suspended in 25 mM ammonium bicarbonate and added to copper grids coated with a thin layer of carbon. Grids were exposed for 60 min to blocking buffer (PBS containing 0.1% fish gelatin) and then incubated with antibody AT8 overnight. Immunogold-labeled secondary antibody (12 nm gold, Jackson, USA) was applied for 2 h at RT and the protein structure was examined using a JEOL 100CXII transmission electron microscope. Images were captured with a MegaView III digital camera.

Cell culture, transfection and treatment

HEK293 cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM, Invitrogen, USA), supplemented with 10% fetal bovine serum (Invitrogen), 100 U/ml penicillin, and 100 μM streptomycin (Invitrogen) at 37°C in a 5% CO₂ humidified atmosphere and then passaged every 3-4 days. For siRNA experiment, cells were planted in 60 mm plates and transfected with human gene-specific validated and genome-wide siRNAs (Pin1, GCCATTTGAAGACGCCTCGTT; HDJ2/HSP40, GATATCAAGTGTGTACTAAAT) using Lipofectamine ^® RNAiMAX Reagent (Invitrogen) according to the manufacturer’s instructions. Forty-eight hours later, transfection of the 3 × FLAG tagged human tau441 plasmid were carried out using Lipofectamine ^® 3000 Reagent (Invitrogen). The final siRNA and plasmid used per dish were 25 pmol and 2.5/5 μg, respectively. Then, the cells were harvested for immunoblotting analysis 24 h later.

PC12 cells were grown in DMEM supplemented with 5% fetal calf serum, 15% horse serum. Cells were seeded into petri dishes (10-cm diameter) at a density of 1 × 10⁶ cells/ml and cultured 24 h at 37°C. Thereafter, the medium was replaced with fresh medium, and cells were treated with fAβ_1 - 42 (0.25 μmol/L, ChinaPeptides, China) in the absence or presence of rosmarinic acid (1 × 10^–4~10^–6), both given 10 min before Aβ₄₂. The concentration of Aβ₄₂ was selected based on previous report, which produced a submaximal effect on cell viability and reactive oxygen species formation [32]. At 24 h after Aβ treatment, cells were harvested and subjected to immunoblotting analysis.

Statistical analysis

Integrated intensity readings from immunoblotting were analyzed with Prism5.0 (GraphPad Software, San Diego, CA). Integrated intensities of target proteins were normalized to control protein, in some analysis P-tau also normalized to total tau labeled by antibody tau-5, then the data were expressed as the “fold of control” and presented as mean ± standard error of the mean (SEM). Statistical analysis was determined by unpaired two-tailed Student’s t-test. A value of p <  0.05 was considered to be statistically significant.

Effects of chronic restraint stress on tau phosphorylation in brain of mice with different ages

Our previous studies found chronic restraint stress (CRS)-induced tau phosphorylation in cerebral cortex and hippocampus [17]. To investigate the effects of aging on CRS-induced tau phosphorylation, 6- and 13-month-old mice were used as adult and middle-aged mice in this study [33]. The homogenates of cerebral cortex were analyzed by western blotting with antibodies AT8 (recognizing Ser202/Thr205), PS396, and Thr181. Results showed the basal levels of P-tau in homogenates of cerebral cortex from control middle-aged mice detected by AT8 and PS396 antibodies were higher than those from control adult mice, while the P-tau-Thr181 in control middle-aged mice did not significantly increase comparing that in adult mice (Fig. 1).

After 18 consecutive daily exposures to a 30-min restraint stress, P-tau raised in both adult and middle-aged mice, but differentially. For middle-aged mice, P-tau-Ser396 significantly increased (p <  0.001), whereas P-tau-Ser202/Thr205 and P-tau-Thr181 in stressed mice were tended to increase but not significant. For adult mice, the significant increases of P-tau-Ser202/Thr205 and P-tau-Ser396 were observed after chronic stress (p <  0.01, p <  0.05), respectively, comparing those in control mice, while the increase of P-tau-Thr181 was not significant. In addition, the levels of P-tau in stressed middle-aged mice also tended to increase comparing those in stressed adult mice (Fig. 1).

Effects of chronic restraint stress on the solubility of phosphorylated tau in brain of mice with different ages

To investigate the effect of aging on stress caused insolubility of tau, tau in cerebral cortex was sequentially extracted as described in methods. Results showed that the P-tau tended to increase in RAB soluble fraction after CRS for both adult and middle-aged mice, among which the increases of P-tau-Ser396 were significant in middle-aged mice, and all detected P-tau were significantly elevated in adult mice (Fig. 2A).

In detergent soluble fraction, P-tau-Ser396, P-tau-Thr181, and Tau-5 labeled tau decreased significantly in middle-aged mice after CRS. In contrast, in adult mice AT8-labeled P-tau-Ser202/Thr205 still increased, while Tau-5-labeled tau decreased (Fig. 2B). In SDS soluble fraction, the change tendency of P-tau and total tau showed a decrease except an increase of P-tau-Ser202/Thr205 in adult mice (Fig. 2C).

In above results, no significant increase of P-tau-Ser202/Thr205 in middle-aged mice after CRS was found in homogenates, and sequential extracts. Therefore, to further evaluate AT8-labeled P-tau in stressed middle-aged mice, we analyzed FA soluble fractions extracted from SDS insoluble materials. Results showed a dramatic elevated P-tau-Ser202/Thr205 in samples from stressed middle-aged mice, although the increase also observed in stressed adult mice but the increase level was not so dramatic. In addition, a trend of increased P-tau-Ser396 and Tau-5-labeled tau in FA fractions also appeared both in adult and middle-aged mice (Fig. 3A). Therefore CRS could induce the insolubility of tau, especially for P-tau-Ser202/Thr205 in middle-aged mice.

Because AT8-labeled tau in the FA fraction from stressed middle-aged mice appeared in a smear pattern at high molecule weight in immunoblots, we supposed that these AT8-labeled tau might be ubiquitinated. Therefore, immunoprecipation was conducted to analyze FA fractions. As expected, captured ubiquitin-decorated proteins really contained AT8-positive tau, which also appeared in a smear pattern at high molecule weight in immunoblots (Fig. 3B).

Structural phenotype of SDS insoluble AT8-labeled phosphorylated tau after chronic restraint stress

NFTs consist of P-tau formed PHFs in AD brain. PHFs can be imaged by transmission electron microscopy of ultrathin sections or extracts of the AD brain [34, 35]. We used similar methods to image cerebral SDS-insoluble fractions. In samples from control middle-aged mice, some sparsely scattered or amorphous structures labeled by immunogold with AT8 were detected (Fig. 4D). In samples from CRS middle-aged mice, although no typical PHF was found, we did observe that some aggregates consisting of filament like structures beside amorphous structures could be decorated by immunogold with AT8 (Fig. 4A–C), confirming the presence of aggregated P-tau after CRS stimulation in older mice. Moreover, we found an increase of AT8 staining in cerebral cortex of middle-aged or adult mice after CRS, but no NFT accumulation was observed (Fig. 4G–N). The immunblotting analysis of total protein sample from middle-aged mice did not show an increase of AT8-labeled tau, and the increase in immunohistochemical staining might be due to its including the SDS insoluble tau which could not be resolved by SDS-PAGE electrophoresis.

Effects of chronic restraint stress on CRF and CRFR1 expression

The effects of CRS on tau phosphorylation, solubility and aggregation have been found related to corticotrophin releasing factor (CRF) and corticotrophin releasing factor receptor1 (CRFR1) [29, 36]. However, the analysis of CRF in this study showed that it did not increase in 6-month-old mice, and even slightly decreased in some 13-month-old mice, although not statistically significant (p > 0.05). Meanwhile CRFR1 appeared to have a tendency toward downregulation both in 6- and 13-month-old mice (Fig. 3C).

Chronic restraint stress and aging on chaperone proteins

To further evaluate the reason for tau prone to deposition affected by CRS and/or aging, we analyzed some proteins that take roles in modulation of tau aggregation, including chaperones and peptidylprolyl cis/trans isomerase Pin1. Results showed that the basal levels of chaperones such as HSP70, HSC70, HSP90, and HDJ2/HSP40 in cortex of middle-aged mice were lower than those of adult mice. Moreover, after CRS stimulation these chaperones appeared to decrease, or have a tendency to decrease in both adult and middle-aged mice (Fig. 5A–E). Interestingly, there were nearly no clear bands of HDJ2 in stressed mice at middle-age (Fig. 5A). To determine whether HDJ2 knockdown (KD) affects protein stability of tau, 293 cells were transfected with siRNA of HDJ2 and tau expression construct. Indeed, HDJ2 KD increased tau level (Fig. 5H).

For the TCP1 complex (also known as the TCP1 ring complex), here, we detected the subunit α and found that the basal level of TCPα in middle-aged mice was also significantly lower than that in adult mice, but the CRS induced a slight increase of TCP1α both for adult and middle-aged mice (Fig. 5A, G). In addition, the detection of Pin1 showed no significant difference between control mice with different ages. However, the level of Pin1 decreased significantly after CRS in middle-aged mice (p <  0.05), but not in adult mice (Fig. 5A, F). Evidence implicating Pin1 in regulating tau processing already exists. To prove this, we manipulated Pin1 KD with siRNA which also showed the increase of tau and P-tau (Fig. 5H). Therefore, the effects of CRS on tau phosphorylation and accumulation in aging processing might be related to the deficiency of Pin1 and chaperone proteins.

Rosmarinic acid inhibits tauopathy induced by chronic restraint stress

RA could inhibit Aβ-induced tau phosphorylation [26, 27]. To explore the interference of stress-induced tauopathy, we evaluated the effects of RA. Results showed that the treatment with RA (2 mg/kg ip daily) significantly compromised CRS-induced tau phosphorylation in both adult and middle-aged mice (Fig. 6). Moreover, it also prominently inhibited tau insolubility as indicated by FA fraction analysis (Fig. 7). In particular, the stress-induced AT8-labeled tau in middle-aged mice was effectively attenuated byRA treatment.

For middle-aged mice, the analysis of chaperone proteins and Pin1 revealed that RA could significantly reverse the CRS-induced decrease of Pin1, HDJ2/HSP40, HSC70, and HSP90, whereas slightly promoted the CRS-induced increase of TCP-1α. Of note, the protective effects of RA on CRS-induced changes of chaperone proteins in adult mice also presented, but were relatively limited compared with those in middle-aged mice (Fig. 8A, B). Therefore, RA might be useful to relieve the stress-induced tauopathy particularly for middle-aged subjects.

To explore whether RA could directly regulate tau phosphorylation and the expression of HSPs and Pin1, PC12 cells were treated with Aβ₄₂ and with/without RA. We found that RA compromised Aβ-induced tau phosphorylation (Fig. 8C), but did not affect the levels of HSPs and Pin1 with various concentrations (1 × 10^–4 ∼10^–6 mol/L), except that high concentration (1 × 10^–4 mol/L) of RA downregulated HSC70 (Fig. 8D). These results suggested that RA might act on the upstream mechanisms of stress and aging to regulate the expression of HSPs and Pin1.