Neuroprotective Effect of TREM-2 in Aging and Alzheimer’s Disease Model

Abstract

Neuroinflammation and activation of innate immunity are early events in neurodegenerative diseases including Alzheimer’s disease (AD). Recently, a rare mutation in the gene Triggering receptor expressed on myeloid cells 2 (TREM2) has been associated with a substantial increase in the risk of developing late onset AD. To uncover the molecular mechanisms underlying this association, we investigated the RNA and protein expression of TREM2 in APP/PS1 transgenic mice. Our findings suggest that TREM2 not only plays a critical role in inflammation, but is also involved in neuronal cell survival and in neurogenesis. We have shown that TREM2 is a soluble protein transported by macrophages through ventricle walls and choroid plexus, and then enters the brain parenchyma via radial glial cells. TREM2 protein is essential for neuroplasticity and myelination. During the late stages of life, a lack of TREM2 protein may accelerate aging processes and neuronal cell loss and reduce microglial activity, ultimately leading to neuroinflammation. As inflammation plays a major role in neurodegenerative diseases, a lack of TREM2 could be a missing link between immunomodulation and neuroprotection.

Keywords

Alzheimer’ disease choroid plexus macrophages innate immunity immunomodulation myelination neurogenesis neuroinflammation neuroplasticity neuroprotective soluble TREM2

INTRODUCTION

The immune system has evolved to defend against pathogens and clear up endogenous defective cells (plaques/dying neurons). It is thus conceivable that the immune system may be actively be involved in Alzheimer’s disease (AD). Molecules of both the innate and adaptive immune responses are induced in a wide range of neurological disorders, including AD [1, 2], Parkinson’s disease [3 –5], Huntington’s disease [6], amyotrophic lateral sclerosis [7] and multiple sclerosis [8]. There is a highly organized innate immune response during the early stages of inflammation. This inflammatory response is characterized by the expression of various immunological proteins in the circumventricular organs (CVO), choroid plexus (CP), and other structures lacking the protection conferred by the blood-brain barrier [9, 10]. The response extends progressively to affect microglia and macrophages across the brain parenchyma and may lead to the onset of an adaptive immune response [11, 12].

AD is characterized by the presence of extracellular amyloid deposits comprised of aggregated amyloid-β (Aβ) peptides and intracellular neurofibrillary tangles containing hyperphosphorylated, aggregated tau protein [13, 14]. The deposition of Aβ in brain areas involved in cognitive functions is assumed to initiate a pathological cascade that ultimately results in inflammation, synaptic dysfunction, synaptic loss, and neuronal death [15, 16].

Triggering receptor expressed on myeloid cells 2 (TREM2) is a microglia/macrophage receptor that acts as a sensor for a wide array of lipids including apolipoprotein (ApoE) and phospholipid transfer protein [17 –20]. Recent genome-wide association studies have shown that a rare mutation (R47H) of TREM2 gene is associated with a substantial increase in the risk of developing AD [19 –22]. The absence of TREM2 expression on microglia impairs their capacity to phagocytose cell membrane debris and increases their production of pro-inflammatory cytokines [23, 24]. Identification of this novel variant in the gene encoding for TREM2 has refocused attention onto inflammation as a major contributing factor in AD [25, 26]. DNAX-activating protein of 12 kDa (DAP12, also called TYROBP) is a type I transmembrane adapter protein, which associates with the cytosolic portion of TREM2, forming a molecular complex [17, 27]. It is expressed in neurons, microglia and resident macrophages in the central nervous system (CNS) [28] and functions to stimulate phagocytosis and to suppress cytokine production and inflammation [29]. Developmental dysregulation of either TREM2 or DAP12 mutation causes an early onset form of dementia with cystic bone disorder, known as Nasu-Hakola disease [30 –32].

Several mouse models that mimic some of the neuropathological and behavioral features of AD have been developed [33 –36]. Transgenic mice expressing human APP695 containing the double mutation Lys670-Asn, Met 671 Leu (Swedish mutation), and one PS1 mutation (M146V) in Tg2576 (APP/PS1-Tg2576, hereby referred to as APP-PS1) displays age-dependent increases in Aβ plaques, activated microglia, astrocytes, and dystrophic neurites [10 , 37]. The effects of TREM2 in AD mouse models, particularly those upon Aβ plaque load, have been studied in different transgenic mouse models, generating conflicting results; one group reported that the absence of TREM2 decreased Aβ load [38], whereas another group reported that TREM2 deficiency increased Aβ deposit in another AD (5xFAD) mouse model [39]. Both groups showed the presence of TREM2 in the microglia or in the peripheral macrophages. None of these papers, however, have mentioned TREM2 protein expression in the neurons or other glial cells (e.g., in astrocytes oroligodendrocytes).

The aim of our study was to investigate TREM2 protein expression in the APP-PS1 transgenic mouse model of AD to validate previously reported results. Highlight novel findings regarding the location of TREM2 in mouse brain and in vitro analysis using primary neuron and glial culture. Collectively, our data demonstrates that in the young mouse brain, TREM2 protein is expressed in pyramidal neurons and dentate gyrus granule cells, indicating a developmental role in neuronal cell survival and neurogenesis. During the early stages of the AD-like phenotype in the APP-PS1 mice (between 3– 6 months), activated microglia and astrocytes were visible close to the Aβ plaques, but TREM2 protein did not co-localized with microglial markers (Iba1 or CD11b) or GFAP positive astrocytes. Furthermore, we show that TREM2 protein levels decline with age, which could affect neuronal survival. This decline may also cause a failure in clearance of amyloid deposits by microglia in APP-PS1 mouse brain.

MATERIALS AND METHODS

Transgenic mice

Transgenic mice overexpressing the 695-amino acid isoform of human amyloid precursor protein containing a Lys⁶⁷⁰ ⟶ Asn, Met⁶⁷¹ ⟶ Leu mutation (K670N and V717F, Swedish mutation) and one PS1 mutation (M146V), driven by Thy1 promoter on a C57BL/6 genetic background (Tg2576) were purchased from Jackson Laboratory, USA. Neuropathological characterization of these animals has previously been described in detail [10, 35]. All animals were housed under standard conditions (12 h light-dark cycle, 20°C ambient temperature) with free access to food and water. All procedures were performed under license in accordance to the UK Animals (Scientific Procedures) Act 1986. Six mice per age group (3, 6, 9, and 10– 12 months) were used for RT-PCR and immunohistochemistry. Similarly, six mice from each group were used for protein quantitation by western blotting (WB), described subsequently. C57/BL mice were used as control samples (n = 6, age-matched to APP-PS1 mice).

Tissue preparation

Mice were terminally anaesthetized with carbon dioxide and culled. Unfixed tissues were dissected from various brain regions from control and APP-PS1 mouse brains and snap frozen in dry ice until analyzed by either RT-PCR or WB as described previously [40]. For histochemical analyses, animals were anesthetized with pento-barbitone and flash-perfused transcardially with 0.9% saline followed with 4% (v/v) paraformaldehyde (PFA) in 0.1 M phosphate buffer (pH 7.4). Brains were sectioned by microtome as described previously [41]. Free-floating sections were prepared (25 μm coronal sections in 0.1 M PBS) through the entire olfactory bulb, hippocampus, cortex, mid brain and cerebellum. Sections were then stained by immunohistochemistry as described below.

RNA isolation and RT-PCR

For RNA analysis, mouse brain (n = 6) tissues were dissected from frontal cortex (that also contains blood vessels and endothelium) as described above. RNA was extracted from approximately 50 mg of tissue and 1 ml of TRIzol reagent (Invitrogen) following manufacturer’s instructions and then purified using an RNeasy Mini kit (Qiagen). RNA was treated with DNase I and cDNA synthesized from 2 μg of the treated RNA using a SuperScript III reverse transcriptase kit (Invitrogen) with random hexamer primers. PCR of the newly synthesized cDNA (8 ng) was performed using PCR Supermix (Invitrogen) with the primer pairs for TREM2 (Forward Primer: GCTGCTGATCACAGCCCTG, and Reverse primer: CTTGATTCCTGGAGGTGCTG, product size 464 bp) and DAP12 (Forward Primer: GTGCCTTCTGTTCCTTCCTG and Reverse primer: GGCATAGAGTGGGCTCATCTG, product size 335 bp) using a program of 95°C for 3 min, 30 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 1 min. Transcript expression levels were normalized to the expression of GAPDH (Forward Primer: CGGAGTCAACGGATTTGGTCGTAT, Reverse primer: AGCCTTCTCCATGGTGGTGAAGAC, product size 500 bp). PCR products were separated on 1.5% agarose gels and photographed under UV illumination.

In situ hybridization

Brain tissues were prepared for in situ hybridization and probed as described previously [40].

Synthesis of digoxigenin (DIG) labeled probes for in situ hybridization

To synthesize DIG-labeled RNA probes, the target TREM2 cDNA was amplified by PCR using primers designed on the basis of the mouse TREM2 cDNA sequence used in RT-PCR. The primers used for DIG labeling were TREM2-insF:TAATACGACTCACTATAGG GCTGCTGATCAC-AGCCCTG and TREM2-insR: ATTTAGGTGACACTATAGAGGCATAGAGTGGGCTCATCTG.

The PCR product was amplified using a 5^′ primer containing a T7 phage promoter sequence and a 3^′ primer containing an SP6 phage promoter sequence, generating a template for transcription of a sense and an antisense probe, respectively. The PCR products (470 bp) were sequenced and homology checked by BLAST search (NCBI database). In vitro transcription reactions were performed using dig-UTP RNA labeling mix (Roche, Mannheim, Germany) and SP6 or T7 RNA polymerase (Roche).

In situ hybridization with DIG labeled probe

Brain, liver and other sections were fixed in 4% PFA for 10 min, permeabilized for 10 min in PBS with 0.5% Triton X-100, and acetylated by 10 min incubation in a solution made of 250 ml of water with 3.5 ml of triethanolamine and 625 μl of acetic anhydride added drop wise [40]. Pre-hybridization was performed in hybridization buffer made of 50% formamide, 5×SSC, and 2% blocking reagent (Roche) for 3 h at 62°C. Hybridization with DIG-labeled probes (100 ng/ml) was performed in the same buffer overnight at 62°C. Stringency washing was performed in 0.2×SSC for 1 h at 62°C. For the detection of DIG-labeled hybrids, the slides were equilibrated in maleic acid buffer (0.1 M maleic acid and 0.15 M NaCl, pH 7.5), incubated for 1 h at room temperature with 1% blocking reagent made in maleic acid buffer (blocking buffer), and then for 1 h with alkaline phosphatase-conjugated anti-DIG antibodies (Roche) diluted 1 : 5000 in blocking buffer. The slides were washed twice for 30 min in maleic acid buffer and incubated overnight in color development buffer [2.4 mg levamisole (Sigma), 45 μL 4-nitroblue tetrazolium (Sigma), and 35 μl 5-bromo-4-chloro-3-indolyl-phosphate (Sigma) in 10 ml of a buffer made of 0.1 M Trizma base, 0.1 M NaCl and 0.005 M MgCl₂, pH 9.5]. The reaction was stopped in neutralizing buffer (0.01 M Trizma base and 0.001 M EDTA, pH 8) and sections were mounted in PBS– glycerol and a coverslip was applied. Non-specific binding was analyzed using sense probes (data notshown).

Sources of antibodies

The following primary antibodies were raised against mouse TREM2 peptides, goat polyclonal (PAB) anti-TREM2 (ab95470) or rabbit polyclonal anti-TREM2 (ab175525) and for human cell line mouse monoclonal (Ab201621). Other antibodies used include anti-TREM2 (HPA010917, Sigma-Aldrich), rabbit PAB synaptophysin, and rabbit PAB synapsin (from Abcam, Cambridge, UK). The monoclonal anti-Aβ antibodies (6E10) (Signet laboratory) had been described previously [10] and rabbit anti-Aβ (1-40) and CD11b (Millipore), anti-GFAP (Sigma-Aldrich), and Iba1 (WAKO) are described in Table 1. Alexa Fluor 568-labeled donkey anti-mouse, Alexa Fluor 488-labelled donkey anti-rabbit and Alexa Fluor 568-labeled donkey anti-goat (all from Invitrogen, 1 : 1000 for immunofluorescence).

SDS-PAGE and western blotting

Protein lysates were prepared from cortex of mouse brains (n = 6) and from a primary cell culture and neuronal cell line (n = 3). 20 μg protein samples were separated on 4– 12% Nu-PAGE Bis-tris (Bis (2-hydroxyethyl)-amino-tris (hydroxymethyl)-methane) gradient gels and transferred to 0.2 μm pore size PVDF membranes, using NuPAGEelectrophoresis system (Invitrogen). Membranes were incubated with TREM2 (rabbit polyclonal anti-TREM2 (ab175525) antibody in blocking buffer for 24 h at 4°C and then washed three times with 0.1 M Tris saline buffer containing 1% Tween 20 (TBST) followed by incubation for 1 h at room temperature with HRP-conjugated secondary antibodies (anti rabbit IgG (1 : 3000, DAKO) or anti-mouse IgG (1 : 3000; DAKO) antibodies). Binding was detected with ECL Plus chemiluminescence reagents.

Immunofluorescence

Sections were blocked using blocking buffer (0.1 M PBS, 0.1% Triton X100, 10% normal donkey serum) for 1 h at room temperature, then incubated overnight at 4°C with primary antibody diluted in blocking buffer. Alexa Fluor-conjugated secondary antibodies were used for detection and samples counterstained with 4^′6-diamidino-2-phenylindole (DAPI, Sigma). Sections were then mounted on glass slides with coverslips using FluorSave (Calbiochem).

Primary rat hippocampal cultures

Cultures of dissociated hippocampal neurons were prepared using previously described methods [42] with some modifications. Hippocampal tissue was collected from Sprague-Dawley rat embryos (Charles River) at day 18 of development, digested in 0.25% trypsin for 15 min at 37°C in Hank’s buffered saline solution (HBSS), and then gently triturated inDulbecco’s modified Eagle’s medium (DMEM,Gibco) supplemented with 10% fetal calf serum andan additional 0.8% of glucose. This produced a single cell suspension that was plated at a density of 5×10⁴ cells/cm² on glass coverslips coated with 250 μg/ml of poly-D-lysine (PDL, Sigma). Cultures were maintained in Neurobasal medium supplemented with 2% B27 and 1% GlutaMAX and used in experiments after 3– 4 weeks in culture. Coverslips were fixed with 80% ice-cold methanol and analyzed by immunofluorescence staining as above and examined by confocal microscopy. All cell culture media and reagents were purchased from Invitrogen.

Neuronal cell lines

Neuronal cell lines (SKNF1 and SH-SY5Y) were plated on PDL coated glass cover slips (as described above) in 24-well plates with DMEM (Gibco), 10% fetal calf serum, and 1% penicillin– streptomycin– fungizone (PSF). After 1– 3 days in vitro, cells were fixed with 80% ice-cold methanol and analyzed by immunofluorescence.

Primary rat microglial culture and lipopolysaccharide (LPS) treatment

The cortices of new-born Sprague-Dawley rats (between P1 to P5) were removed, stripped of the meninges, chopped up with a razor blade and then incubated in 0.1% trypsin (Sigma) in EDTA for 45 min at 37°C. Following a 5-min incubation in DNAse (0.001%, Sigma in HBSS), the supernatant was removed and tissue triturated in 2 ml of triturating solution with a flame-polished Pasteur pipette. After centrifugation for 3 min at 1000 g, cells were re-suspended in culture medium [in DME, 10% fetal calf serum, Sera Lab, UK; 1% PSF, Gibco] and plated in 75 cm³ poly-l-lysine-coated tissue culture flasks (Nunclon, Life Technologies, Paisley, Scotland) at a density of 2 cortices per flask. To prepare the microglial culture, after the cells became confluent, mixed glial cultures were agitated on a rotary shaker at 200 r.p.m for 2 h. Floating microglial cells were washed and re-grown in a 75 cm³ flask and some cells were plated on 13-mm-diameter poly-l-lysine-coated coverslips at a density of 10⁴ per coverslip. After 1– 3 days in vitro, the culture medium in each well was changed, and the cells were treated for 4 h with 100 nM of LPS and then washed with PBS and fixed as described above.

Microscopy

Bright field images were taken and quantified using Lucia imaging software and a Leica FW 4000 upright microscope equipped with a SPOT digital camera. Fluorescence images were obtained using a Leica DM6000 wide field fluorescence microscope equipped with a Leica FX350 camera and x20 and x40 objectives. Images were taken through several z-sections and de-convolved using Leica software. A Leica TCS SP2 confocal laser-scanning microscope was used with x40 and x63 objectives to acquire high-resolution images.

Image and statistics analysis

All experiments were performed in triplicate. WB and immunofluorescence images were quantified using ImageJ software (NIH). For WB, the gel analyzer module was used. Selected bands were quantified based on their relative intensities, adjusted for background with fold-change in intensity subjected to statistical analysis as described below. Immunofluorescence was quantified using methods previously described [16]. Values in the figures are expressed as mean±SEM. To determine the statistical significance, values were analyzed by Student’s t-test when comparing difference between case (APP-PS1 brain) and controls. A probability value of p < 0.05 was considered to be statisticallysignificant.

RESULTS

TREM2 in wild-type mouse brain

As a first step in determining possible roles of TREM2 in the brain, we investigated the expression of TREM2 and its binding partner DAP12 in wild-type (WT) mouse brain over time. DAP12 is a type I transmembrane adapter proteins which forms a molecular complex with TREM-2 [17, 27]. RT-PCR of TREM2 and DAP12 was performed on tissues from the frontal cortex of 3-, 6-, 9-, and 12-month-old WT mice (n = 6 per group). TREM2 levels demonstrated a gradual increase over time in the control mice, peaking at 9 months of age (Fig. 1a). DAP12, on the other hand, remained consistent over time (Fig. 1b), significantly higher than TREM2 at 3 and 6 months. These measures indicated that both TREM2 and DAP12 are present in the brain.

To investigate the cellular localization of TREM2 mRNA, in situ hybridization experiments wereperformed using a TREM2 probe (470 bp) amplified by DIG labeling. Despite the presence of RNA based on RT-PCR, very little TREM2 signal was detected in the cortex of WT mice (Fig. 1e). Low levels of signal was observed around blood vessels in the brain (Fig. 1f), with strong TREM2 transcripts inside the blood vessels, specifically in the mononucleated cells (Fig. 1 h). Specificity of our probes was demonstrated by labeling TREM2 transcripts in bone osteoclast cells (Fig. 1i) and in the stellate macrophages or Kuffer cells of the liver (Fig. 1 g; [43, 44]) and a β-actin probe was used on sections from hippocampus to assess hybridization stringency (Fig. 1j). Given the limited localization of TREM2 mRNA in brain parenchyma, these data suggest that TREM2 is being derived from elsewhere.

WB analysis of frontal cortex from WT mice (at 3, 6, 9, and 12 months, n = 6 per group) complemented the RT-PCR results, indicating that levels of TREM2 protein increased over the first 6 to 9 months of life (Fig. 1k, l). We further confirmed the presence of TREM2 protein in the WT mouse brain using immunofluorescent staining. In 6-month-old control brains, TREM2 was present in periglomerular neurons, granule cells and white matter tracts of the olfactory bulb (Fig. 2a). Similar to the in situ staining, we noted TREM2 immunostaining close to blood vessels, demonstrating co-localized with β-catenin and NG2 positive glia (Fig. 2b, c). TREM2 protein was observed in the granular cells of the dentate gyrus in the hippocampus (Fig. 2b, c), co-localizing with DAPI, whereas no co-localization with GFAP positive astrocytes and minimal co-localization with Iba1 positive microglia (Fig. 2e, f). TREM2 protein was also present in the cytoplasm and in membrane of the epithelial cells of choroid plexux (CP) (Fig. 2g, h). Interestingly, TREM2 protein was visible in the pyramidal neurons of layer V-VI of the cortex and it co-localized with Aβ₄₀ (Fig. 2d). This finding suggested that TREM2 protein was present in the neurons and in the oligodendrocytes, particularly white matter tract in NG2 positive glia, whereas it was absent in theastrocytes.

TREM2 expression in APP-PS1 mouse brain declined with disease progression

Given the co-localization of TREM2 and Aβ₄₀ in the cortex, we next analyzed the expression of TREM2 in the APP-PS1 mice. At 3– 4 months, these mice start accumulating amyloid deposition and plaque formation; by 9– 12 months, they resemble a more severe stage of AD pathology [10]. RT-PCRof frontal cortex tissue from 3, 6, 9, and 12 months of age, indicated that TREM2 levels were consistently higher in APP-PS1 mice than controls, significantly so at 3 months and 12 months (p < 0.001; Fig. 1a). Curiously, there was no significant difference in DAP12 mRNA levels between the two groups of mice at any time point (Fig. 1b). And when we compared TREM2 and DAP12 mRNA in the APP-PS1 brain samples, we noted significantly higher levels of DAP12 at 3 months of age (p < 0.0001, Fig. 1c). GAPDH was used as an internal control (Fig. 1d). When we analyzed protein levels (via WB), however, we found that TREM2 levels decreased with age and disease progression in the APP-PS1 mice (Fig. 1k, l; p≤0.001), suggesting post-transcriptional issues for TREM2 in these mice.

To further verify TREM2 protein expression and to determine whether it is present in either neurons or glial cells, total cell lysates (within 48 h of culture) from primary cultures of microglia, mixed glia (includes astrocytes and oligodendrocytes), primary hippocampal culture, and a neuronal cell line (SH-SY5Y and SKNF1) were analyzed with mouse monoclonal anti-TREM2 antibody (Ab201621). TREM2 was expressed in all proliferative cells and highest amounts were in hippocampal neurons (Fig. 1m). As only two samples were used from each type of cell culture experiments, no statistical analysis was performed. These data confirmed that TREM2 protein was present in early stages of cellular proliferation including in neurons.

TREM2 protein in the meningeal macrophages and in surviving neurons in APP-PS1 mouse brain

Immunofluorescent staining in the 10-month-old APP-PS1 brain presented prominent accumulation of intraneuronal amyloid throughout the cortex including the frontal and entorhinal cortex and subiculum and CA1 of the hippocampus (Fig. 3a-d). Similar to the WT situation, in the 10-month-old APP-PS1 brain, TREM2 protein was found to be close to blood vessels (Fig. 3e, f). There appeared to be more TREM2 and Aβ₄₂ co-localization in cell bodies of the cortex of the APP-PS1 mice, only in surviving neurons (Fig. 3a-d). Co-labeling of TREM2 and Aβ₄₂ was also present in the CA1/2 region of hippocampus (Fig. 3a-e), and in close proximity to the plaques in that region, in some cases in the center of plaques that did not co-localized with GFAP (Fig. 3f). Clear expression of TREM2 was seen in the white matter tract of the corpus callosum (Fig. 3c), and co-localized with Aβ₄₂ in the ependymal cells of CP (Fig. 3g, h). Of particular interest was the presence of TREM2 staining in macrophages on the pial surface of the cortex (indicated by * in Fig. 3a, b) and in perivascular macrophages in the sub-ventricular zone (Fig. 3g). This observation, and the blood vessel staining, provided further indications that TREM2 protein is entering the brain via blood vessels and peripheral macrophages.

TREM2 protein present in perivascular macrophages in the choroid plexus and the ventricular wall in APP-PS1 mice

Given the high levels of TREM2 protein expression in blood vessels, sub-ventricular zone and CP. We turned our attention to the glial cell types in these regions to better characterize how TREM2 may be entering the brain. We analyzed sections from 6- and 10-month-old APP-PS1 and WT mice. At the 6-month time point, TREM2 protein exhibited limited co-localization with Iba1+ microglia in the CP of both WT (Fig. 4a-c) and APP-PS1 mice (Fig. 4d-f).Utilizing another microglial marker (CD11b), we also found no co-localization with microglial cells in both strains of mice (Fig. 4g).

Astrocytes are also present in the CP and close to blood vessels, but brain sections stained with TREM2 indicated no co-localization with GFAP (Fig. 4h). To determine entry of TREM2 via blood vessels, another section from mid brain was stained with TREM2 and interleukin (IL)-10, and both protein co-localized in the glial cells (Fig. 4i). This data suggested that soluble TREM2 protein enters the brain parenchyma from ventricles, CVO via radial glial cells and was not present in the Iba1 positive activated microglia found in the late stages of disease progression as previously reported by others [28].

TREM2 expression in primary neurons, neuronal cell lines and glial precursors

In order to investigate possible functional roles of TREM2 in the brain, we endeavored to develop an in vitro assay that could be manipulated. The first step in this process is demonstrating that TREM2 is expressed in vitro. Previous reports have demonstrated limited TREM2 expression in cortical and hippocampal neuronal cultures [26]. In our hands, however, TREM2 was observed in hippocampal neurons (Fig. 5a-f), particularly in the soma, at perinuclear location, in axons, in dendrites, and synapses, co-localized with synaptic vesicular protein synaptophysin (Fig. 5a-c) and synapsin, indicating soluble TREM2 transportation via axon and dendrites (Fig. 5d-f). We confirmed these observations in a second neuronal cell line (SKNF1) noting that both TREM2 and β-III tubulin were seen at perinuclear locations (Fig. 5g). To determine TREM2 expression in glial precursor cells (OPCs), we analyzed mixed glial cultures in very early stages (within 48 h of plating). TREM2 was present in the perinuclear cytosol in astrocytes and in the growth cones of oligodendrocytes (Fig. 5h-i). To confirm TREM2 presence in neural precursor cells (NPCs), hippocampal culture (within 48 h of plating) was stained with β-III tubulin and TREM2; it was present in newly proliferative cells, whereas β-III tubulin was visible in mature neurons (Fig. 6a). TREM2 protein was visible in OPCs and co-localized with SOX2, a know transcription factor present in OPCs (Fig. 6b-c). An astrocyte culture was stained with GFAP and TREM2. A single neuron was stained with TREM2 (shown with an arrow) but there was no co-localization of TREM2 in mature astrocytes (Fig. 6d). In oligodendrocyte cultures, TREM2 was visible in the processes and some co-localization with OPC marker Olig2 in the nucleus (Fig. 6e). This data confirmed that TREM2 was present in all proliferative cells and even in glial precursor cells. In a third neuronal cell line (SH-SY5Y), we observed TREM2 protein present in the growth cones, suggesting that TREM2 may have important role in cellular differentiation (Fig. 6f-i).

TREM2 protein was localized in the Golgi complex and in early endosomes

As we have noticed, TREM2 protein was visible in perinuclear location, and duel labeling of TREM2 and Golgi marker (58K-Golgi) was performed in the SKNF1 cell line. TREM2 was observed to co-localize with 58K-Golgi in the trans-Golgi location, suggesting a function in sorting and packaging proteins for secretion (Fig. 6j-l). Punctuate TREM2 proteins in the radial glial cells close to the ventricles were observed (Fig. 4 h), therefore SKNF1 cells were stained with TREM2 and an early endosome marker EEA1. Duel Immunofluorescence labeling shows that both proteins co-localized in the endosomes (Fig. 6m-o). EEA1 localizes exclusively to early endosomes and has an important role in endosomal trafficking. Our results suggest that TREM2 protein is transported via EEA1 and is a tethering molecule that provides directionality to vesicular transport from the plasma membrane to the early endosomes.

Microglia cultures and responds to LPS treatment

Finally, we assessed TREM2 expression in newly proliferative microglia cultures (Fig. 7a-c), and using higher magnification we found TREM2 was visible in the nucleus and perinuclear location but not in the processes and showed limited co-localization with microglial marker CD11b (Fig. 7d-f). These data provided the foundation for investigating roles of TREM2 in vitro.

Given that inflammation is an important part of neurodegenerative conditions, like AD [45], we began our investigation into TREM2 functions by analyzing the activity of TREM2 in inflammation. Microglia culture was treated with 100 nM of LPS on culture medium for 4 h. Post-LPS treatment TREM2 expression was increased in some newly proliferative microglia, while mature microglia lost the perinuclear localization and limited co-localization was seen with CD11b (Fig. 7g-i). We also assessed pro-inflammatory cytokines (IL-1β, tumor necrosis factor-α (TNF-α), and IL-10) in untreated and in the LPS-treated microglia cultures. In untreated microglia, pro-inflammatory cytokines (IL-1β, TNF-α) and IL-10 were expressed in the different subset of organelles within the cells (Fig. 7j, k, m). TNF-α was expressed in a different population of microglia that had minimal co-localized TREM2 (Fig. 7j) or IL-1β (Fig. 7k). After LPS treatment, both IL-1β and TREM2 proteins were found to be spread throughout the membrane, in addition to a change to activated microglial morphology (loss of processes) and limited co-localization with IL-1β (Fig. 7l). In normal microglia, a population of microglia co-localized with CD11b and IL-10 (Fig. 7m). After LPS treatment, TREM2 co-localized with IL-10 in mixed glial cells (Fig. 7n). A significant increase in both TREM2 and IL-1β was detected after LPS treatment (Fig. 7o, p≤0.0001).

DISCUSSION

The association of TREM2 mutations to an increased risk of AD has emphasized the important role played by neuroinflammation in neurodegenerative diseases [19 , 46]. Microglia are the only immune cells present in the CNS parenchyma and are the quick responders to environmental changes by playing a critical role in clearing debris and restoring homeostasis in the CNS [47, 48]. With age, the brain undergoes a homeostatic shift and gradually neuroinflammatory changes develop which compromise neuronal function [29, 49]. In the human brain, TREM2 protein is involved in bone homeostasis, phagocytosis, and migration [27 , 51].

We have examined TREM2 mRNA levels (by RT-PCR) in APP-PS1 mice and found that TREM2 transcription was age-related and increased with age. This could be due to infiltrating macrophages, and such inflammatory changes and have been described in aged APP-PS1 mice which correlate with synaptic function, or it could be due to excessive microglial proliferation due to inflammatory changes in early disease processes [52]. These findings are supported by others published data on TREM2 expression in AD transgenic mice [53]. To identify the cellular location of TREM2, an in situ hybridization was performed in C57/BL6 WT mouse brain with a DIG-labeled TREM2 probe. Surprisingly, very limited cellular expression of TREM2 RNA in the mouse brain was visible and only in some cells close to blood vessels in the brain parenchyma, but not in microglia. This last observation could be due to a limited detection level of microglia with DIG-labeled probes, however, there was a clear signal in the blood/myeloid cells. TREM2 protein expression as measured by WB was also age-dependent in APP-PS1 mice, and TREM2 protein levels decreased with age. As we have observed that TREM2 protein is expressed in all precursor cells including in NPCs and OPCs, it may therefore be involved in cellular proliferation implying that TREM2 deficiency would result in impaired interactions between microglia and plaques as previously reported [54, 55].

TREM2 expression is important in limiting neuronal toxicity during the early stages of Aβ deposition. Only one published paper has thus far reported that TREM2 protein was present in neurons in human brain close to a blood vessels [28]. We have shown that in young WT mice TREM2 protein was highly expressed in pyramidal neurons, in the hippocampus, and dentate gyrus granule cells, suggesting involvement in cellular plasticity. With age and disease progression, TREM2 levels decreased particularly in the frontal and entorhinal cortex, affecting clearing process and plaque burden as seen in APP-PS1 mice and late onset AD. TREM2 protein was visible in the CP epithelial cells and in the peripheral macrophages close to the ventricles and subarachnoid space, suggesting soluble protein was carried by macrophages before traversing into the brain. We have shown TREM2 and Aβ₄₂ to be located in surviving neurons very close to plaques in 3- to 6-month-old APP-PS1 mice, whereas with disease progression by 10 months, large swollen dystrophic neurites were associated with Aβ plaques and where no TREM2 was detected. Although Iba-positive activated microglia were clearly visible in the APP-PS1 and WT brain, they may be involved in phagocytosis and clearance of plaques. In 6-month-old WT brain, TREM2 was present in the radial glial cells close to the CVO and ventricular walls not co-localizing with Iba1, supporting the notion that soluble TREM2 enters the brain parenchyma via peripheral macrophages as reported previously [38].

In young WT mice, TREM2 protein was present in neurogenic niches; therefore we grew primary hippocampal neuron culture to show that TREM2 co-localized with synaptophysin (presynaptic protein) and synapsin (synaptic vesicular protein) in the soma, axons and dendrites. We hypothesized that soluble TREM2 protein could be transported through synaptic vesicles and may have a role in synaptogenesis or neurogenesis. TREM2 protein was visible in oligodendrocytes, in the white matter tracts in the cortex, in the olfactory bulb, and in striatal bundles indicating that TREM2 protein has a role in myelination, so a lack of TREM2 function could be involve in demyelination in demyelinating disorders such as Nasu– Hakola disease, multiple sclerosis, and amyotrophic lateral sclerosis [31, 46]. TREM2 protein was visible in the nucleus and perinuclear area (within the Golgi complex) of all primary cells OPCs and NPCs and the highest level was seen in growth cone of neurons and oligodendrocytes, further supporting the role of TREM2 in cell proliferation.

In human and mouse neurons and microglia, as well as in human cell lines (microglia and glioblastoma), the receptor is mostly localized not at the surface but within the cell: in the perinuclear area in neurons and spread throughout the cytoplasm in microglia and cell lines [56]. The present work has been carried out in neuronal cell line (SKNF1) using immunofluorescence techniques. TREM2 co-localized with the Golgi marker 58K-Golgi, suggesting it may be involved in sorting and packaging of proteins for secretion. It could be involved in the transport of lipids around the cell that when the process was impaired increased the plaques burden in AD. We have seen punctuate TREM2 protein in the radial glial cells close to the ventricles. Therefore we investigated location of TREM2 in endosomes, using a SKNF1 cell line. TREM2 was found to co-localize with an exclusively early endosome marker EEA1. It may be present in late endosome as well, and we are currently investigating role of TREM2 in different endosomal compartment (unpublished findings).

Our results suggest that TREM2, like EEA1, is a tethering molecule that provides directionality to vesicular transport from the plasma membrane to early endosomes. TREM2 is mostly distributed intracellularly in two pools: a deposit in the Golgi complex and a population in endo/exocytic vesicles that are continuously translocated to, and recycled from, the cell surface as reported previously in a microglia cell line [57]. The identification of TREM2-positive vesicles as organelles competent for regulated exocytosis might open new insights into the study of membrane trafficking and secretion in neuronal cells.

The pro-inflammatory cytokines IL-1β and TNF-αare secreted by activated parenchymal microglial cells and are potent inducers of cell death in animal models of neurodegeneration [58, 59]. Dysfunctional microglia and peripheral macrophages have been shown to contribute to the disease progression in an animal model of amyotrophic lateral sclerosis [60]. Although innate immune response in the CNS has detrimental effects, it was suggested that it also has beneficial role. The release of pro-inflammatory cytokines after acute trauma is followed by a temporal production of neurotrophic factors such as ciliary neurotrophic factor and insulin-like growth factor 1, both involved in the repair of the injured CNS [61]. The presence of TREM2 in the early stages of inflammation and its reduction with age suggests that it might be involved in repair and proliferation [62]. IL-10 is an anti-inflammatory cytokines involved in repair and found to be reduced in AD brain [63].

TREM2 was present in the nucleus in early stages of microglial proliferation. After LPS treatment, TREM2 expression increased in newly proliferative microglia and did not co-localize with TNF-α or IL-1β whereas it co-localized with IL-10, suggesting that TREM2 might have selective anti-inflammatory roles. Currently we are investigating possible anti-inflammatory role of TREM2. Furthermore, there might be a physiological function of innate immune mediators too.

The functional relevance of innate immune responses in AD, however, is not fully understood [64]. It is not clear which components of the innate immunity are leading to neurodegeneration and which parts of the innate immune response are acting neuroprotectively or even neurodegeneratively.

Conclusion

We have shown that TREM2 is a serum protein transported by macrophages through ventricle walls, CVO, and blood vessels entering the brain parenchyma via radial glial cells. TREM2 protein is essential for neuroplasticity, neurotrophism, and myelination. Later in life, a lack of TREM2 protein may accelerate the aging process and neuronal cell loss. In all aging-related diseases, TREM2 levels declined and lack of TREM2 reduced microglial activity leading to neuroinflammation. As inflammation plays a major role in neurodegenerative diseases, a lack of TREM2 could be the missing link between immunomodulation and neuroprotection.

Footnotes

ACKNOWLEDGMENTS

This research was funded by Medical Research Council (MRC grant number is RNAG/254), National Institute of Health Research (NIHR), The John Van Geest foundation, and Cambridgeshire and Peterborough Foundation NHS Trust, Cambridge, UK. We would like to thank Professor Antony Holland for his encouragement and support, Miss Kirah Goldberg, summer student from University of Montreal for participating in histology techniques, and to Abcam, Cambridge for providing us TREM2 and other antibodies.

Authors’ disclosures available online ().

References

Hardy

, Duff

, Hardy

, Perez-Tur

, Hutton

(1998) Genetic dissection of Alzheimer’s disease and related dementias: Amyloid and its relationship to tau. Nat Neurosci 1, 355–358.

Selkoe

, Bell

, Podlisny

, Price

, Cork

(1987) Conservation of brain amyloid proteins in aged mammals and humans with Alzheimer’s disease. Science 235, 873–877.

Kim

, Joh

(2006) Microglia, major player in the brain inflammation: Their roles in the pathogenesis of Parkinson’s disease. Exp Mol Med 38, 333–347.

Whitton

(2007) Inflammation as a causative factor in the aetiology of Parkinson’s disease. Br J Pharmacol 150, 963–976.

Hirsch

, Vyas

, Hunot

(2012) Neuroinflammation in Parkinson’s disease. Parkinsonism Relat Disord 18(Suppl 1), S210–S212.

Moller

(2010) Neuroinflammation in Huntington’s disease. J Neural Transm (Vienna) 117, 1001–1008.

Holmoy

(2008) T cells in amyotrophic lateral sclerosis. Eur J Neurol 15, 360–366.

Frohman

, Racke

, Raine

(2006) Multiple sclerosis–the plaque and its pathogenesis. N Engl J Med 354, 942–955.

Engelhardt

(2008) The blood-central nervous system barriers actively control immune cell entry into the central nervous system. Curr Pharm Des 14, 1555–1565.

10.

Raha

, Bomford

, Raha-Chowdhury

(2013) Hepcidin and ferroportin participate in iron clearance from brain endothelium: Failure of this process leads to iron accumulation in Alzheimer’s disease. Am J Hematol 88, E156–E156.

11.

Schwartz

, Kipnis

(2005) Protective autoimmunity and neuroprotection in inflammatory and noninflammatory neurodegenerative diseases. J Neurol Sci 233, 163–166.

12.

Town

, Nikolic

, Tan

(2005) The microglial “activation” continuum: From innate to adaptive responses. J Neuroinflammation 2, 24.

13.

Hardy

, Allsop

(1991) Amyloid deposition as the central event in the aetiology of Alzheimer’s disease. Trends Pharmacol Sci 12, 383–388.

14.

Spillantini

, Goedert

(2013) Tau pathology and neurodegeneration. Lancet Neurol 12, 609–622.

15.

Walsh

, Selkoe

(2004) Oligomers on the brain: The emerging role of solublerotein aggregates in neurodegeneration. Protein Pept Lett 11, 213–228.

16.

Raha

, Vaishnav

, Friedland

, Bomford

, Raha-Chowdhury

(2013) The systemic iron-regulatory proteins hepcidin and ferroportin are reduced in the brain in Alzheimer’s disease. Acta Neuropathol Commun 1, 55–.

17.

Daws

, Lanier

, Seaman

, Ryan

(2001) Cloning and characterization of a novel mouse myeloid DAP12-associated receptor family. Eur J Immunol 31, 783–791.

18.

Cannon

, O’Driscoll

, Litman

(2012) Specific lipid recognition is a general feature of CD300 and TREM molecules. Immunogenetics 64, 39–47.

19.

Guerreiro

, Hardy

(2013) TREM2 and neurodegenerative disease. N Engl J Med 369, 1569–1570.

20.

Jonsson

, Stefansson

(2013) TREM2 and neurodegenerative disease. N Engl J Med 369, 1568–1569.

21.

Tanzi

(2015) TREM2 and risk of Alzheimer’s disease–friend or foe? N Engl J Med 372, 2564–2565.

22.

Slattery

, Beck

, Harper

, Adamson

, Abdi

, Uphill

, Campbell

, Druyeh

, Mahoney

, Rohrer

, Kenny

, Lowe

, Leung

, Barnes

, Clegg

, Blair

, Nicholas

, Guerreiro

, Rowe

, Ponto

, Zerr

, Kretzschmar

, Gambetti

, Crutch

, Warren

, Rossor

, Fox

, Collinge

, Schott

, Mead

(2014) R47H TREM2 variant increases risk of typical early-onset Alzheimer’s disease but not of prion or frontotemporal dementia. Alzheimers Dement 10, 602e604–608e604.

23.

Hsieh

, Koike

, Spusta

, Niemi

, Yenari

, Nakamura

, Seaman

(2009) A role for TREM2 ligands in the phagocytosis of apoptotic neuronal cells by microglia. J Neurochem 109, 1144–1156.

24.

Kleinberger

, Yamanishi

, Suarez-Calvet

, Czirr

, Lohmann

, Cuyvers

, Struyfs

, Pettkus

, Wenninger-Weinzierl

, Mazaheri

, Tahirovic

, Lleo

, Alcolea

, Fortea

, Willem

, Lammich

, Molinuevo

, Sanchez-Valle

, Antonell

, Ramirez

, Heneka

, Sleegers

, van der Zee

, Martin

, Engelborghs

, Demirtas-Tatlidede

, Zetterberg

, Van Broeckhoven

, Gurvit

, Wyss-Coray

, Hardy

, Colonna

, Haass

(2014) TREM2 mutations implicated in neurodegeneration impair cell surface transport and phagocytosis. Sci Transl Med 6, 243ra286.

25.

Frank

, Burbach

, Bonin

, Walter

, Streit

, Bechmann

, Deller

(2008) TREM2 is upregulated in amyloid plaque-associated microglia in aged APP23 transgenic mice. Glia 56, 1438–1447.

26.

Kiialainen

, Hovanes

, Paloneva

, Kopra

, Peltonen

(2005) Dap12 and Trem2, molecules involved in innate immunity and neurodegeneration, are co-expressed in the CNS. Neurobiol Dis 18, 314–322.

27.

Humphrey

, Daws

, Spusta

, Niemi

, Torchia

, Lanier

, Seaman

, Nakamura

(2006) TREM2, a DAP12-associated receptor, regulates osteoclast differentiation and function. J Bone Miner Res 21, 237–245.

28.

Satoh

, Kawana

, Yamamoto

, Ishida

, Saito

, Arima

(2013) A survey of TREM2 antibodies reveals neuronal but not microglial staining in formalin-fixed paraffin-embedded postmortem Alzheimer’s brain tissues. Alzheimers Res Ther 5, 30.

29.

Poliani

, Wang

, Fontana

, Robinette

, Yamanishi

, Gilfillan

, Colonna

(2015) TREM2 sustains microglial expansion during aging and response to demyelination. J Clin Invest 125, 2161–2170.

30.

Paloneva

, Manninen

, Christman

, Hovanes

, Mandelin

, Adolfsson

, Bianchin

, Bird

, Miranda

, Salmaggi

, Tranebjaerg

, Konttinen

, Peltonen

(2002) Mutations in two genes encoding different subunits of a receptor signaling complex result in an identical disease phenotype. Am J Hum Genet 71, 656–662.

31.

Thrash

, Torbett

, Carson

(2009) Developmental regulation of TREM2 and DAP12 expression in the murine CNS: Implications for Nasu-Hakola disease. Neurochem Res 34, 38–45.

32.

Xing

, Titus

, Humphrey

(2015) The TREM2-DAP12 signaling pathway in Nasu-Hakola disease: A molecular genetics perspective. Res Rep Biochem 5, 89–100.

33.

Hsiao

, Chapman

, Nilsen

, Eckman

, Harigaya

, Younkin

, Yang

, Cole

(1996) Correlative memory deficits, Abeta elevation, and amyloid plaques in transgenic mice. Science 274, 99–102.

34.

Ashe

(2001) Learning and memory in transgenic mice modeling Alzheimer’s disease. Learn Mem 8, 301–308.

35.

Kumar-Singh

, Pirici

, McGowan

, Serneels

, Ceuterick

, Hardy

, Duff

, Dickson

, Van Broeckhoven

(2005) Dense-core plaques in Tg2576 and PSAPP mouse models of Alzheimer’s disease are centered on vessel walls. Am J Pathol 167, 527–543.

36.

Ulrich

, Finn

, Wang

, Shen

, Mahan

, Jiang

, Stewart

, Piccio

, Colonna

, Holtzman

(2014) Altered microglial response to Abeta plaques in APPPS1-21 mice heterozygous for TREM2. Mol Neurodegener 9, 20.

37.

Frautschy

, Yang

, Irrizarry

, Hyman

, Saido

, Hsiao

, Cole

(1998) Microglial response to amyloid plaques in APPsw transgenic mice. Am J Pathol 152, 307–317.

38.

Jay

, Miller

, Cheng

, Graham

, Bemiller

, Broihier

, Xu

, Margevicius

, Karlo

, Sousa

, Cotleur

, Butovsky

, Bekris

, Staugaitis

, Leverenz

, Pimplikar

, Landreth

, Howell

, Ransohoff

, Lamb

(2015) TREM2 deficiency eliminates TREM2+ inflammatory macrophages and ameliorates pathology in Alzheimer’s disease mouse models. J Exp Med 212, 287–295.

39.

Wang

, Cella

, Mallinson

, Ulrich

, Young

, Robinette

, Gilfillan

, Krishnan

, Sudhakar

, Zinselmeyer

, Holtzman

, Cirrito

, Colonna

(2015) TREM2 lipid sensing sustains the microglial response in an Alzheimer’s disease model. Cell 160, 1061–1071.

40.

Raha-Chowdhury

, Raha

, Forostyak

, Zhao

, Stott

SRW

, Bomford

(2015) Expression and cellular localization of hepcidin mRNA and protein in normal rat brain. BMC Neurosci 16, 24.

41.

Raha-Chowdhury

, Andrews

, Gruen

(2005) CAT 53: A protein phosphatase 1 nuclear targeting subunit encoded in the MHC Class I region strongly expressed in regions of the brain involved in memory, learning, and Alzheimer’s disease. Mol Brain Res 138, 70–83.

42.

Marland

, Pan

, Buttery

(2011) Rac GTPase-activating protein (Rac GAP) alpha1-Chimaerin undergoes proteasomal degradation and is stabilized by diacylglycerol signaling in neurons. J Biol Chem 286, 199–207.

43.

Goncalves

, Rodrigues-Duarte

, Rodo

, Vieira de Moraes

, Marques

, Penha-Goncalves

(2013) TREM2 governs Kupffer cell activation and explains belr1 genetic resistance to malaria liver stage infection. Proc Natl Acad Sci U S A 110, 19531–19536.

44.

Otero

, Shinohara

, Zhao

, Cella

, Gilfillan

, Colucci

, Faccio

, Ross

, Teitelbaum

, Takayanagi

, Colonna

(2012) TREM2 and beta-catenin regulate bone homeostasis by controlling the rate of osteoclastogenesis. J Immunol 188, 2612–2621.

45.

Heppner

, Ransohoff

, Becher

(2015) Immune attack: The role of inflammation in Alzheimer disease. Nat Rev Neurosci 16, 358–372.

46.

Lill

, Rengmark

, Pihlstrom

, Fogh

, Shatunov

, Sleiman

, Wang

, Liu

, Lassen

, Meissner

, Alexopoulos

, Calvo

, Chio

, Dizdar

, Faltraco

, Forsgren

, Kirchheiner

, Kurz

, Larsen

, Liebsch

, Linder

, Morrison

, Nissbrandt

, Otto

, Pahnke

, Partch

, Restagno

, Rujescu

, Schnack

, Shaw

, Tumani

, Tysnes

, Valladares

, Silani

, van den Berg

, van Rheenen

, Veldink

, Lindenberger

, Steinhagen-Thiessen

, Consortium

, Teipel

, Perneczky

, Hakonarson

, Hampel

, von Arnim

, Olsen

, Van Deerlin

, Al-Chalabi

, Toft

, Ritz

, Bertram

(2015) The role of TREM2 R47H as a risk factor for Alzheimer’s disease, frontotemporal lobar degeneration, amyotrophic lateral sclerosis, and Parkinson’s disease. Alzheimers Dement 11, 1407–1416.

47.

Koizumi

, Shigemoto-Mogami

, Nasu-Tada

, Shinozaki

, Ohsawa

, Tsuda

, Joshi

, Jacobson

, Kohsaka

, Inoue

(2007) UDP acting at P2Y6 receptors is a mediator of microglial phagocytosis. Nature 446, 1091–1095.

48.

Sierra

, Encinas

, Deudero

, Chancey

, Enikolopov

, Overstreet-Wadiche

, Tsirka

, Maletic-Savatic

(2010) Microglia shape adult hippocampal neurogenesis through apoptosis-coupled phagocytosis. Cell Stem Cell 7, 483–495.

49.

Costello

, Keenan

, McManus

, Falvey

, Lynch

(2016) The age-related neuroinflammatory environment promotes macrophage activation, which negatively impacts synaptic function. Neurobiol Aging 43, 140–148.

50.

Forabosco

, Ramasamy

, Trabzuni

, Walker

, Smith

, Bras

, Levine

, Hardy

, Pocock

, Guerreiro

, Weale

, Ryten

(2013) Insights into TREM2 biology by network analysis of human brain gene expression data. Neurobiol Aging 34, 2699–2714.

51.

Lampron

, Pimentel-Coelho

, Rivest

(2013) Migration of bone marrow-derived cells into the central nervous system in models of neurodegeneration. J Comp Neurol 521, 3863–3876.

52.

Gate

, Rezai-Zadeh

, Jodry

, Rentsendorj

, Town

(2010) Macrophages in Alzheimer’s disease: The blood-borne identity. J Neural Transm (Vienna) 117, 961–970.

53.

Matarin

, Salih

, Yasvoina

, Cummings

, Guelfi

, Liu

, Nahaboo Solim

, Moens

, Paublete

, Ali

, Perona

, Desai

, Smith

, Latcham

, Fulleylove

, Richardson

, Hardy

, Edwards

(2015) A genome-wide gene-expression analysis and database in transgenic mice during development of amyloid or tau pathology. Cell Rep 10, 633–644.

54.

Wang

, Ulland

, Ulrich

, Song

, Tzaferis

, Hole

, Yuan

, Mahan

, Shi

, Gilfillan

, Cella

, Grutzendler

, DeMattos

, Cirrito

, Holtzman

, Colonna

(2016) TREM2-mediated early microglial response limits diffusion and toxicity of amyloid plaques. J Exp Med 213, 667–675.

55.

Yuan

, Condello

, Keene

, Wang

, Bird

, Paul

, Luo

, Colonna

, Baddeley

, Grutzendler

(2016) TREM2 haplodeficiency in mice and humans impairs the microglia barrier function leading to decreased amyloid compaction and severe axonal dystrophy. Neuron 90, 724–739.

56.

Sessa

, Podini

, Mariani

, Meroni

, Spreafico

, Sinigaglia

, Colonna

, Panina

, Meldolesi

(2004) Distribution and signaling of TREM2/DAP12, the receptor system mutated in human polycystic lipomembraneous osteodysplasia with sclerosing leukoencephalopathy dementia. Eur J Neurosci 20, 2617–2628.

57.

Prada

, Ongania

, Buonsanti

, Panina-Bordignon

, Meldolesi

(2006) Triggering receptor expressed in myeloid cells 2 (TREM2) trafficking in microglial cells: Continuous shuttling to and from the plasma membrane regulated by cell stimulation. Neuroscience 140, 1139–1148.

58.

Pasparakis

, Alexopoulou

, Episkopou

, Kollias

(1996) Immune and inflammatory responses in TNF alpha-deficient mice: A critical requirement for TNF alpha in the formation of primary B cell follicles, follicular dendritic cell networks and germinal centers, and in the maturation of the humoral immune response. J Exp Med 184, 1397–1411.

59.

Beaulieu

, Lin

, Mick

, Koupenova

, Weinberg

, Kramer

, Genco

, Tanriverdi

, Larson

, Benjamin

, Freedman

(2014) Interleukin 1 receptor 1 and interleukin 1beta regulate megakaryocyte maturation, platelet activation, and transcript profile during inflammation in mice and humans. Arterioscler Thromb Vasc Biol 34, 552–564.

60.

Boillee

, Yamanaka

, Lobsiger

, Copeland

, Jenkins

, Kassiotis

, Kollias

, Cleveland

(2006) Onset and progression in inherited ALS determined by motor neurons and microglia. Science 312, 1389–1392.

61.

Nguyen

, Julien

, Rivest

(2002) Innate immunity: The missing link in neuroprotection and neurodegeneration? Nat Rev Neurosci 3, 216–227.

62.

Kipnis

, Schwartz

(2005) Controlled autoimmunity in CNS maintenance and repair: Naturally occurring CD4+CD25+ regulatory T-Cells at the crossroads of health and disease. Neuromolecular Med 7, 197–206.

63.

Guillot-Sestier

, Doty

, Gate

, Rodriguez

Jr , Leung

, Rezai-Zadeh

, Town

(2015) Il10 deficiency rebalances innate immunity to mitigate Alzheimer-like pathology. Neuron 85, 534–548.

64.

Guillot-Sestier

, Doty

, Town

(2015) Innate immunity fights Alzheimer’s disease. Trends Neurosci 38, 674–681.