Abstract
Stress is an important risk factor of Alzheimer’s disease (AD). It has been evidenced that stress could induce tau phosphorylation and increase tau insolubility in brain; however, little is known about the interactional effect of stress with aging on tauopathy. Therefore, we explored the effects of aging on stress-induced tauopathy and the potential mechanism in mouse model of chronic restraint stress (CRS). Here we found that in general, the level of phosphorylated tau (P-tau) was higher in brain of middle-aged mice than that in adult mice under physiological conditions. CRS-induced tau phosphorylation and its insolubility were more prominent in middle-aged mice. The increase of AT8-labeled insoluble P-tau was dramatic in middle-aged mice, which was highly ubiquitinated but did not form PHF structures. The levels of chaperones were relatively lower in middle-aged mice brain; CRS further reduced the expression, especially for HDJ2/HSP40. CRS also suppressed the expression of Pin1, the peptidylprolyl cis/trans isomerase, in middle-aged mice but not in adult mice. Downregulation of HSP40 or Pin1 caused an increase of transfected extraneous tau in 293 cells. Rosmarinic acid (RA) could effectively suppress the elevation of P-tau and insoluble P-tau formation induced by CRS, and reversed the abnormal changes of chaperones and Pin1 particularly in middle-aged mice. Taken together, our findings provided evidence that aging could be a promoting factor in stress-induced tauopathy, which was relevant with malregulation of chaperones and Pin1, and RA might be a promising beneficial agent for stress-induced tauopathy.
INTRODUCTION
Alzheimer’s disease (AD) is characterized clinically as a progressive dementia, with pathological markers of senile plaques and neurofibrillary tangles(NFTs) consisting of amyloid-β peptides (Aβ) and hyperphosphorylated microtubule-associated protein tau, respectively. Tau has the ability to bind and stabilize microtubules physiologically, however, hyperphosphorylated tau reduces its binding with microtubules and self-aggregates to form insoluble paired helical filaments (PHFs), which comprise NFTs [1, 2]. Tau protein may play a crucial role in the cognitive decline in AD, because the elevation of NFTs number positively correlates with the duration and severity of AD [3].
Familial forms of AD involve mutations in several genes, such as amyloid-β protein precursor (AβPP) and presenilins (PS1and PS2), which cause the overdosage of Aβ. However, the majority of AD cases are of sporadic origin with age as the primary risk factor [4], and the interactions among aging, environmental, and genetic factors lead to the sensitivity of developing AD [5, 6]. Exposure to stressful events can lead to consequences for learning impairment and neurodegeneration [7–9]. People vary in their response to stressful events, and those vulnerable to adverse outcomes exhibit negative affectivity or distress proneness. Epidemiological evidence has confirmed that patients with distress proneness are 2.7 times more likely to develop AD than those not prone to distress, and this trait is also associated with a more rapid progression of the disease [10–13], indicating stress as an important risk factor for AD. Recent experimental studies also have focused on AD-related pathological alterations induced by stress, and shown that adverse stress not only exacerbates impairments in learning but also causes an earlier onset of neurological symptoms in several rodent models of AD. Interestingly, the increase of phosphorylated tau (P-tau) in brain caused by stress stimulation not only appeared in AD transgenic mice but also evidently in wild type animals [14–16]. These studies suggest stress conferring risk for the pathogenesis of sporadic AD.
We previously reported repeated exposure to an emotional stressor, physical restraint, inducing tau phosphorylation in rat brain [17]. Aging is the primary risk factor for developing AD and the aged brain is more vulnerable to chronic stress [18]. However, the interplay between stress and aging in the progression of tau pathology is still unclear. In present research, we extended to study the potential combinatorial effects of aging and chronic stress on tau phosphorylation and its insolubility that infer the aggregation of tau, and to explore the levels of chaperone proteins and Pin1 (Peptidylprolyl cis/trans isomerase, NIMA-interacting 1), which are potentially involved in the mechanism of tauopathy [19–24]. Rosmarinic acid (a-O-caffeoyl-3, 4-dihydroxyphenyl-lactic acid; RA) is naturally occurring hydroxylated compound, a polyphenolic ingredient of Perillae Herba known to generate healthy and beneficial effects. Several RA biological activities have been found including anti-Aβ-induced neuronal toxicity and tauopathy, antidepressant, and antioxidant [25–28]. In this study, we tested the effects of RA on stress-induced tau phosphorylation and aggregation, and on the expressions of chaperone proteins and Pin1.
MATERIALS AND METHODS
Animals and chronic restraint stress
Adult (6 months) and middle-aged (13 months) male C57BL/6 mice were from the Shanghai Experimental Animal Center of the Chinese Academy of Science, and housed in a 12 h light/dark cycle with food and water ad libitum. All animal experiments were performed according to the Guide for the Care and Use of Medical Laboratory Animals and the guidelines of the Shanghai Medical Laboratory Animal Care and Use Committee. The chronic restraint stress method was modified according to procedures described previously [29]. Repeated stress involved placing mice in 50 ml conical tubes with holes for ventilating, 30 min each day for 18 consecutive days. The stress environment was a room with the same temperature, illumination, and background noise as the animal house. Nonstressed control mice were housed with same-sex littermates and were transported to/from testing rooms but were not otherwise handled.
Rosmarinic acid (Aladdin, China), a primary constituent of a Chinese herbal medicine, purity 97% , was dissolved in saline. Mice were administered an intraperitoneal injection of RA (2 mg/kg) or saline 30 min before chronic restraint stress.
Antibodies
The following primary antibodies were used: AT8 (Thermo Scientific, USA); PS396 and Tau-5 (Invitrogen, USA); Thr181, Ubiquitin and HDJ2 (Abcam, USA); β-actin, GAPDH, tubulin and FLAG (Santa Cruz, USA); CRF and CRFR1 (Bioworld, USA); Pin1 and HSP90 (Cell Signaling Technology, USA); TCP1α (Proteintech, USA); HSP70 and HSC70 (Affbiotech, USA).
Different soluble fractions of brain tissues
20 min after last stress treatment, mice were anesthetized with chloral hydrate (40 mg/kg) and decapitated. Cerebral cortex was homogenized in reassembly buffer (RAB: 0.1 M MES, pH 7.6, 0.75 M NaCl, 1 mM EGTA, 0.5 mM MgSO4, 2 mM NaF, 2 mM PMSF, and protease inhibitors) at 4°C. Aliquot parts of homogenized samples were retained for analyses the protein expression and phosphorylation as total protein. To determine tau solubility, sequential fractionation procedures were performed which was modified according to described previously [30, 31, 30, 31]. RAB homogenized samples were centrifuged at 40,000 × g for 40 min at 4°C. The supernatants as RAB soluble fractions were collected. The pellets were extracted with Radio-Immunoprecipitation Assay Buffer (RIPA: 50 mM Tris-HCl, pH 7.4, 0.1% SDS, 1% NP-40, 0.25% sodium deoxycholate, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA and protease inhibitors) at 4°C, centrifuged at 40,000 × g for 20 min to obtain detergent soluble fractions. The RIPA-insoluble pellets were extracted at 4°C with SDS buffer (100 mM Tris-HCl, pH7.0, 4% SDS, 20% glycerol, 1% Triton X-100 and protease inhibitors). After centrifuging at 25,000 × g for 60 min, the supernatants were collected as SDS soluble fraction. SDS insoluble pellets were washed once with phosphate-buffered saline (PBS) by centrifuged at 25,000 × g for 60 min. Collected pellets were solubilized in 70% formic acid (FA) by sonication to recover the most insoluble proteins named FA soluble fraction.
Immunoblotting
The protein concentrations were determined using the bicinchoninic acid Protein Assay Kit (Beyotime, China). Laemmli sample buffer was added, then samples were heated to 100°C for 5 min. Equal amounts of protein were separated by SDS-PAGE electrophoresis and transferred to nitrocellulose membranes(Millipore, USA). The membranes were incubated with blocking buffer (Odyssey, USA) for 1 h at room temperature (RT) and then incubated with primary antibodies overnight at 4°C. After washing with TBST (Tris-buffered saline with 0.1% Tween),IRDye-labeled secondary antibodies (LI-COR, USA) were applied for 1 h at RT. After 3 additional washes, blots were scanned and analyzed by the Odyssey IR Imaging System (Li-COR, USA).
Immunoprecipitation of FA soluble fraction
The SDS insoluble pellets were washed with PBS, and then extracted in 70% FA and sonicated till clarified. After FA evaporating by vacuum freeze-drying, samples were dissolved in IP buffer (50 mM Tris-HCl, 150 mM NaCl, 0.5 mM EGTA, 1 mM Na3VO4, 1 mM NaF, pH 7.6) with 30% acetonitrile. After standing at RT for 1 h, the aqueous phase would separate from organic phase. The aqueous phases were collected and dialyzed against IP buffer without acetonitrile. The dialyzed samples were pre-cleared with Protein A/G agarose beads (Roche, US), then ubiquitin antibody was added at the concentration of 5 μg/ml and incubated overnight at 4°C. Protein A/G agarose beads were added to capture the ubiquitinated proteins. Immunoprecipitated proteins and the dialyzed samples treated with or without immunoprecipitation were subject to western blot analysis with AT8 antibody.
Immunohistochemistry
Mice were deeply anesthetized with 10% chloral hydrate and perfused through the heart with 0.9% saline, followed by 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.2). Brains were removed and post-fixed in 4% paraformaldehyde overnight and coronal brain sections of hippocampal tissue were cut at 30 μm with a freezing microtome (Leica, Germany). Sections were blocked with normal goat serum (NGS, 10% ) diluted in PBS (pH 7.4), then incubated with AT8 antibody diluted in PBS containing 1% NGS and 0.2% Triton X-100 overnight at 4°C. Following several washes in PBS, sections were incubated with anti-mouse IgG antibody conjugated to horseradish peroxidase for 10 min at RT. Following additional washes, sections were developed with diaminobenzidine chromogen (Superpicture kit, Invitrogen, CA) for 5 min.
Immunoelectron microscopy
The SDS insoluble fractions were examined by immunogold electron microscopy to probe the structural changes of tau. SDS insoluble fractions were extensively dialyzed against distilled water in 50-kDa cut-off dialysis tubing. Preparations were suspended in 25 mM ammonium bicarbonate and added to copper grids coated with a thin layer of carbon. Grids were exposed for 60 min to blocking buffer (PBS containing 0.1% fish gelatin) and then incubated with antibody AT8 overnight. Immunogold-labeled secondary antibody (12 nm gold, Jackson, USA) was applied for 2 h at RT and the protein structure was examined using a JEOL 100CXII transmission electron microscope. Images were captured with a MegaView III digital camera.
Cell culture, transfection and treatment
HEK293 cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM, Invitrogen, USA), supplemented with 10% fetal bovine serum (Invitrogen), 100 U/ml penicillin, and 100 μM streptomycin (Invitrogen) at 37°C in a 5% CO2 humidified atmosphere and then passaged every 3-4 days. For siRNA experiment, cells were planted in 60 mm plates and transfected with human gene-specific validated and genome-wide siRNAs (Pin1, GCCATTTGAAGACGCCTCGTT; HDJ2/HSP40, GATATCAAGTGTGTACTAAAT) using Lipofectamine ® RNAiMAX Reagent (Invitrogen) according to the manufacturer’s instructions. Forty-eight hours later, transfection of the 3 × FLAG tagged human tau441 plasmid were carried out using Lipofectamine ® 3000 Reagent (Invitrogen). The final siRNA and plasmid used per dish were 25 pmol and 2.5/5 μg, respectively. Then, the cells were harvested for immunoblotting analysis 24 h later.
PC12 cells were grown in DMEM supplemented with 5% fetal calf serum, 15% horse serum. Cells were seeded into petri dishes (10-cm diameter) at a density of 1 × 106 cells/ml and cultured 24 h at 37°C. Thereafter, the medium was replaced with fresh medium, and cells were treated with fAβ1 - 42 (0.25 μmol/L, ChinaPeptides, China) in the absence or presence of rosmarinic acid (1 × 10–4~10–6), both given 10 min before Aβ42. The concentration of Aβ42 was selected based on previous report, which produced a submaximal effect on cell viability and reactive oxygen species formation [32]. At 24 h after Aβ treatment, cells were harvested and subjected to immunoblotting analysis.
Statistical analysis
Integrated intensity readings from immunoblotting were analyzed with Prism5.0 (GraphPad Software, San Diego, CA). Integrated intensities of target proteins were normalized to control protein, in some analysis P-tau also normalized to total tau labeled by antibody tau-5, then the data were expressed as the “fold of control” and presented as mean ± standard error of the mean (SEM). Statistical analysis was determined by unpaired two-tailed Student’s t-test. A value of p < 0.05 was considered to be statistically significant.
RESULTS
Effects of chronic restraint stress on tau phosphorylation in brain of mice with different ages
Our previous studies found chronic restraint stress (CRS)-induced tau phosphorylation in cerebral cortex and hippocampus [17]. To investigate the effects of aging on CRS-induced tau phosphorylation, 6- and 13-month-old mice were used as adult and middle-aged mice in this study [33]. The homogenates of cerebral cortex were analyzed by western blotting with antibodies AT8 (recognizing Ser202/Thr205), PS396, and Thr181. Results showed the basal levels of P-tau in homogenates of cerebral cortex from control middle-aged mice detected by AT8 and PS396 antibodies were higher than those from control adult mice, while the P-tau-Thr181 in control middle-aged mice did not significantly increase comparing that in adult mice (Fig. 1).
After 18 consecutive daily exposures to a 30-min restraint stress, P-tau raised in both adult and middle-aged mice, but differentially. For middle-aged mice, P-tau-Ser396 significantly increased (p < 0.001), whereas P-tau-Ser202/Thr205 and P-tau-Thr181 in stressed mice were tended to increase but not significant. For adult mice, the significant increases of P-tau-Ser202/Thr205 and P-tau-Ser396 were observed after chronic stress (p < 0.01, p < 0.05), respectively, comparing those in control mice, while the increase of P-tau-Thr181 was not significant. In addition, the levels of P-tau in stressed middle-aged mice also tended to increase comparing those in stressed adult mice (Fig. 1).
Effects of chronic restraint stress on the solubility of phosphorylated tau in brain of mice with different ages
To investigate the effect of aging on stress caused insolubility of tau, tau in cerebral cortex was sequentially extracted as described in methods. Results showed that the P-tau tended to increase in RAB soluble fraction after CRS for both adult and middle-aged mice, among which the increases of P-tau-Ser396 were significant in middle-aged mice, and all detected P-tau were significantly elevated in adult mice (Fig. 2A).
In detergent soluble fraction, P-tau-Ser396, P-tau-Thr181, and Tau-5 labeled tau decreased significantly in middle-aged mice after CRS. In contrast, in adult mice AT8-labeled P-tau-Ser202/Thr205 still increased, while Tau-5-labeled tau decreased (Fig. 2B). In SDS soluble fraction, the change tendency of P-tau and total tau showed a decrease except an increase of P-tau-Ser202/Thr205 in adult mice (Fig. 2C).
In above results, no significant increase of P-tau-Ser202/Thr205 in middle-aged mice after CRS was found in homogenates, and sequential extracts. Therefore, to further evaluate AT8-labeled P-tau in stressed middle-aged mice, we analyzed FA soluble fractions extracted from SDS insoluble materials. Results showed a dramatic elevated P-tau-Ser202/Thr205 in samples from stressed middle-aged mice, although the increase also observed in stressed adult mice but the increase level was not so dramatic. In addition, a trend of increased P-tau-Ser396 and Tau-5-labeled tau in FA fractions also appeared both in adult and middle-aged mice (Fig. 3A). Therefore CRS could induce the insolubility of tau, especially for P-tau-Ser202/Thr205 in middle-aged mice.
Because AT8-labeled tau in the FA fraction from stressed middle-aged mice appeared in a smear pattern at high molecule weight in immunoblots, we supposed that these AT8-labeled tau might be ubiquitinated. Therefore, immunoprecipation was conducted to analyze FA fractions. As expected, captured ubiquitin-decorated proteins really contained AT8-positive tau, which also appeared in a smear pattern at high molecule weight in immunoblots (Fig. 3B).
Structural phenotype of SDS insoluble AT8-labeled phosphorylated tau after chronic restraint stress
NFTs consist of P-tau formed PHFs in AD brain. PHFs can be imaged by transmission electron microscopy of ultrathin sections or extracts of the AD brain [34, 35]. We used similar methods to image cerebral SDS-insoluble fractions. In samples from control middle-aged mice, some sparsely scattered or amorphous structures labeled by immunogold with AT8 were detected (Fig. 4D). In samples from CRS middle-aged mice, although no typical PHF was found, we did observe that some aggregates consisting of filament like structures beside amorphous structures could be decorated by immunogold with AT8 (Fig. 4A–C), confirming the presence of aggregated P-tau after CRS stimulation in older mice. Moreover, we found an increase of AT8 staining in cerebral cortex of middle-aged or adult mice after CRS, but no NFT accumulation was observed (Fig. 4G–N). The immunblotting analysis of total protein sample from middle-aged mice did not show an increase of AT8-labeled tau, and the increase in immunohistochemical staining might be due to its including the SDS insoluble tau which could not be resolved by SDS-PAGE electrophoresis.
Effects of chronic restraint stress on CRF and CRFR1 expression
The effects of CRS on tau phosphorylation, solubility and aggregation have been found related to corticotrophin releasing factor (CRF) and corticotrophin releasing factor receptor1 (CRFR1) [29, 36]. However, the analysis of CRF in this study showed that it did not increase in 6-month-old mice, and even slightly decreased in some 13-month-old mice, although not statistically significant (p > 0.05). Meanwhile CRFR1 appeared to have a tendency toward downregulation both in 6- and 13-month-old mice (Fig. 3C).
Chronic restraint stress and aging on chaperone proteins
To further evaluate the reason for tau prone to deposition affected by CRS and/or aging, we analyzed some proteins that take roles in modulation of tau aggregation, including chaperones and peptidylprolyl cis/trans isomerase Pin1. Results showed that the basal levels of chaperones such as HSP70, HSC70, HSP90, and HDJ2/HSP40 in cortex of middle-aged mice were lower than those of adult mice. Moreover, after CRS stimulation these chaperones appeared to decrease, or have a tendency to decrease in both adult and middle-aged mice (Fig. 5A–E). Interestingly, there were nearly no clear bands of HDJ2 in stressed mice at middle-age (Fig. 5A). To determine whether HDJ2 knockdown (KD) affects protein stability of tau, 293 cells were transfected with siRNA of HDJ2 and tau expression construct. Indeed, HDJ2 KD increased tau level (Fig. 5H).
For the TCP1 complex (also known as the TCP1 ring complex), here, we detected the subunit α and found that the basal level of TCPα in middle-aged mice was also significantly lower than that in adult mice, but the CRS induced a slight increase of TCP1α both for adult and middle-aged mice (Fig. 5A, G). In addition, the detection of Pin1 showed no significant difference between control mice with different ages. However, the level of Pin1 decreased significantly after CRS in middle-aged mice (p < 0.05), but not in adult mice (Fig. 5A, F). Evidence implicating Pin1 in regulating tau processing already exists. To prove this, we manipulated Pin1 KD with siRNA which also showed the increase of tau and P-tau (Fig. 5H). Therefore, the effects of CRS on tau phosphorylation and accumulation in aging processing might be related to the deficiency of Pin1 and chaperone proteins.
Rosmarinic acid inhibits tauopathy induced by chronic restraint stress
RA could inhibit Aβ-induced tau phosphorylation [26, 27]. To explore the interference of stress-induced tauopathy, we evaluated the effects of RA. Results showed that the treatment with RA (2 mg/kg ip daily) significantly compromised CRS-induced tau phosphorylation in both adult and middle-aged mice (Fig. 6). Moreover, it also prominently inhibited tau insolubility as indicated by FA fraction analysis (Fig. 7). In particular, the stress-induced AT8-labeled tau in middle-aged mice was effectively attenuated byRA treatment.
For middle-aged mice, the analysis of chaperone proteins and Pin1 revealed that RA could significantly reverse the CRS-induced decrease of Pin1, HDJ2/HSP40, HSC70, and HSP90, whereas slightly promoted the CRS-induced increase of TCP-1α. Of note, the protective effects of RA on CRS-induced changes of chaperone proteins in adult mice also presented, but were relatively limited compared with those in middle-aged mice (Fig. 8A, B). Therefore, RA might be useful to relieve the stress-induced tauopathy particularly for middle-aged subjects.
To explore whether RA could directly regulate tau phosphorylation and the expression of HSPs and Pin1, PC12 cells were treated with Aβ42 and with/without RA. We found that RA compromised Aβ-induced tau phosphorylation (Fig. 8C), but did not affect the levels of HSPs and Pin1 with various concentrations (1 × 10–4 ∼10–6 mol/L), except that high concentration (1 × 10–4 mol/L) of RA downregulated HSC70 (Fig. 8D). These results suggested that RA might act on the upstream mechanisms of stress and aging to regulate the expression of HSPs and Pin1.
DISCUSSION
Stress is believed to be associated with the pathogenesis of neurodegenerative and neuropsychiatric disorders, including AD [6, 10–13]. Different models of stress have been used in inducing Aβ production and tau phosphorylation [14–17, 38], among which CRS more closely resembles human emotional and psychiatric stress. However, the reaction of tau phosphorylation to different stress seems to be differential. For instance, unpredicted stress did not induce tau phosphorylation in male mice even in Tau P301 L transgenic mice, but did in hippocampus of female mice [37, 39].
Although aging is a main reason for AD, a very recent study of unpredicted stress-induced tau aggregation exhibited no obvious difference between middle-aged and old TauP301 L transgenic female mice [39]. Therefore, it is still not clear whether stress-induced AD-related pathology is age-dependent. In this study, we used 6- and 13-month-old mice to investigate CRS-induced tauopathy. Our data, in general, showed the level of P-tau in control middle-aged mice was higher than that in control adult mice. Stress-induced P-tau increased in both adult and middle-aged mice. Under CRS, the increase of P-tau-Ser396 in middle-aged mice was more obvious comparing that in adult mice (Fig. 1). These results indicate that aging could affect CRS-induced tau phosphorylation.
Phosphorylation of tau causes a decrease of its microtubule binding ability, and similarly tau detaching from microtubule tends to be phosphorylated [40]. For stressed mice, P-tau increased in RAB soluble fraction and tended to decrease in RIPA and SDS soluble fractions, which inferred the loss of microtubule binding. Surprisingly, AT8-labeled P-tau-Ser202/Thr205 did not increase in homogenate samples of cerebral cortex from middle-aged mice, neither in RAB soluble, detergent soluble nor SDS fractions. In contrast, although the increases of tau and P-tau in FA fraction after CRS appeared both in adult and middle-aged mice, only in middle-aged mice AT8-labeled P-tau-Ser202/Thr205 dramatically increased, which was also ubiquitinated. Therefore, aging could promote tau deposition induced by chronic stress.
Phosphorylated insoluble tau is a potentially prepathogenic state, which tends to form PHF and subsequently aggregate to be tangle formation. As we knew, very few reports found PHF formed by mouse tau [19]; most samples of PHF studies were human tau [41]. In this study, we did find the aggregation of AT8-labeled tau in SDS insoluble fraction, but did not observe the formation of PHF structure and NFT-like pathological changes.
It was not clear why the increase of AT8-labeled P-tau in FA fraction was robust in stressed middle-aged mice compared to that in adult mice. CRF could influence phosphorylation of tau via receptor CRFR1 [42]. CRF participates in chronic stress-induced tau phosphorylation, solubility, and aggregation [36, 37]. However, in this study, we did not find increases in CRF and CRFR1 in either adult or middle-aged mice. These results are consistent with the results of previous studies that CRH concentration and CRH mRNA were not significantly changed in hypothalamus after chronic immobilized stress [43] or CRS [44]. Therefore, we supposed that CRF might take a role in triggering tau phosphorylation in early events that may subsequently affect tau aggregation, and other factors mediated the late steps in tau insolubility and aggregation.
Molecular chaperones play important roles in regulation of tau aggregation [23, 46], and deranged expression in brains of AD patients have been found [47]. Tau phosphorylation has been shown to promote its degradation via chaperone-mediated machinery [24, 48] or to inhibit its degradation [49]. The HSPs are chaperones that are charged with preventing unfolded or misfolded proteins. HSP70 has been confirmed against tauopathy [45]. In contrast, HSP90 is able to facilitate microtubule association of tau and tau stability to form toxic oligomers, but can also work with other (co-)chaperones, such as the ubiquitin ligase CHIP and HSP40, to facilitate tau degradation [24, 50].
The data of age-related changes of HSPs expression were not consistent, such as recent studies finding that the increase of HSP proteins in 9-month-old rTg4510 mice compared to those in 5-month-old rTg4510 mice [51], while HSP70 decrease in cortex of F344/BN rats aged 18 and 30 months [52]. In this study, we found the decreased expression of HSPs in 13-month-old C57 mice compared to those in 6-month-old mice. Regarding stress stimulation, it was reported that acute immobilized stress induced an increase of HSP70 [53]; however, other data found both acute and chronic stress compromised in the cytoplasmic HSP70 and HSP90 [54]. In contrast, we found a CRS-induced decrease or tendency to decrease of HSPs in adult and middle-aged mice. Among these HSPs, the deficiency of HDJ2/HSP40 was more prominent in stressed middle-aged mice, and inhibition of HSP40 expression could induce tau accumulation. Therefore, the effects of aging and stress on expression of HSPs might depend on the types of stress and species of animals. The deficiency of HSPs in older mice might explain the tendency of insoluble tau formation induced by CRS in this study.
The CCT/TRiC (chaperonin containing TCP-1/TCP-1 ring) chaperonin complex can inhibit aggregation of expanded repeat huntingtin fragments and its cellular toxicity [55], although the function of CCT in AD is still not clear. Interestingly, we observed a decrease of TCP1 in older mice, and a slight increase of TCP1 expression induced by chronic stress in both 6- and 13-month-old mice. Whether the upregulation of TCP1 in stressed mice confers a protection for tau needs to be further studied.
Pin1, an unique prolyl isomerase, catalyzes the isomerization of the peptide bond between pSer/Thr-Pro in proteins, thereby regulating their biological functions [56]. Pin1 could restore the ability of tau to bind microtubules and facilitate tau dephosphorylation [19, 57], including all Cdk5-mediated phosphorylation sites (Ser-202, Thr-205, Ser-235, and Ser-404) [58]. In this study, we also observed Pin1 KD induced a retention of transfected tau and P-tau in 293 cells. In AD subjects, Pin1 is downregulated and oxidatively-modified causing decrease of its activity [59, 60]. Therefore, it was analyzed herein whether CRS affects Pin1 expression in an age-dependent manner. In this study, Pin1 decreased after exposure to chronic stress in middle-aged mice, indicating the tendency of Pin1 deficiency might also devote to tauopathy in older subjects.
RA could relieve depression symptoms in stress animals [25], and attenuate tau phosphorylation and decrease neuronal injury induced by Aβ [26]. In this study, RA effectively attenuated tau phosphorylation as well as tau insolubility induced by the CRS. Meanwhile, RA also significantly regulates the CRS-induced changes of chaperone proteins particularly in middle-aged mice, implying these effects might be partially involved in the mechanism of RA on CRS-induced tauopathy. However, in an in vitro study, RA did not significantly affect HSPs and Pin1 expression in general. Therefore, RA might act on the upstream mechanisms of stress and aging to regulate the expression of HSPs and Pin1.
In conclusion, the findings presented here, indicate that the aging state could affect the progression of tauopathy induced by chronic restraint stress, especially for tau aggregation and insolubility. The insoluble tau caused by chronic stress in aging might be attributed to tau phosphorylation and malregulation of the chaperone and isomerase systems. Furthermore, early intervention of chronic stress with RA could effectively attenuate tauopathy, exhibiting a therapeutic implication for AD.
