Upregulated Expression of Heparanase and Heparanase 2 in the Brains of Alzheimer’s Disease

Abstract

Background: Heparan sulfate proteoglycans (HSPGs) promote amyloid-β peptide and tau fibrillization in Alzheimer’s disease (AD) and provide resistance against proteolytic breakdown. Heparanase (HPSE) is the only enzyme that cleaves heparan sulfate (HS). Heparanase 2 (HPSE2) lacks HS-degrading activity, although it is able to interact with HS with high affinity.

Objective: To analyze HPSE and HPSE2 expressions at different stages of AD.

Methods: RT-PCR was used to analyze transcription levels of both heparanases at different stages of AD, and immunohistochemistry was performed to localize each one in different parts of the brain.

Results: Both proteins appeared overexpressed at different stages of AD. Immunohistochemistry indicated that the presence of the heparanases was related to AD pathology, with intracellular deposits found in degenerated neurons. At the extracellular level, HPSE was observed only in neuritic plaques with a fragmented core, while HPSE2 appeared in those with compact cores as well.

Conclusion: Given the involvement of HSPGs in AD pathology, there would seem to be a relationship between the regulation of heparanase expression, the features of the disease, and a possible therapeutic alternative.

Keywords

Alzheimer’s disease amyloid amyloid-β glycosaminoglycan heparan sulfate heparanase

INTRODUCTION

Alzheimer’s disease (AD) is the most common neurodegenerative disease, and the main cause of dementia in older people worldwide. AD is characterized by progressive loss of memory and cognitive dysfunction. The disease inexorably leads to death, with patients usually dying of complications of chronic illness [1, 2]. AD is proteinopathy-driven, principally by two types of abnormal protein deposition in the human brain: the extracellular accumulation of cytotoxic amyloid-β peptide (Aβ) in senile plaques, and the intracellular accumulation of hyperphosphorylated forms of a microtubule associated protein tau, in neurofibrillary tangles [3, 4]. Little to date is known of how these plaques trigger the onset of neurodegeneration. However, it is thought that heparan sulfate proteoglycans (HSPGs) may, on the one hand, promote Aβ or tau fibrillization, and, on the other, provide resistance against proteolytic breakdown [5]. In addition to Aβ, the most common AD-related subtype of senile plaques, called neuritic plaques (NPs), also contain accessory molecules, such as heparan sulfate (HS), apolipoprotein E, serum amyloid-P component, and α1-antichymotrypsin. Previous data indicates that the HS-Aβ interaction contributes to every stage of pathogenesis in AD, including production, clearance, accumulation, aggregation, and toxicity of Aβ [6 –8].

Heparanase (HPSE) is an endo-β-D-glucuronidase that cleaves specific linkages in the structure of HS, yielding biologically active fragments [9]. By altering HSPGs on the cell surface, HPSE is thought to regulate the cellular response to external stimuli [10]. HPSE develops multiple functions in cancer, inflammation, infections, diabetes, and atherosclerosis [11 –17], and in terms of neurodegeneration, recent studies have shown that overexpression of HPSE lowers the amyloid burden in transgenic mouse models of AD [18]. Heparanase 2 (HPSE2) is a homologue of HPSE that lacks HS-degrading activity, although it is able to interact with HS with high affinity [19, 20]. HPSE2 could act as a natural competitive inhibitor of HPSE due to is ability to associate with HPSE, and it appears, to modulate its enzymatic activity and signaling properties [14, 19].

In this study, we investigate for the first time the expression of two genes encoding heparanases in different stages of AD, using human brain tissue from different brain areas, principally following the Braak & Braak classification [21].

MATERIALS AND METHODS

Materials

The following materials were purchased from the manufacturers indicated: RNeasy Kit and RNase-Free DNase from Qiagen (Hilden, Germany); High-Capacity cDNA Reverse Transcription Kit and PowerSYBR Green PCR Master Mix from Applied Biosystems (Foster City, CA); GenElute PCR clean-up kit and 3–3’ diaminobenzidine from Sigma-Aldrich (St. Louis, MO); EnVisiontrademark Flex/HRP and high pH Envision FLEX target retrieval solution from Dako (Glostrup, Denmark). All other chemicals were obtained from commercial sources and were of analytical grade.

The following antibodies were used in this study: Goat anti-heparanase 1 polyclonal antibody (L-19), which recognizes the proteolytically-processed highly active HPSE (50 kDa active form of HPSE), was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA) and rabbit anti-heparanase-2 polyclonal antibody, from GeneTex (Atlanta, GA). Both primary antibodies were properly validated as specific for the HPSE and HPSE2 proteins [14]. Anti-rabbit (sc-2004) and anti-goat (sc-2005) secondary antibodies were also from Santa Cruz Biotechnology (Santa Cruz, CA). Molecular Weight of proteolytically processed highly active HPA1:50 kDa.

Patients and samples

Samples from 18 patients with AD and 6 controls were collected at the Brain Biobank of the Hospital Universitario de Araba between February 2013 and October 2015 following approval from the same institute’s Review Board on Ethical Procedures, and after informed consent for the research had been received from each patient or their relatives. The diagnosis of AD was based on morphological and immunohistochemical criteria according to the most up-to-date grading classification (NIA-RI Consensus 1997). The characteristics of the patients studied (age, gender) and the timing of the postmortem of each sample were recorded (Table 1). Samples from the different brain areas were collected following the Braak & Braak classification [21]. Additionally, samples from basal ganglia (pallidum) and the cerebellum were used as an internal control, since they are assumed to not be altered in this disease.

Table 1

Patient characteristics and descriptive statistics

Patients
	Total (N = 24)	Control (N = 6)	Mild AD (N = 6)	Moderate AD (N = 6)	Severe AD (N = 6)
Sex (%)
Male	7 (30)	3 (50)	1 (17)	2 (33)	1 (17)
Female	17 (70)	3 (50)	5 (83)	4 (67)	5 (83)
Age (Mean±sd)	84±11	79±16	89±5	89±10	80±12
Brain Weight (g)	1128±111	1148±57	1177±26	1122±31	967±19
Postmortem interval (h)	17±5	18±5	19±5	15±5	20±4

AD, Alzheimer’s disease; Mild AD, I-II Braak & Braak classification; Moderate AD, III-IV Braak & Braak classification; Severe AD, V-VI Braak & Braak classification.

Total RNA isolation and cDNA synthesis

To obtain the RNA, tissue fragments of between 20 and 30 mg in weight were homogenized using a polytron PT 2100 (Kinematica Inc.; Bohemia, NY), and RNA was isolated using the RNeasy kit, following the manufacturer’s specifications. To ensure removal of residual contaminating DNA, samples were subjected to treatment with RNase-free DNase during the purification process itself. The concentration of RNA obtained was determined spectrophotometrically by measuring absorbance using a Picodrop Microliter UV/Vis spectrophotometer (Picodrop Limited, UK). The samples were divided into aliquots of 10μl and either used for reverse transcription reactions or stored at – 20°C until furtheruse.

cDNA synthesis was carried out using the High Capacity cDNA Transcription Kit following the manufacturer’s guidelines. The reactions were performed using an iCycler IQ thermocycler (BioRad; Hercules, CA), using 2μg of RNA as starting material. The reaction products were cleaned using the PCR Clean-Up GenElute kit following the manufacturer’s instructions. Finally, the aliquots containing the cDNA were diluted 1:20 with water and used for qRT-PCR assays or stored at – 20°C until use.

qRT-PCR reactions

In all cases, specific oligonucleotides were designed on different exons or exon junctions, using the program Primer 3 (http://biotools.umassmed.edu/bioapps/primer3_www.cgi). The size of the amplicon in all cases was between 70 and 150 base pairs and wherever possible Tm was above 77°C. The theoretical Tm for each amplicon was determined using the program Biomath (http://www.promega.com/biomath/calc11.).

The primer sequences were: HPSE (Gene ID 10855) forward 5’ ATGCTCAGTTGCTCCTGGAC 3’, reverse 5’ CTCCTAACTGCGACCCATTG 3’; HPSE2 (Gene ID 60495) forward 5’ caccctgatgttatgctggag 3’, reverse 5’ tccagagcaatcagcaaagtta 3’.

A minimum four repetitions of all the qRT-PCR reactions were carried out in a final volume of 10μl, in accordance with the manufacturer’s specifications, using 1μl of the cDNA dilution as template, with 2μl of primer pair mix (200 nM final concentration) and 5μl of SYBR Green mix, assembled in 96-well microtiter plates. The plates were sealed with optical film and centrifuged at 2500 rpm for 5 min before being placed in a Real-Time ABI Prism Detection System device (Applied Biosystems; Foster City, CA) with the following cycling conditions: 95°C for 10 min, 40 cycles of 95°C for 15 s followed by 60°C for 60 s. Following the thermal cycling and data collection steps, amplifier products were analyzed using a melt curve program (95°C for 1 min, 55°C for 1 min, then increments of 0.5°C per cycle for 80 cycles of 10 s each). For each amplification, the presence of a single peak with a Tm corresponding to the theoretical value previously calculated was verified. Actin was included on each plate as a control gene in order to compare run variation and to normalize individual gene expression.

Data analysis

To calculate the efficiencies of amplification for each gene we used the program LinRegPCR (http://www.gene-quantification.de/download.html), taking the best correlation coefficient (after considering a minimum of 3 points within the window of linearity) and establishing the average of all positive amplifications. The expression values of the genes of interest were calculated as (1 + efficiency) ^–ΔCt (relative to actin as the housekeeping gene).

Immunohistochemistry

Paraffin embedded tissue sections were treated with xylene to render them diaphanous (the paraffin being removed later by passing it through decreasing alcohol concentrations until 100% water was reached). Rehydrated sections were rinsed in phosphate buffered saline (PBS) containing 1% tween-20. For the detection of HPSE2, sections were heated in high pH Envision FLEX target retrieval solution at 65°C for 20 min and then incubated for 20 min at room temperature in the same solution. For HPSE detection, the final step was omitted.

Endogenous peroxidase activity (3% H₂O₂) and non-specific binding (33% fetal calf serum) were blocked and the sections were incubated overnight at 4C with primary antibodies using a 1:100 dilution. Ready to use labelled polymer-HRP (DAKO, Spain) was used as secondary antibodies, and 3–3’ diaminobenzidine was employed as a chromogen. Finally, samples were counterstained with hematoxylin, dehydrated, and mounted in Entellan^® (Merck, Germany). The sections were studied and photographed under a light microscope (Nikon - Eclipse 80i).

Immunohistochemistry assessment

The protein expression levels were evaluated by two independent experts (and in the case of disagreement, a third).

Statistical analysis

A non-parametric Wilcoxon test was used for the statistical analysis of the experiments with the level of significance set at p < 0.05. All analyses were performed using the Statistics for Windows program (Statsoft Inc.; Tulsa, OK).

RESULTS

Analysis of differential gene expression

Initially we used qRT-PCR to perform a quantitative analysis of the differential transcription of the coding genes using samples of 7 different tissue types from various encephalic areas. Mild AD cases (I-II Braak & Braak classification), Moderate AD cases (III-IV Braak & Braak classification), and Severe AD cases (V-VI Braak & Braak classification) were analyzed and compared to healthy controls. The samples corresponded to patients of both sexes aged between 52 and 103 years. Determination of the expression of HPSE and HPSE 2 from the different areas of AD brains was performed by immunohistochemistry.

Differential expression of heparanase

Analysis of the transcription levels of the HPSE gene by means of qRT-PCR detected expression levels in all samples studied. There were statistically significant differences in alterations between AD stages as defined by Braak & Braak staging. Additionally, significant overexpression of HPSE was noted in neurodegenerated areas of AD brains. Furthermore, significant HPSE underexpression was observed in pallidum in mild and moderate AD brains. The cerebellum of brains at different AD stages did not show any significant alterations in HPSE transcription levels (Fig. 1).

Compared with healthy tissue, immunohistochemistry showed the presence of intracellular HPSE deposits in atrophic neurons with neurofibrillary tangles. At the extracellular level, HPSE was mainly observed in NPs with fragmented core rather than those with a large dense core, pointing to the existence of a gradient of HPSE expression. Basal ganglia and cerebellum were mostly negative(Fig. 2).

Fig.1

Differential transcription of heparanase and heparanase 2 in Alzheimer’s disease (AD). Relative abundance for controls (black bars), mild AD (dark gray bars), moderate AD (light gray bars) and severe AD (white bars) are plotted on a log scale for each gene assayed and the spreads represent standard deviations. Genes and zones that display significant differences in their transcription levels are highlighted. a: p = 0.000011; b: p = 0.000001; c: p = 0.000000; d: p = 0.013545; e: p = 0.01817; f: p = 0.026365; g: p = 0.000005; h: p = 0.002675; i: p = 0.000021; j: p = 0.043012; k: p = 0.013804; l: p = 0.000149; m: p = 0.000079; n: p = 0.00000; o: p = 0.025297; p: p = 0.048391; q: p = 0.024351; r: p = 0.001165; s: p = 0.041894; t: p = 0.037990; u: p = 0.000007; v: p = 0.000063; w: p = 0.005458; x: p = 0.005616; y: p = 0.000002; z: p = 0.000009; A: p = 0.012136; B: p = 0.001540; C: p = 0.004565; D: p = 0.007672. Values on the Y axis are represented on a logarithmic scale.

Fig.2

Immunohistochemical staining of HPSE in Alzheimer’s disease. A) Negative expression of HPSE in neurons and glial cells in control brain samples. B, C) HPSE overexpression in neurons with neurofibrillary tangles (B) and granulovacuolar degeneration (C). D-F) NPs showing different core size, from big to medium-sized and small (white arrows); in inverse correlation to HPSE deposits from mild (D) to moderate (E) and high levels (F) (black arrow). Magnification 600X.

Differential expression of heparanase 2

We analyzed the levels of transcription of HPSE2 in cerebral tissue using primers designed to detect wild-type transcripts (HPSE2c). Analysis of the transcription levels of HPSE2 detected expression in all samples studied. Stage-dependent (based on Braak & Braak) statistically significant differences were found in AD brains. Additionally, significant HPSE2 overexpression was noted, mainly in neurodegenerated areas of AD brains and in the cerebellum in all AD cases. Pallidum, on the other hand, showed no significant alterations of HPSE2 transcription levels (Fig. 1).

HPSE2 protein expression was analyzed by immunohistochemistry, showing the presence of intracellular HPSE2 deposits in atrophic neurons with neurofibrillary degeneration. At the extracellular level, HPSE2 was observed in almost all NPs. HPSE2 was undetectable in pallidum and cerebellum, although the latter showed a very mild diffuse positivity (Fig. 3).

Fig.3

Immunohistochemical staining of HPSE 2 in Alzheimer’s disease. A) Negative expression of HPSE2 in neurons and glial cells in control brain samples. B, C) HPSE2 overexpression in neurons with neurofibrillary tangles (B) and granulovacuolar degeneration (C). D-F) NPs showing different forms of HPSE 2 deposits. Concentrated deposits in unfragmented core of NPs (D), dispersed deposits (E), and filament-like deposits are indicated (F) (blue arrows). Magnification 600X.

DISCUSSION

AD is a fatal progressive neurodegenerative disorder mainly caused by extracellular accumulation of Aβ protein in plaques, which is thought to account for the onset of neurodegeneration. Several in vitro studies have demonstrated the interaction of Aβ with HS [22, 23]. In addition, studies have demonstrated that HS molecules are preferentially colocalized with Aβ around the dense cores of senile plaques [18, 24] and it has been proposed that Aβ-HS interaction is mutually protective, in that Aβ is protected from protease degradation and HS is protected from HPSE degradation [22, 25]. HPSE is a multitasking protein characterized by involvement in enzymatic and non-enzymatic activities. The former activity gives rise to fragments of HSPG chains which are biologically involved in multiple physiological and pathological functions [9]. Thanks to the cleavage of HS, HPSE also promotes the release and diffusion of several HS-linked molecules, such as growth factors, cytokines, and enzymes. In addition to degrading HS chains, HPSE has non-enzymatic functions that trigger several signaling pathways [26]. In the present work, we have focused on the study of the expression levels of 2 genes which encode heparanases at different stages of AD using RT-PCR, and then localized the proteins in the tissue through immunohistochemistry.

Concerning HPSE, a significant overexpression was noted in neurodegenerated areas of AD brains, which mostly correlated well with the Braak & Braak stage for each case. We speculate that HPSE overexpression in AD could be a consequence of the disease itself, rather than being part of the cause. Under this scenario, different brain cells would release HPSE in order to reduce the existing AD pathology by degrading HS chains, exposing Aβ deposits to degradation. Many different treatment approaches have tried to focus on inhibiting tau-aggregation or reducing Aβ deposits by decreasing production, preventing aggregation, or increasing removal [27, 28]. There have been many clinical trials for AD treatments, and although the majority have proved inconclusive [29 –34], these treatment options continue to be pursued. However, it is our view that the lack of progress in AD treatment is due to the majority of studies having underestimated either the functional or structural roles of HS molecules in AD [35].

Published data indicates that intact HS chains are required at multiple sites in order to mediate neurodegeneration, further supporting the notion that HPSE is possibly a crucial element that may have potential treatment implications in AD [36]. Additionally, recent experimental evidence suggests that transcellular propagation of fibrillar protein aggregates drives the progression of neurodegenerative diseases in a prion-like manner [37]. Likewise, the mechanism by which aggregated extracellular proteins, such as tau, bind and enter cells to trigger intracellular fibril formation occurs via HSPG binding [38]. HPSE could, therefore, act to modulate or impede this process, as heparinase III does in vitro in order to slow down neurodegeneration [38]. However, there are potentially contradictory roles that can be ascribed to HPSE in AD: On the one hand, HPSE could impair inflammatory response and macrophage-mediated clearance of Aβ favoring AD progression. On the other, HPSE could block the internalization and propagation of pathologic tau throughout the brain [38, 39]. The significant overexpression of HPSE in calcarine sulcus (neocortex) at early stages of AD could be explained by the existence of extracellular deposits related to fragmented NPs. Likewise, the significant underexpression of HPSE in the pallidum could be the result of strong HPSE diffusion to neurodegenerative areas, even at early stages of disease. And finally, we have found the presence of HPSE principally in those NPs with a fragmented core, which may possibly contribute to breaking down plaques and exposing Aβ to degradation [40 –42].

We observed that HPSE2 was significantly overexpressed in AD cases following neurodegeneration, the same as HPSE, albeit with lower levels of ARNm expression. Similar again to the findings for HPSE, significant changes in HPSE2 were mostly AD-stage-dependent. Histologically, HPSE2 was found to be associated to NPs and neurofibrillary tangles. Furthermore, a mild diffuse neurophilic immunostaining was noted in AD-related areas and cerebellum. In this sense, HPSE2 binds to HSPGs but, unlike HPSE, it fails to become internalized, and remains on the cell surface for a relatively long period of time [20]. Detailed characterization of HPSE2 at the biochemical, cellular, and clinical levels is not available to date, and its role in normal physiology and pathological disorders is unclear. However, recent studies have shown that HPSE2 is an endogenous inhibitor of HPSE activity, likely due to its high affinity to HS and its ability to associate physically with HPSE [20]. In this light, HPSE2 could inhibit HPSE activity, facilitating the progression of AD pathology, by impeding the clearance of Aβ deposits and giving rise to more internalization and propagation of pathologic tau throughout the brain.

In conclusion, our study reveals details of the behavior of both heparanases in AD, pointing to the combined overexpression of HPSE and HPSE2, mostly related to AD pathology. While HPSE activity would seem to either release Aβ deposits or block tau intracellular fibril formation and propagation, HPSE2 appears to act as an inhibitor of HPSE. Finally, the relevance, both biological and clinical, for studying both heparanases is based on the fact that no other molecules are capable of performing the same function, making both enzymes an attractive potential target for medical treatment. In this regard, considering that HS-Aβ interaction contributes to every stage of the Aβ pathogenesis in AD, including production, clearance, accumulation, aggregation, and toxicity, it is rational to hypothesize that interfering in the HS-Aβ interaction may have multiple beneficialeffects.

Footnotes

ACKNOWLEDGMENTS

This study was funded by the Health Department of the Basque Country [grant 2014111060 to IFV]; the Government of the Principado de Asturias (Spain) for consolidated research groups [grant FC-15-GRUPIN14-141 to BG]; and the Fundación de Investigación Oftalmológica through the Fundación Cristina Masaveu Peterson [Instituto Universitario Fernández-Vega; to BG, JM, LQ].

Authors’ disclosures available online ().

References

Blennow

, de Leon

, Zetterberg

(2006) Alzheimer’s disease. Lancet 368, 387–403.

Sarkar

, Irwin

, Singh

, Riccetti

(2016) Alzheimer’s disease: The silver tsunami of the 21(st) century. Neural Regen Res 11, 693–697.

Hardy

(2009) The amyloid hypothesis for Alzheimer’s disease: A critical reappraisal. J Neurochem 110, 1129–1134.

Selkoe

, Hardy

(2016) The amyloid hypothesis of Alzheimer’s disease at 25 years. EMBO Mol Med 8, 595–608.

van Horssen

, Wesseling

, van den Heuvel

, de Waal

, Verbeek

(2003) Heparan sulphate proteoglycans in Alzheimer’s disease and amyloid-related disorders. Lancet Neurol 2, 482–492.

Zhang

, Zhang

, Wang

, Li

(2014) Towards understanding the roles of heparan sulfate proteoglycans in Alzheimer’s disease. Biomed Res Int 2014, 516028.

van Horssen

, Kleinnijenhuis

, Maass

, Rensink

, Otte-Holler

, David

, van den Heuvel

, Wesseling

, de Waal

, Verbeek

(2002) Accumulation of heparan sulfate proteoglycans in cerebellar senile plaques. Neurobiol Aging 23, 537–545.

Cui

, Freeman

, Jacobson

, Small

(2013) Proteoglycans in the central nervous system: Role in development, neural repair, and Alzheimer’s disease. IUBMB Life 65, 108–120.

Vlodavsky

, Goldshmidt

, Zcharia

, Atzmon

, Rangini-Guatta

, Elkin

, Peretz

, Friedmann

(2002) Mammalian heparanase: Involvement in cancer metastasis, angiogenesis and normal development. Semin Cancer Biol 12, 121–129.

10.

Nasser

(2008) Heparanase involvement in physiology and disease. Cell Mol Life Sci 65, 1706–1715.

11.

Vlodavsky

, Iozzo

, Sanderson

(2013) Heparanase: Multiple functions in inflammation, diabetes and atherosclerosis. Matrix Biol 32, 220–222.

12.

Fernandez-Vega

, Garcia

, Crespo

, Castanon

, Menendez

, Astudillo

, Quiros

(2013) Specific genes involved in synthesis and editing of heparan sulfate proteoglycans show altered expression patterns in breast cancer. BMC Cancer 13, 24.

13.

Fernandez-Vega

, Garcia-Suarez

, Garcia

, Crespo

, Astudillo

, Quiros

(2015) Heparan sulfate proteoglycans undergo differential expression alterations in right sided colorectal cancer, depending on their metastatic character. BMC Cancer 15, 742.

14.

Garcia

, ` Garcia-Suarez

, Fernandez-Vega

, Vallina

, Astudillo

, Quiros

(2016) Heparanase and heparanase 2 display differently deregulation in neuroendocrine tumors, depending on their differentiation grade. Histol Histopathol 31, 73–81.

15.

Garcia

, Fernandez-Vega

, García-Suárez

, Castañón

, Quirós

(2014) The role of heparan sulfateproteoglycans in bacterial infections. J Med Microbiol Diagn 3, 157–164.

16.

Fernández-Vega

I GB

, García-Suárez

, Castañón

, Quirós

(2014) Alterations of heparan sulfate proteoglycans in cancer. J Glycobiol 3, 109–114.

17.

García-Suárez

, Fernandez-Vega

, Quirós

(2013) Multiple alterations of heparan sulphate in cancer. OA Cancer 1, 1.

18.

Jendresen

, Cui

, Zhang

, Vlodavsky

, Nilsson

, Li

(2015) Overexpression of heparanase lowers the amyloid burden in amyloid-beta precursor protein transgenic mice. J Biol Chem 290, 5053–5064.

19.

Arvatz

, Barash

, Nativ

, Ilan

, Vlodavsky

(2010) Post-transcriptional regulation of heparanase gene expression by a 3’ AU-rich element. FASEB J 24, 4969–4976.

20.

Levy-Adam

, Feld

, Cohen-Kaplan

, Shteingauz

, Gross

, Arvatz

, Naroditsky

, Ilan

, Doweck

, Vlodavsky

(2010) Heparanase 2 interacts with heparan sulfate with high affinity and inhibits heparanase activity. J Biol Chem 285, 28010–28019.

21.

Braak

, Braak

(1991) Neuropathological stageing of Alzheimer-related changes. Acta Neuropathol 82, 239–259.

22.

Bame

, Danda

, Hassall

, Tumova

(1997) Abeta(1-40) prevents heparanase-catalyzed degradation of heparan sulfate glycosaminoglycans and proteoglycans. A role for heparan sulfate proteoglycan turnover in Alzheimer’s disease. J Biol Chem 272, 17005–17011.

23.

Leveugle

, Scanameo

, Ding

, Fillit

(1994) Binding of heparan sulfate glycosaminoglycan to beta-amyloid peptide: Inhibition by potentially therapeutic polysulfated compounds. Neuroreport 5, 1389–1392.

24.

O’Callaghan

, Sandwall

, Li

, Yu

, Ravid

, Guan

, van Kuppevelt

, Nilsson

, Ingelsson

, Hyman

, Kalimo

, Lindahl

, Lannfelt

, Zhang

(2008) Heparan sulfate accumulation with Abeta deposits in Alzheimer’s disease and Tg2576 mice is contributed by glial cells. Brain Pathol 18, 548–561.

25.

Gupta-Bansal

, Frederickson

, Brunden

(1995) Proteoglycan-mediated inhibition of A beta proteolysis. A potential cause of senile plaque accumulation. J Biol Chem 270, 18666–18671.

26.

Moretti

, Sinnappah-Kang

, Toller

, Curcio

, Marchetti

(2006) HPSE-1 expression and functionality in differentiating neural cells. J Neurosci Res 83, 694–701.

27.

Wischik

, Edwards

, Lai

, Roth

, Harrington

(1996) Selective inhibition of Alzheimer disease-like tau aggregation by phenothiazines. Proc Natl Acad Sci U S A 93, 11213–11218.

28.

Sereno

, Coma

, Rodriguez

, Sanchez-Ferrer

, Sanchez

, Gich

, Agullo

, Perez

, Avila

, Guardia-Laguarta

, Clarimon

, Lleo

, Gomez-Isla

(2009) A novel GSK-3beta inhibitor reduces Alzheimer’s pathology and rescues neuronal loss in vivo. Neurobiol Dis 35, 359–367.

29.

Lambracht-Washington

, Rosenberg

(2013) Advances in the development of vaccines for Alzheimer’s disease. Discov Med 15, 319–326.

30.

Winblad

, Andreasen

, Minthon

, Floesser

, Imbert

, Dumortier

, Maguire

, Blennow

, Lundmark

, Staufenbiel

, Orgogozo

, Graf

(2012) Safety, tolerability, and antibody response of active Abeta immunotherapy with CAD106 in patients with Alzheimer’s disease: Randomised, double-blind, placebo-controlled, first-in-human study. Lancet Neurol 11, 597–604.

31.

Sperling

, Jack

Jr , Black

, Frosch

, Greenberg

, Hyman

, Scheltens

, Carrillo

, Thies

, Bednar

, Black

, Brashear

, Grundman

, Siemers

, Feldman

, Schindler

(2011) Amyloid-related imaging abnormalities in amyloid-modifying therapeutic trials: Recommendations from the Alzheimer’s Association Research Roundtable Workgroup. Alzheimers Dement 7, 367–385.

32.

Vellas

, Andrieu

, Sampaio

, Wilcock

, European Task Force g (2007) Disease-modifying trials in Alzheimer’s disease: A European task force consensus. Lancet Neurol 6, 56–62.

33.

Schneider

, Mangialasche

, Andreasen

, Feldman

, Giacobini

, Jones

, Mantua

, Mecocci

, Pani

, Winblad

, Kivipelto

(2014) Clinical trials and late-stage drug development for Alzheimer’s disease: An appraisal from 1984 to 2014. J Intern Med 275, 251–283.

34.

Mangialasche

, Solomon

, Winblad

, Mecocci

, Kivipelto

(2010) Alzheimer’s disease: Clinical trials and drug development. Lancet Neurol 9, 702–716.

35.

Aprahamian

, Stella

, Forlenza

(2013) New treatment strategies for Alzheimer’s disease: Is there a hope? Indian J Med Res 138, 449–460.

36.

Zhang

, Wang

, Li

(2014) Implications of heparan sulfate and heparanase in neuroinflammation. Matrix Biol 35, 174–181.

37.

Brundin

, Melki

, Kopito

(2010) Prion-like transmission of protein aggregates in neurodegenerative diseases. Nat Rev Mol Cell Biol 11, 301–307.

38.

Holmes

, DeVos

, Kfoury

, Li

, Jacks

, Yanamandra

, Ouidja

, Brodsky

, Marasa

, Bagchi

, Kotzbauer

, Miller

, Papy-Garcia

, Diamond

(2013) Heparan sulfate proteoglycans mediate internalization and propagation of specific proteopathic seeds. Proc Natl Acad Sci U S A 110, E3138–E3147.

39.

Zhang

, Wang

, O’Callaghan

, Hjertstrom

, Jia

, Gong

, Zcharia

, Nilsson

, Lannfelt

, Vlodavsky

, Lindahl

, Li

(2012) Heparanase overexpression impairs inflammatory response and macrophage-mediated clearance of amyloid-beta in murine brain. Acta Neuropathol 124, 465–478.

40.

Reilly

(2000) Crucial role of heparan sulfate proteoglycan (agrin) in beta-amyloid formation in Alzheimer’s disease. J Neurol 247, 663–664.

41.

Shimizu

, Ghazizadeh

, Sato

, Oguro

, Kawanami

(2009) Interaction between beta-amyloid protein and heparan sulfate proteoglycans from the cerebral capillary basement membrane in Alzheimer’s disease. J Clin Neurosci 16, 277–282 .

42.

Snow

, Sekiguchi

, Nochlin

, Fraser

, Kimata

, Mizutani

, Arai

, Schreier

, Morgan

(1994) An important role of heparan sulfate proteoglycan (Perlecan) in a model system for the deposition and persistence of fibrillar A beta-amyloid in rat brain. Neuron 12, 219–234.