Mitochondria-Division Inhibitor 1 Protects Against Amyloid-β induced Mitochondrial Fragmentation and Synaptic Damage in Alzheimer’s Disease

Abstract

The purpose our study was to determine the protective effects of mitochondria division inhibitor 1 (Mdivi1) in Alzheimer’s disease (AD). Mdivi1 is hypothesized to reduce excessive fragmentation of mitochondria and mitochondrial dysfunction in AD neurons. Very little is known about whether Mdivi1 can confer protective effects in AD. In the present study, we sought to determine the protective effects of Mdivi1 against amyloid-β (Aβ)- and mitochondrial fission protein, dynamin-related protein 1 (Drp1)-induced excessive fragmentation of mitochondria in AD progression. We also studied preventive (Mdivi1+Aβ₄₂) and intervention (Aβ₄₂+Mdivi1) effects against Aβ₄₂ in N2a cells. Using real-time RT-PCR and immunoblotting analysis, we measured mRNA and protein levels of mitochondrial dynamics, mitochondrial biogenesis, and synaptic genes. We also assessed mitochondrial function by measuring H₂O₂, lipid peroxidation, cytochrome oxidase activity, and mitochondrial ATP. MTT assays were used to assess the cell viability. Aβ₄₂ was found to impair mitochondrial dynamics, lower mitochondrial biogenesis, lower synaptic activity, and lower mitochondrial function. On the contrary, Mdivi1 enhanced mitochondrial fusion activity, lowered fission machinery, and increased biogenesis and synaptic proteins. Mitochondrial function and cell viability were elevated in Mdivi1-treated cells. Interestingly, Mdivi1 pre- and post-treated cells treated with Aβ showed reduced mitochondrial dysfunction, and maintained cell viability, mitochondrial dynamics, mitochondrial biogenesis, and synaptic activity. The protective effects of Mdivi1 were stronger in N2a+Aβ₄₂ pre-treated with Mdivi1, than in N2a+Aβ₄₂ cells than Mdivi1 post-treated cells, indicating that Mdivi1 works better in prevention than treatment in AD like neurons.

Keywords

Amyloid-β dynamin-related protein 1 mitochondrial division inhibitor 1 mitochondrial dynamics mitochondrial dysfunction mitochondrial fission synaptic pathology

INTRODUCTION

Alzheimer’s disease (AD) is a progressive, age-dependent illness, characterized by the progressive decline of memory, cognitive function, and changes in behavior and personality [1 –4]. Currently, over 46.8 million people worldwide, including 5.4 million Americans, live with AD-related dementia, and this number is estimated to increase to 131.5 million by 2050 [5]. AD-related dementia has huge economic consequences, with the total worldwide medical cost of dementia in 2015 estimated at $818 billion. By 2018, AD, including AD-related dementia, is expected to become a trillion-dollar disease [5]. With lifespan increasing in humans, AD is headed toward becoming the major health concern of elderly persons. Currently, there are no drugs or agents that can delay disease progression in elderly individuals and in patients with AD. Further, there are no definitive peripheral biomarkers that indicate disease in its early stages so that effective therapeutics can be initiated.

AD is largely associated with synaptic damage, mitochondrial structural and functional changes, inflammatory responses, hormonal imbalance, cell cycle changes, and neuronal loss [6 –8]. In addition, there are two major pathological hallmarks: intracellular neurofibrillary tangles and extracellular amyloid-β (Aβ) deposits in the learning and memory regions of brain [3, 9]. Genetic mutations in APP, PS1, and PS2 genes cause about 1–2% of the total number of AD cases. Several factors contribute to late-onset AD, including lifestyle, diet, environmental exposure, stroke, traumatic brain injury, and multiple genetic variants in genetic loci, including sortilin-related receptor 1 gene clusterin, the complement component receptor 1, CD2AP, CD33, EPHA1, and MS4A4/MS4A6E genes and the ApoE4 genotype [7, 8].

Recently, several lines evidence suggest that mitochondrial abnormalities are largely involved in AD progression: 1) several studies found increased free radical production, lipid peroxidation, oxidative DNA damage, oxidative protein damage, and decreased ATP production in postmortem AD brains, compared to brains from age-matched healthy subjects [10 –14], in AD transgenic mice, and in cell lines that express mutant APP or cells treated with Aβ [15, 16]; 2) studies of mitochondrial enzyme activities found decreased levels of cytochrome oxidase activity, pyruvate dehydrogenase, and α-ketodehydrogenase in fibroblasts, lymphoblasts, and postmortem brains from AD patients, compared to neurons, fibroblasts, and lymphoblasts from age-matched healthy subjects [16]; 3) mitochondrial DNA changes were higher in postmortem brain tissue from AD patients and aged-matched healthy subjects, compared to DNA changes in postmortem brain tissue from young, healthy subjects, suggesting that the accumulation of mitochondrial DNA in AD pathogenesis is age-related [17, 18]; 4) several groups investigated mitochondrial gene expressions in postmortem AD brains and in brain specimens from AD transgenic mice [19 –21]. They found mitochondrially-encoded genes abnormally expressed in the brains AD patients and AD mice. A recent, time-course global gene expression study in an AD mouse model (Tg2576) and age-matched non-transgenic littermates revealed an upregulation of mitochondrial genes in the Tg2576 mice, suggesting that mitochondrial metabolism is impaired by mutant APP/Aβ and that the upregulation of mitochondrial genes may be a compensatory response to mutant APP/Aβ [20]. Furthermore, Manczak and colleagues found an abnormal expression of mitochondrially-encoded genes in postmortem AD brains compared to the brains of healthy subjects, suggesting impaired mitochondrial metabolism in AD [22]; and 5) recent mitochondrial studies in brain tissue from AD patients and neuronal cells expressing mutant APP found that Aβ fragments mitochondria and causes structural changes in neurons from AD patients [21 , 23–27].

Recent Aβ and mitochondrial studies found impaired mitochondrial dynamics (excessive mitochondrial fragmentation and reduced fusion) in AD postmortem brains and AD cell and mouse models [21 , 23–31]. Further, recent studies from our laboratory revealed that Aβ interacts with Drp1, with a subsequent increase in free radical production, which in turn activates Drp1 and Fis1, and causes excessive mitochondrial fragmentation, defective transport of mitochondria to synapses, low synaptic ATP, and synaptic dysfunction in AD neurons [21, 24]. Given the increase in free radical production and excessive fragmentation in mitochondria that are involved in AD, we hypothesize that drugs capable of reducing free radicals or decreasing excessive mitochondrial fragmentation may be effective therapeutic approaches to treat AD.

Excessive mitochondrial fragmentation is well documented in neurodegenerative diseases, including AD, Parkinson’s disease, and Huntington’s disease, leading to impaired mitochondrial dynamics, defective axonal transport, low synaptic ATP and, ultimately, synaptic damage [32, 33]. Based on excessive mitochondrial fragmentation, impaired mitochondrial dynamics, defective axonal transport, low synaptic ATP, and synaptic damage that are present in AD, it has been proposed that mitochondrial division inhibitors are potential candidates to treat excessive mitochondrial fragmentation and its associated factors in AD progression and pathogenesis.

To identify mitochondrial fission inhibitors, several groups have independently screened chemical libraries and have found several inhibitors: Mdivi 1 [34], Dynasore [35], and P110 [36]. Among these, Mdivi 1 has been extensively investigated with experimental rodent models of epilepsy and seizures [37], ischemia/reperfusion injury [38 –41], oxygen glucose deprivation [42], and such conditions as aggregation of endosomes and vesicle fusion during exocytosis [43]. In all of these diseased states and conditions, Mdivi 1 was found to have beneficial effects on affected tissues and cells, by reducing excessive mitochondrial fission and maintaining the fission-fusion balance in mitochondria and the normal functioning of cells.

Mdivi1 is a cell-permeable, selective mitochondrial fission inhibitor; its molecular weight is 353.22. It inhibits GTPase Drp1 activity by blocking the self-assembly of Drp1, resulting in reversible formation of elongated and tubular mitochondria in wild-type cells [34]. However, it is unclear whether Mdivi1 reduces Aβ-induced excessive mitochondrial fragmentation, maintains and/or enhances mitochondrial function and synaptic activities in Aβ-treated N2a cells.

In the present study, we sought to determine the protective effects of Mdivi1 against Aβ-induced excessive mitochondrial fragmentation and synaptic toxicities in mouse neuroblastoma (N2a) cells. Using Aβ₄₂ peptide and Mdivi1 and mouse neuroblastoma (N2a) cells: 1) we measured mRNA and protein levels of mitochondrial fission and fusion genes, biogenesis genes, and synaptic genes; 2) we assessed mitochondrial function by measuring H₂O₂, lipid peroxidation, cytochrome oxidase activity, and mitochondrial ATP; and 3) and we determined the cell viability.

MATERIALS AND METHODS

Chemicals and reagents

The Aβ₄₂ peptide was purchased from Anaspec (Fremont, CA, USA); water soluble Mdivi1 was made in our laboratory; and N2a cells were purchased from American Type Culture Collection (ATCC) (Manassas, VA, USA). Dulbecco’s Modified Eagle Medium (DMEM) and Minimum Essential Medium (MEM), penicillin/streptomycin, Trypsin-EDTA, and fetal bovine serum were purchased from GIBCO (Gaithersberg, MD, USA).

Tissue culture work

The N2a cells were grown for 3 days in a serum-free medium (1:1 mixture of DMEM and OptiMEM, plus penicillin and streptomycin [Invitrogen, Carlsbad, CA, USA]) until the cells developed neuronal processes. As shown in Fig. 1, these cells were used for 5 groups— 1 control group and 4 treatment groups: 1) untreated N2a cells (the control group), 2) N2a cells treated (incubated) with the Aβ₄₂ peptide (Aβ₄₂ treatment group; 20μM final concentration) for 6 h, 3) N2a cells treated with Mdivi1 for 24 h (Mdivi1 treatment group, 20μM final concentration), 4) N2a cells treated with the Aβ₄₂ peptide for 6 h then treated with Mdivi1 for 24 h (Aβ₄₂+Mdivi1 treatment group), and 5) N2a cells treated with Mdivi1 for 24 h and then treated with the Aβ₄₂ peptide for 6 h (Mdivi1+Aβ₄₂ treatment group). As shown in Fig. 1, we performed 4 independent cell cultures and treatments for all experiments(n = 4).

Fig.1

Experimental design of Mdivi1 and Aβ₄₂ treatments in mouse neuroblastoma (N2a) cells.

The N2a cells from all 5 groups (4 treatment groups and 1 control group) were harvested, and their cell pellets were collected and used for quantitative real-time RT-PCR, immunoblotting analysis of mitochondrial and synaptic proteins, and mitochondrial functional assays for hydrogen peroxide production, lipid peroxidation, cytochrome c oxidase activity, and MTT determination. Isolated mitochondria from N2a cells from all 5 groups were used to determine mitochondrial ATP as described in Reddy et al. [6]. As shown in Fig. 1, we performed 4 independent cell cultures and treatments for each parameter: levels of mRNA, proteins, mitochondrial functional assays for lipid peroxidation, cytochrome c oxidase activity, ATP production, and cell viability.

Quantitative real-time RT-PCR

Using the reagent TriZol (Invitrogen), total RNA was isolated from cell pellets from the 5 N2a cell groups (Fig. 1). Using primer express software (Applied Biosystems, Carlsbad, CA, USA), we designed the oligonucleotide primers for the housekeeping genes β-actin, GAPDH, mitochondrial structural genes, fission genes (Drp1, Fis1), fusion genes (MFN1, MFN2, Opa1), biogenesis genes (PGC1α, Nrf1, Nrf2, TFAM), and synaptic genes (synaptophysin and PSD95) (see Table 1 for primer sequences and amplicon sizes). Using SYBR-Green chemistry-based quantitative real-time RT-PCR, mRNA expressions of the above-mentioned genes were measured, as described by Manczak and Reddy [44].

Table 1

Summary of quantitative real-time RT-PCR oligonucleotide primers used in measuring mRNA expression in mitochondrial dynamics, mitochondrial biogenesis, and synaptic genes in in N2a cells treated with Aβ₄₂, Mdivi1+Aβ₄₂, Aβ₄₂+Mdivi1 relative to untreated N2a cells

Gene	DNA Sequence (5’-3’)	PCR Product Size
Mitochondrial Dynamics Genes
Drp1	Forward Primer ATGCCAGCAAGTCCACAGAA	86
Reverse Primer TGTTCTCGGGCAGACAGTTT
Fis1	Forward Primer CAAAGAGGAACAGCGGGACT	95
Reverse Primer ACAGCCCTCGCACATACTTT
MFN1	Forward Primer GCAGACAGCACATGGAGAGA	83
Reverse Primer GATCCGATTCCGAGCTTCCG
MFN2	Forward Primer TGCACCGCCATATAGAGGAAG	78
Reverse Primer TCTGCAGTGAACTGGCAATG
Opa1	Forward Primer ACCTTGCCAGTTTAGCTCCC	82
Reverse Primer TTGGGACCTGCAGTGAAGAA
Mitochondrial Biogenesis Genes
PGC1α	Forward Primer GCAGTCGCAACATGCTCAAG	83
Reverse Primer GGGAACCCTTGGGGTCATTT
Nrf1	Forward Primer AGAAACGGAAACGGCCTCAT	96
Reverse Primer CATCCAACGTGGCTCTGAGT
Nrf2	Forward Primer ATGGAGCAAGTTTGGCAGGA	96
Reverse Primer GCTGGGAACAGCGGTAGTAT
TFAM	Forward Primer TCCACAGAACAGCTACCCAA	84
Reverse Primer CCACAGGGCTGCAATTTTCC
Synaptic Genes
Synaptophysin	Forward Primer CTGCGTTAAAGGGGGCACTA	81
Reverse Primer ACAGCCACGGTGACAAAGAA
PSD95	Forward Primer CTTCATCCTTGCTGGGGGTC	90
Reverse Primer TTGCGGAGGTCAACACCATT
Housekeeping Genes
Beta Actin	Forward Primer AGAAGCTGTGCTATGTTGCTCTA	91
Reverse Primer TCAGGCAGCTCATAGCTCTTC
GAPDH	Forward Primer TTCCCGTTCAGCTCTGGG	59
Reverse Primer CCCTGCATCCACTGGTGC

The mRNA transcript level was normalized against β-actin and the GAPDH at each dilution. The standard curve was the normalized mRNA transcript level, plotted against the log-value of the input cDNA concentration at each dilution. To compare β-actin, GAPDH, and relative quantification was performed according to the (CT) method (Applied Biosystems). Briefly, this method involved averaging triplicate samples, which were taken as the CT values for β-actin, GAPDH, and neuroprotective markers. β-actin normalization was used in the present study because the β-actin CT values were similar for the control and the 4 treatment groups in terms of mitochondrial dynamics, biogenesis, and synaptic genes. The ΔCT-value was obtained by subtracting the average β-actin CT value from the average CT-value of the synaptic mitochondrial ETC genes and the mitochondrial structural genes. The ΔCT of untreated cells was used as the calibrator. The fold change was calculated according to the formula 2^∧–(Δ ΔCT), where ΔΔCT is the difference between ΔCT and the ΔCT calibrator value. To determine the statistical significance of mRNA expression, the CT value differences between the untreated cells and other experimental groups of cells were used in relation to β-actin normalization. Statistical significance was calculated, using one-way ANOVA. Fold changes of mRNA were compared 2 ways - comparison 1, untreated N2a cells with 1) N2a+Mdivi1, 2) N2a+Aβ₄₂, 3) N2a+Aβ₄₂+Mdivi1, 4) N2a+Mdivi1+Aβ₄₂, and comparison 2, N2a+Aβ₄₂ with 1) N2a+Aβ₄₂+Mdivi1and 2) N2a+Mdivi1+Aβ₄₂.

Immunoblotting analysis

To determine the effects of Mdivi1 and Aβ₄₂ at the protein levels of mitochondrial dynamics and biogenesis and synaptic genes that exhibited altered mRNA expression, we performed immunoblotting analyses of protein lysates isolated from cell pellets of all 5 groups of cells (Fig. 1), as described in Reddy et al. [6]. Twenty μg of protein was resolved from each group of cells on a 4–12% Nu-PAGE gel (Invitrogen). The resolved proteins were transferred to nylon membranes (Novax Inc., San Diego, CA, USA) and were then incubated for 1 h at room temperature with a blocking buffer (5% dry milk dissolved in a TBST buffer). The PVDF membranes were incubated overnight with primary antibodies (see Table 2) and washed 3 times with a TBST buffer at 10-min intervals. They were then incubated for 2 h with appropriate secondary antibodies, followed by 3 additional washes at 10-min intervals. Mitochondrial and synaptic proteins were detected with chemiluminescence reagents (Pierce Biotechnology, Rockford, IL, USA), and the bands from immunoblots were quantified on a Kodak scanner, following manufacturer’s instructions (ID Image Analysis Software, Kodak Digital Science, Kennesaw, GA, USA), and the gel images were analyzed from gel images captured with a Kodak digital science CD camera. The lanes were marked to define the positions and specific regions of the bands. An ID fine-band command was used to locate and to scan the bands in each lane and to record the readings.

Table 2

Summary of antibody dilutions and conditions used in the immunoblotting analysis of mitochondrial dynamics, mitochondrial biogenesis, and synaptic proteins in N2a cells treated with Aβ₄₂, Mdivi1+Aβ₄₂, and Aβ₄₂+Mdivi1 relative to untreated N2a cells

Marker	Primary Antibody: Species and Dilution	Purchased from Company, City &State	Secondary Antibody, Dilution	Purchased from Company, City &State
Drp1	Rabbit Polyclonal 1:500	Novus Biological, Littleton, CO	Donkey Anti-rabbit HRP 1:10,000	GE Healthcare Amersham, Piscataway, NJ
Fis1	Rabbit Polyclonal 1:500	MBL International Corporation-life, Woburn, MA	Donkey Anti-rabbit HRP 1:10,000	GE Healthcare Amersham, Piscataway, NJ
Mfn1	Rabbit Polyclonal 1:400	Novus Biological, Littleton, CO	Donkey Anti-rabbit HRP 1:10,000	GE Healthcare Amersham, Piscataway, NJ
Mfn2	Rabbit Polyclonal 1:400	Abcam, Cambridge, MA	Donkey Anti-rabbit HRP 1:10,000	GE Healthcare Amersham, Piscataway, NJ
OPA1	Rabbit Polyclonal 1:500	Novus Biological, Littleton, CO	Donkey anti-rabbit HRP 1:10,000	GE Healthcare Amersham, Piscataway, NJ
SYN	Rabbit Monoclonal 1:400	Abcam, Cambridge, MA	Donkey Anti-rabbit HRP 1:10,000	GE Healthcare Amersham, Piscataway, NJ
PSD95	Rabbit Monoclonal 1:300	Abcam, Cambridge, MA	Donkey Anti-rabbit HRP 1:10,000	GE Healthcare Amersham, Piscataway, NJ
PGC1α	Rabbit Polyclonal 1:500	Novus Biological, Littleton, CO	Donkey Anti-rabbit HRP 1:10,000	GE Healthcare Amersham, Piscataway, NJ
Nrf1	Rabbit Polyclonal 1:300	Santa Cruz Biotechnology, Inc., Dallas, TX	Donkey Anti-rabbit HRP 1:10,000	GE Healthcare Amersham, Piscataway, NJ
Nrf2	Rabbit Polyclonal 1:300	Novus Biological, Littleton, CO	Donkey Anti-rabbit HRP 1:10,000	GE Healthcare Amersham, Piscataway, NJ
TFAM	Rabbit Polyclonal 1:300	Novus Biological, Littleton, CO	Donkey Anti-rabbit HRP 1:10,000	GE Healthcare Amersham, Piscataway, NJ
B-actin	Mouse Monoclonal 1:500	Sigma-Aldrich, St Louis, MO	Sheep Anti-mouse HRP 1:10,000	GE Healthcare Amersham, Piscataway, NJ

Measurement of soluble Aβ₄₂ levels in untreated N2a cells and N2a cells treated with Mdivi1

The cell pellets were washed several times with PBS buffer and washed pellets were used and measured soluble Aβ₄₂ levels in the N2a cells+Aβ₄₂, Aβ₄₂+Mdivi1, and Mdivi1+Aβ₄₂ treatment groups following method described in Manczak et al. [23]. Briefly, protein lysates from untreated control N2a cells and lysates from 4 treatment groups were homogenized in a Tris-buffered saline (pH 8.0) containing protease inhibitors (20 mg/ml pepstatin A, aprotinin, phophsoramidon, and leupeptin; 0.5 mM phenylmethanesulfonyl fluoride and 1 mM ethyleneglycol-bis(flaminoethyl ether)-NN tetraacetic acid). Samples were sonicated briefly and centrifuged at 10,000 g for 20 min at 4°C. The soluble fraction was used to determine the soluble Aβ by ELISA. For each sample, Aβ_1 - 40 and Aβ_1 - 42 were measured with commercial colorimetric ELISA kits (Biosource International, Camarillo, CA, USA) that were specific for each species. A 96-well plate reader was used, following the manufacturer’s instructions. Each sample was run in duplicate. Protein concentrations of the homogenates were determined following the BSA method, and Aβ was expressed as pg Aβ/mg protein.

Mitochondrial functional assays

2.6.1 H₂O₂ production

Using an Amplex^® Red H₂O₂ assay kit (Molecular Probes, Eugene, OR, USA), H₂O₂ production was measured using cell pellets, as described in Manczak and Reddy [44]. Briefly, H₂O₂ production was measured in the protein lysates prepared from cell pellets of control untreated N2a cells and 4 treatment groups (Fig. 1). A BCA protein assay kit (Pierce Biotechnology) was used to estimate protein concentration. The reaction mixture contained mitochondrial proteins (μg/μl), Amplex Red reagents (50μM), horseradish peroxidase (0.1 U/ml), and a reaction buffer (1X). The mixture was incubated at room temperature for 30 min, followed by spectrophotometer readings of fluorescence (570 nm). Finally, H₂O₂ production was determined, using a standard curve equation expressed in nmol/μg mitochondrial protein. H₂O₂ levels were compared 2 ways –comparison 1, untreated N2a cells with 1) N2a+Mdivi1, 2) N2a+Aβ₄₂, 3) N2a+Aβ₄₂+Mdivi1, 4) N2a+Mdivi1+Aβ₄₂, and comparison 2, N2a+Aβ₄₂with 1) N2a+Aβ₄₂+Mdivi1and 2) N2a+Mdivi1+Aβ₄₂.

2.6.2 Lipid peroxidation assay

Lipid peroxidates are unstable indicators of oxidative stress in the brain. The final product of lipid peroxidation is 4-hydroxy-2-nonenol (HNE), which was measured in the N2a cell lysates prepared from cell pellets of control and treatment groups. We used an HNE-His ELISA kit (Cell BioLabs, Inc., San Diego, CA, USA), as described in Manczak and Reddy [44]. Briefly, freshly prepared protein as added to a 96-well protein binding plate and incubated overnight at 4°C. The protein then washed 3 times with a buffer. After the last wash, the anti-HNE-His antibody was added to the protein in the wells, incubated for 2 h at room temperature, and then washed again 3 times. The samples were then incubated with a secondary antibody conjugated with peroxidase for 2 h at room temperature, followed by incubation with an enzyme substrate. Optical density was measured (at 450 nm) to quantify the level of HNE. Lipid peroxidation levels were compared 2 ways –comparison 1, untreated N2a cells with 1) N2a+Mdivi1, 2) N2a+Aβ₄₂, 3) N2a+Aβ₄₂+Mdivi1, 4) N2a+Mdivi1+Aβ₄₂, and comparison 2, N2a+Aβwith 1) N2a+Aβ₄₂+Mdivi1and 2) N2a+Mdivi1+Aβ₄₂.

2.6.3 Cytochrome c oxidase activity

Cytochrome oxidase activity was measured in each of the 5 groups of N2a cells. Enzyme activity was assayed spectrophotometrically using a Sigma Kit (Sigma–Aldrich) following manufacturer’s instructions. Briefly, 2μg protein lysate was added to 1.1 ml of a reaction solution containing 50μl 0.22 mM ferricytochrome c that was fully reduced by sodium hydrosulphide, Tris–HCl (pH 7.0), and 120 mM potassium chloride. The decrease in absorbance at 550 mM was recorded for 1-min reactions at 10-s intervals. Cytochrome oxidase activity was measured according to the following formula: mU/mg total mitochondrial protein = (A/min sample –(A/min blank)×1.1 mg protein×21.84). The protein concentrations were determined following the BCA method. Cytochrome oxidase activity levels were compared 2 ways –comparison 1, untreated N2a cells with 1) N2a+Mdivi1, 2) N2a+Aβ₄₂, 3) N2a+Aβ₄₂+Mdivi1, 4) N2a+Mdivi1+Aβ₄₂, and comparison 2, N2a+Aβ₄₂ with 1) N2a+Aβ₄₂+Mdivi1and 2) N2a+Mdivi1+Aβ₄₂.

2.6.4 ATP levels

ATP levels were measured in N2a cell mitochondria from the treatment groups using an ATP determination kit (Molecular Probes). A bioluminescence assay was used, based on the reaction of ATP with recombinant firefly luciferase and its substract luciferin. Luciferase catalyzes the formation of light from ATP and luciferin. It is the emitted light that is linearly related to the concentration of ATP, which is measured with a luminometer. ATP levels were measured from mitochondrial pellets using a standard curve method. ATP levels were compared 2 ways –comparison 1, untreated N2a cells with 1) N2a+Mdivi1, 2) N2a+Aβ₄₂, 3) N2a+Aβ₄₂+Mdivi1, 4) N2a+Mdivi1+Aβ₄₂, and comparison 2, N2a+Aβ₄₂with 1) N2a+Aβ₄₂+Mdivi1and 2) N2a+Mdivi1+Aβ₄₂.

Statistical considerations

Statistical analyses were conducted for mitochondrial structural and functional parameters in the N2a cells from the 5 experimental groups, using one-way ANOVA with Dunnett correction. The parameters included H₂O₂, cytochrome oxidase activity, lipid peroxidation, ATP production, and cell viability. To determine the effect of Mdivi1 on N2a cells, in the absence and presence of Aβ₄₂, we analyzed and compared data in 2 ways –comparison 1, untreated N2a cells with 1) N2a+Mdivi1, 2) N2a+Aβ₄₂, 3) N2a+Aβ₄₂+Mdivi1, 4) N2a+Mdivi1+Aβ₄₂, and comparison 2, N2a+Aβ with 1) N2a+Aβ+Mdivi1 (curative) and 2) N2a+Mdivi1+Aβ₄₂ (preventive).

RESULTS

mRNA expressions of mitochondrial dynamics genes

3.1.1 Amyloid-β₄₂ treatment

In the N2a cells treated with Aβ₄₂ compared to untreated N2a cells, mRNA expression levels were significantly higher: in the fission Drp1 by 1.4-fold (p = 0.02) and Fis1 by 1.4-fold (p = 0.03) (Table 3). In contrast, mRNA expression levels of mitochondrial fusion genes were lower but not significant - Mfn1 by –1.2-fold, Mfn2 by –1.3-fold, and Opa1 by –1.2-fold. These findings indicate the presence of abnormal mitochondrial dynamics in cells treated with Aβ.

Table 3
mRNA fold changes in N2a cells treated with Aβ₄₂ and Mdivi1

Genes mRNA fold changes compare mRNA fold changes

with untreated cells compare with Aβ₄₂-treated cells

Mdivi1 Aβ₄₂ Aβ₄₂+Mdivi1 Mdivi1+Aβ₄₂ Aβ₄₂+Mdiv1 Mdivi1+Aβ₄₂

Mitochondrial Structural genes

Drp1 –1.5^* 1.4^* –1.2 –1.1 –1.5^* –1.5^*

Fis1 –1.3 1.4^* –1.2 –1.2 –1.7^* –1.6^*

Mfn1 1.3 –1.2 1.3 2.1^* 1.6^* 2.6^**

Mfn2 1.2 –1.3 1.2 1.7^* 1.6^* 2.2^*

OPA1 1.2 –1.2 1.0 1.9^* 1.3 2.3^*

Mitochondrial Biogenesis Genes

PGC1α 2.2^* –5.8^ 1.4 1.1 8.1^* 6.5^**

Nrf1 2.2^* –2.0^* 1.0 1.3 2.0^* 2.7^**

Nrf2 1.6^* –2.1^* 1.0 1.3 2.0^* 2.7^**

TFAM 1.5^* –2.5^* 1.2 1.3 2.9^ 3.2^

Synaptic Genes

Synaptophysin 1.3 –1.4^* 1.2 1.7^* 1.5^* 2.2^*

PSD95 5.1^** –2.6^* 4.8^** 1.5^* 8.6^* 3.8^

Genes	mRNA fold changes compare	mRNA fold changes
Mitochondrial Structural genes
Drp1	–1.5^*	1.4^*	–1.2	–1.1	–1.5^*	–1.5^*
Fis1	–1.3	1.4^*	–1.2	–1.2	–1.7^*	–1.6^*
Mfn1	1.3	–1.2	1.3	2.1^*	1.6^*	2.6^**
Mfn2	1.2	–1.3	1.2	1.7^*	1.6^*	2.2^*
OPA1	1.2	–1.2	1.0	1.9^*	1.3	2.3^*
Mitochondrial Biogenesis Genes
PGC1α	2.2^*	–5.8^**	1.4	1.1	8.1^***	6.5^**
Nrf1	2.2^*	–2.0^*	1.0	1.3	2.0^*	2.7^**
Nrf2	1.6^*	–2.1^*	1.0	1.3	2.0^*	2.7^**
TFAM	1.5^*	–2.5^*	1.2	1.3	2.9^**	3.2^**
Synaptic Genes
Synaptophysin	1.3	–1.4^*	1.2	1.7^*	1.5^*	2.2^*
PSD95	5.1^**	–2.6^*	4.8^**	1.5^*	8.6^***	3.8^**

^*p≤0.05; ^**p≤0.005; ^***p≤0.0005.

3.1.2 Mdivi1

The mRNA levels of N2a cells treated with Mdiv1 were significantly lower in the fission genes Drp1 (1.5-fold decrease, p = 0.01 and Fis1 (1.3-fold decrease) and higher for the fusion genes Mfn1 by 1.3-fold, Mfn2 by 1.2-fold, and Opa1 by 1.2-fold (Table 3).

3.1.3 Treatment with Aβ₄₂ and Mdivi1

In the N2a cells treated with Aβ₄₂ and then treated with Mdivi1, the mRNA levels were unchanged for Drp1 and Fis1 and for Mfn1, Mfn2 and Opa1 and CypD, compared to the mRNA levels of untreated N2a cells (Table 3). The mRNA levels of N2a cells treated with Mdivi1 and then treated with Aβ₄₂ did were significantly higher for the fusion genes Mfn1 by 2.1-fold (p = 0.01), Mfn2 by 1.7-fold (p = 0.03), and Opa1 by 1.9-fold (p = 0.01) (Table 3).

Mitochondrial biogenesis genes

3.2.1 Aβ₄₂

To determine the effects of Aβ₄₂ and Mdivi1 on mitochondrial biogenesis genes, mRNA expression levels of PGC1α, Nrf1, Nrf2, and TFAM genes were measured. Significantly lower mRNA expressions were found in the biogenesis genes from N2a cells treated with Aβ₄₂ relative to the mRNA expression level of untreated cells: –PGC1α by 5.8-fold (p = 0.001), Nrf1 by 2.0-fold (p = 0.01), Nrf2 by 2.1-fold (p = 0.01), and TFAM by 2.5-fold (p = 0.01) (Table 3).

3.2.2 Mdivi1

mRNA levels were significantly increased for PGC1α by a 2.2-fold (p = 0.01), Nrf1 by a 2.2-fold (p = 0.01), Nrf2 by 1.6-fold (p = 0.03), and TFAM by a 1.5-fold (p = 0.03) in Mdivi-treated cells relative to untreated cells (Table 3). These observations indicate that Mdivi1 increases mitochondrial biogenesis activity.

3.2.3 Aβ₄₂+Mdivi1

In cells treated with Aβ₄₂ first and then treated with Mdivi1, mRNA expression levels were unchanged for Nrf1, Nrf2 and only slightly higher for PGC1α (by 1.4-fold) and TFAM (1.2-fold) (Table 3).

3.2.4 Mdivi1+Aβ₄₂

In cells treated with Mdivi1 and then treated with Aβ₄₂, levels of mRNA expression were slightly higher for biogenesis genes: PGC1α by 1.1-fold, Nrf1 by 1.3-fold, Nrf2 by 1.3, and TFAM by 1.3 (Table 3). These results suggest that Mdivi1 treatment prevented Aβ₄₂-induced biogenesis toxicity.

Synaptic genes

3.3.1 Aβ₄₂

In cells treated with Aβ₄₂ compared to untreated cells, mRNA expression levels were lower for synaptophysin by 1.4-fold (p = 0.04) and PSD95 by 2.6-fold (p = 0.004), indicating that Aβ₄₂ reduces synaptic activity (Table 3).

3.3.2 Mdivi1

mRNA levels were significantly higher for PSD95 5.1-fold (p = 0.004) and higher for synaptophysin by 1.3-fold in the Mdivi1-treated cells (Table 3). These findings indicate that Mdivi1 boosts synaptic activity in healthy cells.

3.3.3 Aβ₄₂+Mdivi1

In cells treated with Aβ₄₂ and then treated with Mdivi1, mRNA levels were significantly higher for PSD95 by 4.8-fold (p = 0.001) and slightly higher for synaptophysin 1.2-fold (Table 3). These observations suggest that Mdivi1 rescued synaptic activity from Aβ₄₂-induced toxicity.

3.3.4 Mdivi1+Aβ

In cells treated with Mdivi1 and then treated with Aβ₄₂, significantly higher mRNA expression levels were found for synaptophysin by1.7-fold (p = 0.01) and PSD95 by 1.5-fold (p = 0.04) (Table 3), indicating that Mdivi1 prevented Aβ₄₂-induced synaptic activity.

3.3.5 Comparison to Aβ₄₂-treated N2a cells

As shown in Table 3, mRNA expression levels of fission genes were lower in N2a cells treated with Aβ₄₂+Mdivi1 (Drp1 by 1.5-fold, p = 0.03; Fis1 by 1.7-fold, p = 0.02), and with Mdivi1+Aβ₄₂ (Drp1 by 1.5-fold, p = 0.02; Fis1 by 1.6-fold, p = 0.03) relative to the expression levels of fission genes in N2a cells treated only with Aβ₄₂. In contrast, fusion genes were higher in the N2a cells treated with Aβ₄₂+Mdivi1 (Mfn1 by 1.6-fold, p = 0.04; Mfn2 by 1.6-fold, p = 0.03; Opa1 by 1.3) and Mdivi1+Aβ₄₂ (Mfn1 by 2.6-fold, p = 0.003; Mfn2 by 2.2-fold, p = 0.01; Opa1 by 2.3-fold, p = 0.002) than the N2a cells treated only with Aβ₄₂.

Mitochondrial biogenesis genes were greater in the N2a cells treated with Aβ₄₂+Mdivi1 (PGC1α by 8.1-fold, p = 0.0001; Nrf1 by 2.0-fold, p = 0.01, Nrf2 by 2.0-fold, p = 0.01, TFAM by 2.9-fold, p = 0.004) and Mdivi1+Aβ₄₂ (PGC1α by 6.5-fold, p = 0.001; Nrf1 by 2.7-fold, p = 0.003; Nrf2 by 2.7-fold, p = 0.004; TFAM by 3.2-fold, p = 0.002) than in the N2a cells treated only with Aβ₄₂, indicating that Mdivi1 increases Aβ₄₂-induced reduced biogenesis activity. Similarly, synaptic genes were greater in N2a cells treated with Aβ₄₂+Mdivi1 (synaptophysin by 1.5-fold, p = 0.04 and PSD95 by 8.6-fold, p = 0.0002) and Mdivi1+Aβ₄₂ (synaptophysin 2.2-fold, p = 0.01 and PSD95 by 3.8-fold, p = 0.003) than in N2a cells treated only with Aβ₄₂ (Table 3).

Immunoblotting analysis

To determine the effects of Aβ₄₂ and Mdiv1 on mitochondrial proteins, we quantified mitochondrial proteins in 3 independent treatments of N2a cells with Aβ₄₂, Mdivi1, Aβ₄₂+Mdivi1, and Mdivi1+Aβ₄₂.

3.4.1 Comparison to untreated N2a cells

In N2a cells treated with Aβ₄₂, significantly higher increased proteins levels were found for Drp1 (p = 0.04) and Fis1 (p = 0.01) (Fig. 2A, B) compared to untreated N2a cells. In contrast, significantly lower levels of Mfn1 (p = 0.001), Mfn2 (p = 0.001), and Opa1 (p = 0.001) were found in N2a cells treated with Aβ₄₂. Significantly lower levels of PGC1α (p = 0.001), Nrf1 (p = 0.01), and Nrf2 (p = 0.02) were also found in the Aβ₄₂-treated N2a cells (Fig. 2A, C), similar to synaptophysin (p = 0.01) and PSD95 (p = 0.01), which were significantly lower in the Aβ₄₂-treated N2a cells, compared to untreated N2a cells (Fig. 2A, D).

Fig.2

Immunoblotting analysis of mitochondrial dynamics, mitochondrial biogenesis, and synaptic proteins. A) Representative immunoblot of N2a cells treated with Aβ₄₂, Mdivi1, Aβ₄₂+Mdivi1, and Mdivi1+Aβ₄₂ relative to untreated cells. B) Data from a quantitative densitometry analysis of mitochondrial dynamics proteins. C) Data from a quantitative densitometry analysis of mitochondrial biogenesis proteins. D) Data from a quantitative densitometry analysis of synaptic proteins.

Drp1 (p = 0.001) and Fis1 (p = 0.003) protein levels were significantly lower, in contrast to Mfn1 (p = 0.01), Mfn2 (p = 0.01), and OPA1 (p = 0.01) protein levels were significantly higher in N2a cells treated with Mdivil (Fig. 2A, B). Interestingly, PGC1α (p = 0.01), Nrf2 (p = 0.002), and TFAM (p = 0.02) were also significantly higher in Mdivi1-treated cells (Fig. 2A, C), suggesting increased biogenesis activity. Levels of synaptophysin (p = 0.001) and PSD95 (p = 0.002) were significantly higher in Aβ-treated cells than were they in untreated N2a cells (Fig. 2A, D).

Unchanged protein level for Drp1 and Fis1 were in N2a cells treated with Aβ₄₂+Mdivi1, compared to levels of these proteins in untreated N2a cells (Fig. 2A, B). Also unchanged protein levels for Drp1 and Fis1 were found in the N2a cells treated with Mdivi1+Aβ₄₂-treated cells, compared to levels of these proteins in untreated N2a cells (Fig. 2A, B). Overall, these findings suggest that Mdivi1 reduces fission activity in the N2a cells, and Mdivi1 enhances fusion and biogenesis activities in the presence of Aβ₄₂.

3.4.2 Comparison to Aβ₄₂-treated cells

As shown in Fig. 2A and B, significantly lower levels of Drp1 (p = 0.01) and Fis1 (p = 0.01) were found in N2a cells treated with Aβ₄₂+Mdivi1 relative to Aβ₄₂-treated N2a cells, and significantly lower levels of proteins (Drp1, p = 0.01; Fis1, p = 0.001) were found in N2a cells treated with Mdivi1+Aβ₄₂ relative to the Aβ₄₂-treated N2a cells. In contrast, significantly higher levels of Mfn1 (p = 0.03), Mfn2 (p = 0.001), and Opa1 (0.01) were found in N2a cells treated with Aβ₄₂+Mdivi1 relative to Aβ₄₂-treated N2a cells and significantly higher levels of Mfn1 (p = 0.01), Mfn2 (p = 0.003), and Opa1 (p = 0.01) were also found in Mdivi1+Aβ₄₂-treated N2a cells relative to Aβ₄₂-treated N2a cells.

Also, significantly higher levels of PGC1α (p = 0.002), Nrf1 (p = 0.02), and TFAM (p = 0.02) were found in N2a cells treated with Aβ₄₂+Mdivi1 relative to Aβ₄₂-treated N2a cells, similar to PGC1α (p = 0.001), Nrf1 (p = 0.04), Nrf2 (p = 0.001), and TFAM (p = 0.01) N2a cells that were treated with Mdivi1+β₄₂ (Fig. 2A, C), indicating that Mdivi1 enhances biogenesis in the presence of Aβ₄₂. Likewise, levels of synaptophysin and PSD95 were significantly higher in the N2a cells treated with Aβ₄₂+Mdivi1 (p = 0.04 and p = 0.02, respectively) as were they when treated with Mdivi1+Aβ₄₂ (p = 0.02 and p = 0.01, respectively), compared to the Aβ₄₂-treated cells (Fig. 2A, D). These results indicate that Mdivi1 treatment enhances synaptic activity in the presence of Aβ₄₂.

Mdivi1 and levels of Aβ₄₂

To determine whether Mdivi1 lowers Aβ₄₂ levels in N2a cells, using Sandwich ELISA we measured Aβ₄₂ levels in N2a cells treated with Aβ₄₂+Mdivi1 (curative) and Mdivi1+Aβ₄₂ (preventive). As shown in Fig. 3, significantly lower levels of Aβ₄₂ levels were found in the N2a cells treated with Aβ₄₂+Mdivi1 (p = 0.01) and with Mdivi1+Aβ (p = 0.04), compared to N2a cells treated only with Aβ₄₂.

Fig.3

Aβ₄₂ levels. Significantly reduced levels of Aβ₄₂ levels were found in the N2a cells treated with Aβ₄₂+Mdivi1 (p = 0.01) and with Mdivi1+Aβ (p = 0.04) relative to N2a cells treated only with Aβ₄₂.

These observations indicate that Mdivi1 reduces Aβ₄₂ levels via mitochondrial dynamics pathway since Aβ₄₂ was found to be lower in Mdivi1+Aβ₄₂ and Aβ₄₂+Mdivi1 proteins, regardless of the sequence of treatment, as long as Mdivi1 was involved in the treatment. Also, since Aβ₄₂ were found to be higher in N2a cells, regardless of the sequence of treatment, as long as Mdivil was involved in the treatment, mitochondrial fragmentation lowered, as did the level of free radicals.

Mitochondrial function

Parameters of mitochondrial function were studied in Aβ-treated N2a cells (n = 4) to determine whether affects mitochondrial function and whether Mdivi1 confers preventive effects on Mdivi1 in the presence or absence of the Aβ₄₂ peptide. The parameters included H₂O₂ production, cytochrome oxidase activity, lipid peroxidation, ATP production, and cell viability. We compared the data 2 ways –in comparison 1 - untreated N2a cells with Mdivi1, Aβ₄₂, Mdivi1+Aβ₄₂ and Mdivi1+Aβ₄₂ (preventive) and in comparison 2 –Aβ₄₂ with Aβ₄₂+Mdivi1 and Mdivi1+Aβ₄₂ (curative).

3.6.1 H₂O₂ production

In comparison 1, as shown in Fig. 4A, significantly increased levels of H₂O₂ were found in mitochondria from N2a cells treated with Aβ₄₂ (p = 0.003), but H₂O₂ levels were unchanged in mitochondria isolated from cells treated with Aβ₄₂+Mdivi1 and Mdivi1+Aβ₄₂. H₂O₂ levels significantly lower in Aβ+Mdivi1 (p = 0.003) and Mdivi1+Aβ (p = 0.003) than N2a+Aβ₄₂ cells. These results suggest that Mdivi1 reduces H₂O₂ levels in the presence of Aβ₄₂ in N2a cells (Fig. 4B).

Fig.4

Hydrogen peroxide levels. Hydrogen peroxide levels were analyzed in two ways: (A) the untreated N2a cells were compared with N2a cells treated Aβ₄₂, Mdivi1, Aβ₄₂+Mdivi1, and Mdivi1+Aβ₄₂, and (B) Aβ₄₂-treated N2a cells were compared to N2a cells treated with Aβ₄₂+Mdivi1 and Mdivi1+Aβ₄₂.

3.6.2 Lipid peroxidation

To determine whether Aβ affects lipid peroxidation in N2a cells that underwent Aβ₄₂ incubation, 4-hydroxy-2-nonenol, an indicator of lipid peroxidation, was measured. Significantly higher levels of lipid peroxidation (p = 0.003) were found in the treated (Fig. 5A) relative to the untreated N2a cells. However, significantly lower levels of lipid peroxidation (p = 0.04) were found in the Mdivi1-treated N2a cells relative to cells that were not treated with Aβ₄₂. Significantly lower levels of lipid peroxidation were found in N2a cells treated with Aβ₄₂+Mdivi1 (p = 0.01) and Mdivi1+Aβ₄₂ (p = 0.02) relative to N2a cells treated only with Aβ₄₂. These findings suggest that Aβ₄₂ increases lipid peroxidation, on the contrary Mdivi1 reduces lipid peroxidation in N2a cells. Further, Mdivi1 reduces lipid peroxidation in the presence of Aβ₄₂.

Fig.5

Lipid peroxidation levels. Lipid peroxidation levels were analyzed in two ways: (A) the untreated N2a cells were compared with N2a cells treated Aβ₄₂, Mdivi1, Aβ₄₂+Mdivi1, and Mdivi1+Aβ₄₂, and (B) Aβ₄₂-treated N2a cells were compared to the N2a cells treated with Aβ₄₂+Mdivi1 and Mdivi1+Aβ₄₂.

3.6.3 Cytochrome c oxidase activity

Significantly lower levels of cytochrome oxidase activity were found in N2a cells treated with Aβ₄₂ (p = 0.01) (Fig. 6A). However, increased levels of were found in the Mdivi1, Aβ₄₂+Mdivi1, and Mdivi1+Aβ-treated N2a cells, but levels were not significant. As shown in Fig. 6B, significantly increased cytochrome oxidase activity was found in the N2a cells treated with Aβ₄₂+Mdivi1 (p = 0.02) and Mdivi1+Aβ (p = 0.01) compared cells treated with Aβ₄₂ alone, indicating that Mdivi1 prevent toxic effects of Aβ₄₂ on cytochrome oxidase activity.

Fig.6

Cytochrome c oxidase activity levels. Cytochrome c oxidase activity levels were analyzed in two ways: (A) the untreated N2a cells were with N2a cells treated Aβ₄₂, Mdivi1, Aβ₄₂+Mdivi1 and Mdivi1+Aβ₄₂, and (B) the Aβ₄₂-treated N2a cells were compared to the N2a cells treated with Aβ₄₂+Mdivi1 and Mdivi1+Aβ₄₂.

3.6.4 ATP production

Significantly lower levels of ATP were found in N2a cells that were treated with Aβ₄₂ (p = 0.01) (Fig. 7A). Significantly increased levels of ATP were found in N2a cells treated with Mdivi1 alone (p = 0.01) (Fig. 7A). Significantly higher ATP levels were found in the N2a cells treated with Aβ₄₂+Mdivi1 (p = 0.03) and Mdivi1+Aβ₄₂ (p = 0.04), indicating that Mdivi1 enhances ATP levels in the presence of Aβ₄₂ (Fig. 7B).

Fig.7

Mitochondrial ATP levels. Mitochondrial ATP levels were analyzed in two ways: (A) the untreated N2a cells were compared with N2a cells treated with Aβ₄₂, Mdivi1, Aβ₄₂+Mdivi1, and Mdivi1+Aβ₄₂, and (B) the Aβ₄₂-treated N2a cells were compared to N2a cells treated with Aβ₄₂+Mdivi1 and Mdivi1+Aβ₄₂.

3.6.5 Cell viability

Significantly lower levels of cell viability were found in N2a cells treated with Aβ₄₂ (0.01) (Fig. 8A), but cell viability was significantly higher in N2a cells treated with Mdivi1 (p = 0.01). As shown in Fig. 8B, cell viability was also higher in the N2a cells treated with Aβ+Mdivi1 (p = 0.01) and Mdivi1+Aβ₄₂ (p = 0.02) relative to N2a+Aβ₄₂, indicating that Mdivi1 prevents a decrease in cell viability that Aβ causes.

Fig.8

Cell viability. Cell viability levels were analyzed in two ways: (A) the untreated N2a cells were compared with N2a cells treated Aβ₄₂, Mdivi1, Aβ₄₂+Mdivi1, and Mdivi1+Aβ₄₂, and (B) the Aβ₄₂-treated N2a cells were compared to N2a cells treated with Aβ₄₂+Mdivi1 and Mdivi1+Aβ₄₂.

N2a cells treated with Aβ₄₂ were found to impair mitochondrial dynamics (increased fission and decreased fusion), reduced biogenesis, and decreased synaptic activity and mitochondrial function. On the other hand, Mdivi1 reduced fission machinery and enhanced fusion activity and also increased biogenesis and synaptic proteins. Mitochondrial function and cell viability were elevated in Mdivi1 treated cells. Interestingly, N2a cells treated with Mdivi1 and Aβ₄₂ (Mdiv1+Aβ₄₂ and Aβ₄₂+Mdiv1) showed reduced mitochondrial dysfunction and maintained cell viability, mitochondrial dynamics, mitochondrial biogenesis, and synaptic activity

DISCUSSION

The protective effects of water soluble Mdivi1 were stronger in pre-treated cells than post-treated cells; in other words, Mdivi1 works better in prevention than treatment in AD-like neurons. In the current study, impaired mitochondrial dynamics was evident in the Aβ₄₂-treated N2a cells (Table 3). These findings agree with earlier studies [23 , 45] in which increased mitochondrial fission and reduced fusion were reported. Mitochondrial biogenesis genes were reduced in Aβ₄₂-treated cells, indicating that Aβ₄₂ reduces biogenesis activity. Synaptic activity was significantly reduced in Aβ₄₂-treated N2a cells. Protein data confirmed mRNA changes, suggesting that Aβ₄₂ affects both mRNA and proteins of mitochondria and synapses in AD like neurons. On the other hand, in cells treated with Mdivi1, mitochondrial biogenesis and synaptic genes were increased and mitochondrial fission genes were reduced and fusion genes were increased, indicating that Mdivi1 treatment is beneficial to cells. Further, when we compared mRNA and protein data of N2a cells+Aβ₄₂ with ‘Aβ₄₂+Mdivi1 (curative)’ and ‘Mdivi1+Aβ₄₂ (prevention)’, protective effects of preventive were stronger than Mdivi1. In other words, in the presence of Aβ₄₂ in N2a cells, treatment of Mdivi1 before Aβ₄₂ treatment was stronger than after Aβ₄₂ followed by Mdivi1 treatment (see Table 3). These observations strongly suggest that Mdivi1 prevents mitochondrial structural, biogenesis, and synaptic genes from expressing abnormally. Overall, Mdivi1 protects mitochondrial structure and mitochondrial function by regulating mitochondrial fission and fusion genes in AD.

Aβ₄₂ levels were lower in N2a cells treated with Mdivi1. Interestingly, Mdivi1 reduces Aβ₄₂ in both pre- and post-Mdivi1 treated cells in the presence of Aβ₄₂. Based on current study findings, it appears that Mdivi1 may reduce excessive mitochondrial fragmentation and increase mitochondrial fusion activity, leading to reduced production of mitochondria-generated excessive free radicals, increased cell viability, and maintained mitochondrial/neuronal function. The toxicity caused by Aβ₄₂ [16 , 46] is expected to be reduced by Mdivi1 treatment in N2a cells. However, further research is still needed to understand how Mdivi1 reduces Aβ₄₂ levels in N2a cells.

In the current study, we found mitochondrial function and cell viability were reduced in Aβ₄₂-treated cells. These observations concur with previous studies on Aβ-induced defective mitochondrial function and cell viability [6 , 45–49]. On the other hand, Mdivi1-treated cells exhibited enhanced mitochondrial function (increased mitochondrial ATP, cytochrome oxidase activity and cell viability), and reduced free radicals and oxidative stress. These observations strongly suggest that Mdivi1 reduces cellular toxicity and boosts mitochondrial function.

Our purpose was to determine the protective effects of Mdivi1, particularly ‘reduced fragmentation of mitochondria’ and increased and/or maintained mitochondrial function and cell viability in the presence of Aβ₄₂ in cells. We measured mitochondrial functional parameters and cell viability in N2a cells treated with Mdivi1 in the presence or absence of Aβ₄₂. As described in the Results section, Aβ₄₂-induced excessive mitochondrial fragmentation and defective mitochondrial function and cell viability were reversed in Mdivi1-treated cells. The reversal effect was stronger in Mdivi1 pre-treated cells than Mdivi1 post-treated cells (see Table 3), indicating that Mdivi1 acts as strong preventive drug for AD. These findings are consistent with mitochondrial and synaptic gene-expression and protein data. In the presence of Aβ₄₂, Mdivi1 reduced free radicals and lipid peroxidation, and increased mitochondrial ATP and cytochrome oxidase activity and cell viability. Thus, all of our data point to Mdivi1 protecting cells from Aβ₄₂ toxicity.

Our observations need further support from AD mice studies, in particular Mdivi1 treatment in AD mice from early on, before mice develop toxic Aβ₄₂ peptide and cognitive deficits, and also in disease progression stage, where AD mice developed Aβ peptides and deposits and cognitive impairments.

In summary, our data indicate that Mdivi1 treatment confers protective effects against Aβ₄₂-induced mitochondrial and synaptic toxicities in N2a cells. Findings from our study may have implications for other neurological diseases, such as Huntington’s [50 –53], Parkinson’s [54 –56], multiple sclerosis [57], and amyotrophic lateral sclerosis [58], in which excessive mitochondrial fragmentation ispresent.

Footnotes

ACKNOWLEDGMENTS

The research reported on in this article was supported by NIH grants AG042178 and AG047812 and the Garrison Family Foundation.

Authors’ disclosures available online ().

References

Reddy

, Manczak

, Mao

, Calkins

, Reddy

, Shirendeb

(2010) Amyloid-beta and mitochondria in aging and Alzheimer’s disease: Implications for synaptic damage and cognitive decline. J Alzheimers Dis 20, S499–S512.

Mattson

(2004) Pathways towards and away from Alzheimer’s disease. Nature 430, 631–639.

LaFerla

, Green

, Oddo

(2007) Intracellular amyloid-beta in Alzheimer’s disease. Nat Rev Neurosci 8, 499–509.

Swerdlow

(2007) Pathogenesis of Alzheimer’s disease. Clin Interv Aging 2, 347–359.

World Alzheimer’s Report, 2015 (https://www.alz.co.uk/research/WorldAlzheimerReport2015.pdf

Reddy

, Manczak

, Yin

, Grady

, Mitchell

, Kandimalla

, Kuruva

(2016) Protective effects of a natural product, curcumin, against amyloid β induced mitochondrial and synaptic toxicities in Alzheimer’s disease. J Investig Med 64, 1220–1234.

Reddy

, Tripathi

, Troung

, Tirumala

, Reddy

, Anekonda

, Shirendeb

, Calkins

, Reddy

, Mao

, Manczak

(2012) Abnormal mitochondrial dynamics and synaptic degeneration as early events in Alzheimer’s disease: Implications to mitochondria-targeted antioxidant therapeutics. Biochim Biophys Acta 1822, 639–649.

Mao

, Reddy

(2011) Aging and amyloid beta-induced oxidative DNA damage and mitochondrial dysfunction in Alzheimer’s disease: Implications for early intervention and therapeutics. Biochim Biophys Acta 1812, 1359–1370.

Selkoe

(2001) Alzheimer’s disease: Genes, proteins, and therapy. Physiol Rev 81, 741–766.

10.

Gibson

, Sheu

, Blass

(1998) Abnormalities of mitochondrial enzymes in Alzheimer disease. J Neural Transm (Vienna) 105, 855–870.

11.

Parker

Jr , Filley

, Parks

(1990) Cytochrome oxidase deficiency in Alzheimer’s disease. Neurology 40, 1302–1303.

12.

Maurer

, Zierz

, Möller

(2000) A selective defect of cytochrome c oxidase is present in brain of Alzheimer disease patients. Neurobiol Aging 21, 455–462.

13.

Smith

, Perry

, Richey

, Sayre

, Anderson

, Beal

, Kowall

(1996) Oxidative damage in Alzheimer’s. Nature 382, 120–121.

14.

Devi

, Prabhu

, Galati

, Avadhani

, Anandatheerthavarada

(2006) Accumulation of amyloid precursor protein in the mitochondrial import channels of human Alzheimer’s disease brain is associated with mitochondrial dysfunction. J Neurosci 26, 9057–9068.

15.

Manczak

, Anekonda

, Henson

, Park

, Quinn

, Reddy

(2006) Mitochondria are a direct site of Abeta accumulation in Alzheimer’s disease neurons: Implications for free radical generation and oxidative damage in disease progression. Hum Mol Genet 15, 1437–1449.

16.

Reddy

, Beal

(2008) Amyloid beta, mitochondrial dysfunction and synaptic damage: Implications for cognitive decline in aging and Alzheimer’s disease. Trends Mol Med 14, 45–53.

17.

Lin

, Simon

, Ahn

, Kim

, Beal

(2002) High aggregate burden of somatic mtDNA point mutations in aging and Alzheimer’s disease brain. Hum Mol Genet 11, 133–145.

18.

Coskun

, Beal

, Wallace

(2004) Alzheimer’s brains harbor somatic mtDNA control-region mutations that suppress mitochondrial transcription and replication. Proc Natl Acad Sci U S A 101, 10726–11031.

19.

Chandrasekaran

, Giordano

, Brady

, Stoll

, Martin

, Rapoport

(1994) Impairment in mitochondrial cytochrome oxidase gene expression in Alzheimer disease. Brain Res Mol Brain Res 24, 336–340.

20.

Reddy

, McWeeney

, Park

, Manczak

, Gutala

, Partovi

, Jung

, Yau

, Searles

, Mori

, Quin

(2004) Gene expression profiles of transcripts in amyloid precursor protein transgenic mice: Up-regulation of mitochondrial metabolism and apoptotic genes is an early cellular change in Alzheimer’s disease. Hum Mol Genet 13, 1225–1240.

21.

Manczak

, Calkins

, Reddy

(2011) impaired mitochondrial dynamics and abnormal interaction of amyloid beta with mitochondrial protein Drp1 in neurons from patients with Alzheimer’s disease: Implications for neuronal damage. Hum Mol Genet 20, 2495–2509.

22.

Manczak

, Park

, Jung

, Reddy

(2004) Differential expression of oxidative phosphorylation genes in patients with Alzheimer’s disease: Implications for early mitochondrial dysfunction and oxidative damage. Neuromolecular Med 5, 147–162.

23.

Manczak

, Mao

, Calkins

, Cornea

, Reddy

, Murphy

, Szeto

, Park

, Reddy

(2010) Mitochondria-targeted antioxidants protect against amyloid-beta toxicity in Alzheimer’s disease neurons. J Alzheimers Dis 20(Suppl 2), S609–S631.

24.

Calkins

, Reddy

(2011) Assessment of newly synthesized mitochondrial DNA using BrdU labeling in primary neurons from Alzheimer’s disease mice: Implications for impaired mitochondrial biogenesis and synaptic damage. Biochim Biophys Acta 1812, 1182–1189.

25.

Calkins

, Manczak

, Mao

, Shirendeb

, Reddy

(2011) Impaired mitochondrial biogenesis, defective axonal transport of mitochondria, abnormal mitochondrial dynamics and synaptic degeneration in a mouse model of Alzheimer’s disease. Hum Mol Genet 20, 4515–4529.

26.

Wang

, Su

, Siedlak

, Moreira

, Fujioka

, Wang

, Casadesus

, Zhu

(2008) Amyloid-beta overproduction causes abnormal mitochondrial dynamics via differential modulation of mitochondrial fission/fusion proteins. Proc Natl Acad Sci U S A 105, 19318–19323.

27.

Wang

, Su

, Lee

, Li

, Perry

, Smith

, Zhu

(2009) Impaired balance of mitochondrial fission and fusion in Alzheimer’s disease. J Neurosci 29, 9090–9103.

28.

Manczak

, Kandimalla

, Fry

, Sesaki

, Reddy

(2016) Protective effects of reduced dynamin-related protein 1 against amyloid beta-induced mitochondrial dysfunction and synaptic damage in Alzheimer’s disease. Hum Mol Genet 25, 5148–5166.

29.

Kandimalla

, Manczak

, Fry

, Suneetha

, Sesaki

, Reddy

(2016) Reduced dynamin-related protein 1 protects against phosphorylated tau-induced mitochondrial dysfunction and synaptic damage in Alzheimer’s disease. Hum Mol Genet 25, 4881–4897.

30.

Reddy

(2009) Amyloid beta, mitochondrial structural and functional dynamics in Alzheimer’s disease. Exp Neurol 218, 286–292.

31.

Trushina

, Nemutlu

, Zhang

, Christensen

, Camp

, Mesa

, Siddiqui

, Tamura

, Sesaki

, Wengenack

, Dzeja

, Poduslo

(2012) Defects in mitochondrial dynamics and metabolomic signatures of evolving energetic stress in mouse models of familial Alzheimer’s disease. PLoS One 7, e32737.

32.

Reddy

(2014) Increased mitochondrial fission and neuronal dysfunction in Huntington’s disease: Implications for molecular inhibitors of excessive mitochondrial fission. Drug Discov Today 19, 951–955.

33.

Reddy

(2014) Inhibitors of mitochondrial fission as a therapeutic strategy for diseases with oxidative stress and mitochondrial dysfunction. J Alzheimers Dis 40, 245–256.

34.

Cassidy-Stone

, Chipuk

, Ingerman

, Song

, Yoo

, Kuwana

, Kurth

, Shaw

, Hinshaw

, Green

, Nunnari

(2008) Chemical inhibition of the mitochondrial division dynamin reveals its role in Bax/Bak-dependent mitochondrial outer membrane permeabilization. Dev Cell 14, 193–204.

35.

Macia

, Ehrlich

, Massol

, Boucrot

, Brunner

, Kirchhausen

(2006) Dynasore, a cell-permeable inhibitor of dynamin. Dev Cell 10, 839–850.

36.

, Qvit

, Su

, Mochly-Rosen

(2013) A novel Drp1 inhibitor diminishes aberrant mitochondrial fission and neurotoxicity. J Cell Sci 126, 789–802.

37.

Qiu

, Cao

, Yang

, Zhao

, Liu

, Han

, Xue

, Jiang

, Chi

(2013) Role of mitochondrial fission in neuronal injury in pilocarpine-induced epileptic rats. Neuroscience 245, 157–165.

38.

Ong

, Subrayan

, Lim

, Yellon

, Davidson

, Hausenloy

(2010) Inhibiting mitochondrial fission protects the heart against ischemia/reperfusion injury. Circulation 121, 2012–2022.

39.

Zhang

, Yan

, Yuan

, Gao

, Shen

, Cheng

, Shen

, Wang

, Hu

, Wang

, Chen

(2013) Cerebral ischemia-reperfusion-induced autophagy protects against neuronal injury by mitochondrial clearance. Autophagy 9, 1321–1333.

40.

Park

, Kim

, Lindsey

, Dai

, Heo

, Nguyen

, Ellisman

, Weinreb

, Ju

(2011) A selective inhibitor of drp1, mdivi-1, increases retinal ganglion cell survival in acute ischemic mouse retina. Invest Ophthalmol Vis Sci 52, 2837–2843.

41.

Xie

, Wang

, Lian

, Zhang

, Wu

, Zhang

(2013) A selective inhibitor of Drp1, mdivi-1, protects against cell death of hippocampal neurons in pilocarpine-induced seizures in rats. Neurosci Lett 545, 64–68.

42.

Wappler

, Institoris

, Dutta

, Katakam

, Busija

(2013) Mitochondrial dynamics associated with oxygen-glucose deprivation in rat primary neuronal cultures. PLoS One 8, e63206.

43.

Chlystun

, Campanella

, Law

, Duchen

, Fatimathas

, Levine

, Gerke

, Moss

(2013) Regulation of mitochondrial morphogenesis by annexin A6. PLoS One 8, e53774.

44.

Manczak

, Reddy

(2015) Mitochondrial division inhibitor 1 protects against mutant huntingtin-induced abnormal mitochondrial dynamics and neuronal damage in Huntington’s disease. Hum Mol Genet 24, 7308–7325.

45.

Silva

, Selfridge

, Lu

, E

, Roy

, Hutfles

, Burns

, Michaelis

, Yan

, Cardoso

, Swerdlow

(2013) Bioenergetic flux, mitochondrial mass and mitochondrial morphology dynamics in AD and MCI cybrid cell lines. Hum Mol Genet 22, 3931–3946.

46.

Reddy

(2006) Amyloid precursor protein-mediated free radicals and oxidative damage: Implications for the development and progression of Alzheimer’s disease. J Neurochem 96, 1–13.

47.

Aleardi

, Benard

, Augereau

, Malgat

, Talbot

, Mazat

, Letellier

, Dachary-Prigent

, Solaini

, Rossignol

(2005) Gradual alteration of mitochondrial structure and function by beta-amyloids: Importance of membrane viscosity changes, energy deprivation, reactive oxygen species production, and cytochrome c release. J Bioenerg Biomembr 37, 207–225.

48.

Casley

, Canevari

, Land

, Clark

, Sharpe

(2002) Beta-amyloid inhibits integrated mitochondrial respiration and key enzyme activities. J Neurochem 80, 91–100.

49.

Casley

, Land

, Sharpe

, Clark

, Duchen

, Canevari

(2005) Beta-amyloid fragment 25-35 causes mitochondrial dysfunction in primary cortical neurons. Neurobiol Dis 10, 258–267.

50.

Shirendeb

, Reddy

, Manczak

, Calkins

, Mao

, Tagle

, Reddy

(2011) Abnormal mitochondrial dynamics, mitochondrial loss and mutant huntingtin oligomers in Huntington’s disease: Implications for selective neuronal damage. Hum Mol Genet 20, 1438–1455.

51.

Shirendeb

, Calkins

, Manczak

, Anekonda

, Dufour

, McBride

, Mao

, Reddy

(2012) Mutant huntingtin’s interaction with mitochondrial protein Drp1 impairs mitochondrial biogenesis and causes defective axonal transport and synaptic degeneration in Huntington’s disease. Hum Mol Genet 21, 406–420.

52.

Song

, Chen

, Petrilli

, Liot

, Klinglmayr

, Zhou

, Poquiz

, Tjong

, Pouladi

, Hayden

, Masliah

, Ellisman

, Rouiller

, Schwarzenbacher

, Bossy

, Perkins

, Bossy-Wetzel

(2011) Mutant huntingtin binds the mitochondrial fission GTPase dynamin-related protein-1 and increases its enzymatic activity. Nat Med 17, 377–382.

53.

Yin

, Manczak

, Reddy

(2016) Mitochondria-targeted molecules MitoQ and SS31 reduce mutant huntingtin-induced mitochondrial toxicity and synaptic damage in Huntington’s disease. Hum Mol Genet 25, 1739–1753.

54.

Wang

, Song

, Du

, Tian

, Yue

, Liu

, Li

, Wang

, Zhu

, Cao

, Zhou

, Chen

(2011) Parkin ubiquitinates Drp1 for proteasome-dependent degradation: Implication of dysregulated mitochondrial dynamics in Parkinson disease. J Biol Chem 286, 11649–11658.

55.

Wang

, Yan

, Fujioka

, Liu

, Wilson-Delfosse

, Chen

, Perry

, Casadesus

, Zhu

(2012) LRRK2 regulates mitochondrial dynamics and function through direct interaction with DLP1. Hum Mol Genet 21, 1931–1944.

56.

Stafa

, Tsika

, Moser

, Musso

, Glauser

, Jones

, Biskup

, Xiong

, Bandopadhyay

, Dawson

, Moore

(2014) Functional interaction of Parkinson’s disease-associated LRRK2 with members of the dynamin GTPase superfamily. Hum Mol Genet 23, 2055–2077.

57.

Sadeghian

, Mastrolia

, Rezaei Haddad

, Mosley

, Mullali

, Schiza

, Sajic

, Hargreaves

, Heales

, Duchen

, Smith

(2016) Mitochondrial dysfunction is an important cause of neurological deficits in an inflammatory model of multiple sclerosis. Sci Re 6, 33249.

58.

Magrané

, Sahawneh

, Przedborski

, Estévez

ÁG

, Manfredi

(2012) Mitochondrial dynamics and bioenergetic dysfunction is associated with synaptic alterations in mutant SOD1 motor neurons. J Neurosci 32, 229–242.

Mitochondria-Division Inhibitor 1 Protects Against Amyloid-β induced Mitochondrial Fragmentation and Synaptic Damage in Alzheimer’s Disease

Abstract

Keywords

INTRODUCTION

MATERIALS AND METHODS

Chemicals and reagents

Tissue culture work

Quantitative real-time RT-PCR

Immunoblotting analysis

Measurement of soluble Aβ42 levels in untreated N2a cells and N2a cells treated with Mdivi1

Mitochondrial functional assays

2.6.2 Lipid peroxidation assay

2.6.3 Cytochrome c oxidase activity

2.6.4 ATP levels

Statistical considerations

RESULTS

mRNA expressions of mitochondrial dynamics genes

3.1.1 Amyloid-β42 treatment

3.1.3 Treatment with Aβ42 and Mdivi1

Mitochondrial biogenesis genes

3.2.1 Aβ42

3.2.2 Mdivi1

3.2.3 Aβ42+Mdivi1

3.2.4 Mdivi1+Aβ42

Synaptic genes

3.3.1 Aβ42

3.3.2 Mdivi1

3.3.3 Aβ42+Mdivi1

3.3.4 Mdivi1+Aβ

3.3.5 Comparison to Aβ42-treated N2a cells

Immunoblotting analysis

3.4.1 Comparison to untreated N2a cells

Mdivi1 and levels of Aβ42

Mitochondrial function

DISCUSSION

Footnotes

ACKNOWLEDGMENTS

References

Measurement of soluble Aβ₄₂ levels in untreated N2a cells and N2a cells treated with Mdivi1

3.1.1 Amyloid-β₄₂ treatment

3.1.3 Treatment with Aβ₄₂ and Mdivi1

3.2.1 Aβ₄₂

3.2.3 Aβ₄₂+Mdivi1

3.2.4 Mdivi1+Aβ₄₂

3.3.1 Aβ₄₂

3.3.3 Aβ₄₂+Mdivi1

3.3.5 Comparison to Aβ₄₂-treated N2a cells

Mdivi1 and levels of Aβ₄₂