Amyloid-β 25–35 Upregulates Endogenous Neuroprotectant Neuroglobin via NF κ B Activation in vitro

Materials

Dulbecco’s modified Eagle’s medium (DMEM), Lipofactaminetrademark 2000, Lipofectaminetrademark RNAiMAX, geneticin, and penicillin were purchased from Thermo Fisher Scientific. Fetal bovine serum (FBS) and 0.25% trypsin-EDTA were purchased from Gibco. The N2a cell line was obtained from the American Type Culture Collection. Aβ_25–35 was purchased from Sigma-Aldrich. Mouse Ngb siRNA and control siRNA were purchased from Origene. Dual-Luciferase Reporter Assay kit and CellTiter-Glo^® Luminescent Cell Viability Assay kit were purchased from Promega. JC-1 assay kit was obtained from Thermo Fisher Scientific. Anti-p50, Anti-p65, and Anti-cRel antibodies were purchased from Abcam. Antibodies against cleaved caspase 3, caspase 3, and β-actin were purchased from Cell Signaling Technology. Chicken anti-Ngb primary antibody was purchased from BioVendor. Reporter plasmids P-554 (−549/+6) and constructs with mutations to the NFκB-binding sites were constructed as described previously [25].

Cell culture

The animal protocol was approved by the Institutional Animal Care and Use Committee of Massachusetts General Hospital. Primary mouse cortical neuronal culture was performed as described before [20, 26]. Briefly, primary mouse cortical neurons were prepared from the cortex of embryonic day 15 (E15) obtained from the pregnant C57BL/6 female mouse. The cell pellets were re-suspended in Neurobasal medium (NBM), supplemented with 2% B27, 0.8 mM L-Glutamine, and 100μg/mL penicillin/streptomycin, seeded onto 6 cm wells plate pre-coated with poly-D-lysine at density of 3×10⁵ cells/mL and cultured at a humidified (5% CO₂, 37°C) incubator. Medium was half changed every 3 days. All experiments were performed on cultures at days 7–9 in vitro.

The mouse N2a neuroblastoma cells were maintained in DMEM with 10% heat-inactivated FBS and 100μg/ml penicillin/streptomycin in a humidified (5% CO₂, 37°C) incubator. The cells were seeded onto 24 wells plate or 6 wells plate at a density of 1.5×10⁵ cells/mL.

Transfection

For transfection with siRNAs, on the 8th day after seeding, the primary mouse cortical neurons were transfected with Ngb siRNA or control siRNA using Lipofectaminetrademark RNAiMAX following the manufacturer’s protocol. For transfection with luciferase reporter constructs into N2a cells, the cells with approximately 70% confluence were transiently transfected with DNA constructs using Lipofectamine 2000trademark following the manufacturer’s protocol as described previously [25].

Preparation of A β_25–35

Aβ_25–35 was prepared as described previously [26]. Briefly, Aβ_25–35 was dissolved in deionized distilled water at 1 mM, and subsequently aged for 5 days at 37°C before being used.

Cell viability assay

Cell viability was measured by MTT assay according to manufacturer’s protocol as described previously [27]. N2a cells with approximately 70% confluence were transfected with Ngb siRNA or control siRNA for 24 h, followed by Aβ_25–35 treatment. After treatment for 24 h, cells were treated with fresh DMEM containing MTT for 4 h in the cell culture incubator. The medium was subsequently aspirated and the formazan crystals were dissolved by DMSO. The absorbance at 570 nm was measured by using a microplate reader. Percentages of live cell counts were used for assay normalization.

Real-time quantitative PCR (RT-qPCR)

RT-qPCR was performed as previously described [25]. Briefly, total RNA from primary mouse cortical neurons was isolated with the RNeasy Lipid Tissue Mini Kit (Qiagen) according to the manufacturer’s instruction. Then cDNA was synthesized by reverse-transcription with SuperScript system (Thermo Fisher Scientific). The mRNA levels of Ngb were measured by quantitative real-time PCR using SYBR green kit in an ABI 7000 real-time PCR system (Applied Biosystems). The following sequences were used as primers for real-time PCR amplification: mouse Ngb sense primer, 5’-ATGCTGCAGTGACCAACGTG-3’; mouse Ngb antisense primer, 5’-GCGGTCCTTGTAGCTGGTGT-3’; and mouse 18sRNA sense primer, 5’- AGGGGAGAGCGGGTAAGAGA-3’; mouse 18sRNA antisense primer, 5’- GGACAGGACTAGGCGGAACA-3’; Data were analyzed according to the comparative threshold cycle method with expression for sample normalization. Real-time qPCR assay was performed in triplicate for each sample to ensure reproducibility.

Western blot analysis

Western blot analysis was performed as described previously [25]. Briefly, mouse primary cortical neurons or N2a cells were lysed in cell lysis buffer (Cell signaling Technology) supplemented with 100× protease inhibitor (Sigma), and 20μg of total proteins were separated using 4–12 % SDS-PAGE gel (Thermo Fisher Scientific) and transferred onto nitrocellulose membrane (Thermo Fisher Scientific). The membrane was blocked with 5% non-fat dried milk in 10 mM PBS buffer (PH 7.2) for 1 h, followed by immunoblotting by incubation with primary antibodies overnight at 4°C, and subsequently incubated with secondary antibodies for 1 h at 25°C. After washing with TTBS, immunoreactive proteins were determined by enhanced chemiluminescence (Amersham Pharmacia Biotech) according to the manufacturer’s protocol and then exposed to film (X-Omat; Eastman Kodak Co.).

Luciferase assay

Luciferase assay was performed as described previously [25]. The reporter plasmids P-554 (−549/+6) or its mutated constructs and control plasmid PRL-TK were co-transfected into N2a cells for 24 h, then cells were lysed with 1× passive lysis buffer. 50μL lysates were used for luminescence measurements with Dual-Luciferase Reporter Assay kit. The luciferase activities of firefly and Renilla were successively detected in a Veritas^TM Microplate Luminometer (Turner BioSystem). The relative luciferase activity was defined as the firefly/Renilla luciferase ratio.

Electrophoretic mobility shift assay

Electrophoretic mobility shift assay (EMSA) was performed as we described previously [25]. Nuclear extracts from N2a cells were prepared using NE-PER Nuclear and Cytoplasmic Extraction kit (Thermo Fisher Scientific). The following oligonucleotides were synthesized, labelled with biotin using biotin 3’-end DNA-labelling kit (Thermo Fisher Scientific) and annealed to obtain double-stranded DNA probes:

κB2 sense, AGCCTGGACATTTCCCAGGCCTC;

DNA-protein binding reactions for supershift assays were performed using Lightshift EMSA optimization and control kit (Thermo Fisher Scientific). DNA-protein complexes were loaded on to a 6% non-denaturing polyacrylamide gel and electrophoresed, and subsequently transferred to a nylon membrane (Ambion). The membrane was cross-linked and detected using the Chemiluminesent Nucleic Acid Detection Module (Thermo Fisher Scientific), and exposed to film (X-Omat; Eastman Kodak Co.).

ATP production assay

ATP production assay was performed according to the manufacturer’s instruction as described previously [28]. Briefly, 100μL of neurobasal medium were mixed with the same volume of CellTiter-Glo^® reagent and then added into primary mouse cortical neuron cultures. The lysates were transferred to black 96-well plates, and incubated at room temperature for 10 min to stabilize luminescent signal, which was subsequently recorded by the plate reader (Wallac Tri-Lux beta, PerkinElmer Life and Analytical Sciences, Waltham, MA).

Mitochondrial membrane potential measurement

The mitochondrial membrane potential (ΔΨm) was measured by staining primary mouse cortical neurons with JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolyl-carbocyanine iodide) as we previously described [28]. The ΔΨm in each treatment group was calculated as the fluorescence ratio of red (JC-1 aggregates) to green (JC-1 mononers). After the indicated treatment, primary cortical neurons were incubated with JC-1 probe (final concentration 1μg/ml) at 37°C for 20 min, followed by rinsing with PBS for 3 times and further stained by DAPI. Subsequently, the fluorescence in cells was either detected by a microplate reader (green fluorescence, excitation 489-nm and emission 529-nm; red fluorescence, excitation 570-nm and emission600-nm) and imaged with a fluorescence microscope.

Complex III activity assay

At 8 days of culture, primary mouse cortical neurons were transfected with Ngb siRNA or Control siRNA for 24 h, followed by exposures of indicated doses of Aβ_25–35 for another 16 h. Mitochondria were isolated from neurons using the Mitochondria isolation kit (Thermo Scientific) according to the manufacturer’s instructions. Complex III Activity was measured using Mitochondrial Complex III Activity Assay Kit (Biovision, Milpitas) following the manufacturer’s instruction. Briefly, three reaction mix groups including background control group, sample group, and sample-inhibitor group (sample mix with complex III inhibitor) were prepared and added into wells of the clear bottom 96-well half area plate. Subsequently, 2μL mitochondrial samples and 6μL cytochrome c (substrate) were added into wells containing sample group and sample-inhibitor group. Immediately, the absorbance at 550 nm was read at 30 seconds intervals for up to 10 min by a microplate reader.

Statistical analysis

Data were expressed as mean±SD. Statistical significance (p < 0.05) were analyzed using ANOVA with Tukey’s post hoc tests for multiple comparisons using GraphPad Prism 7 software.

Aβ_25–35 induces dose-dependent neuronal cell death of primary mouse cortical neurons and N2a cells

Primary cultured mouse cortical neurons and N2a cells were treated with Aβ_25–35 at different doses, and neuronal cell death were measured by MTT assay. Our data showed that treatment with 10μM and 20μM of Aβ_25–35 for 24 h led to significant cell death of primary mouse cortical neurons (Fig. 1A), and exposure of N2a cells to 20μM of Aβ_25–35 also markedly induced cell death (Fig. 1B). These results suggested that Aβ_25–35 induces neuronal cell death of primary mouse cortical neurons and N2a cells in a dose-dependent manner. OPEN IN VIEWER

Aβ_25–35 increases Ngb expression of primary cultured mouse cortical neurons and N2a cells

To investigate the effect of Aβ_25–35 on Ngb protein expression, primary cultured mouse cortical neurons and N2a cells were treated with Aβ_25–35 for 24 h at different doses, and Ngb protein levels were measured by western blot analysis. Our data showed that exposure of primary mouse cortical neurons and N2a cells to Aβ_25–35 (2–20μM) increased the expression of Ngb with the maximal effect at concentration of 2 and 5μM, respectively (Fig. 2A, B). We also determined the effects of Aβ_25–35 on Ngb mRNA levels in primary mouse cortical neurons, and found 5μM of Aβ_25–35 induced the maximal increase of Ngb mRNA expression at 8 h after Aβ_25–35 exposure (Fig. 2C). Furthermore, in a dose-range experiment, we found that treatment with 10μM Aβ_25–35 for 8 h also significantly induced Ngb mRNA levels, while the higher dose 20μM of Aβ_25–35 significantly reduced Ngb mRNA compared to 10μM of Aβ_25–35 (Fig. 2D). These data suggested that Aβ_25–35 increases Ngb expression of primary cultured mouse corticalneurons and N2a cells.

OPEN IN VIEWER

Fig. 2

Effect of Aβ_25–35 on Ngb expression. A) Ngb protein levels were measured by western blot in primary mouse cortical neurons cultured in 6 wells plate treated with different dose of Aβ_25–35 (mean±SD); n = 3, *p < 0.05 compared with normal control (Aβ_25–35 0μM). B) Ngb protein levels were measured by western blot in N2a cells cultured in 6 wells plate treated with different dose of Aβ_25–35 (mean±SD); n = 4, *p < 0.05 compared with normal control (Aβ_25–35 0μM). C) The relative Ngb mRNA levels were examined by RT-qPCR in primary mouse cortical neurons cultured in 6 wells plate treated with 5μM of Aβ_25–35 with different time course (mean±SD); n = 4, *p < 0.05 compared with normal control (Aβ_25–35 0μM). D) The relative Ngb mRNA levels were examined by RT-qPCR in primary mouse cortical neurons cultured in 6 wells plate treated with different dose of Aβ_25–35 for 24 h (mean±SD); n = 4, *p < 0.05 compared with normal control (Aβ_25–35 0μM). ^#p < 0.05 compared with Aβ_25–35 (10μM).

NFκB binding sites in Ngb promoter region are involved in Aβ_25–35-induced Ngb expression

Next, we sought to further test whether Aβ_25–35 is involved in the induction of Ngb gene expression in transcription level. We transfected mouse Ngb promoter vector P-554 (−549/+6) into N2a cells for 24 h, followed by treatment with different doses of Aβ_25–35 for another 24 h. As expected, we found Aβ_25–35 significantly increased Ngb promoter activity of P-554 (−549/+6) (Fig. 3A). Our previous data showed that κB2 and κB3 sites located in mouse Ngb gene promoter region from –549 to +6 could be bound by NFκB and mediated hypoxia-induced Ngb promoter activity [25], we thus investigated whether the κB sites were involved in Aβ_25–35 induced Ngb promoter activity. As expected, our results indicated that mutations of κB2 and κB3 sites significantly inhibited Aβ_25–35 induced Ngb promoter activity of P-554 (−549/+6) (Fig. 3B).

OPEN IN VIEWER

Fig. 3

Effect of κB sites mutation in the Ngb promoter on Aβ_25–35 increased Ngb expression. A) Relative Ngb promoter activities were determined by Luciferase assay in N2a cells cultured in 24 wells plate treated with different dose of Aβ_25–35 (mean±SD); n = 5, *p < 0.05 compared with normal control (Aβ_25–35 0μM). B) Relative Ngb promoter activities were determined by luciferase assay in N2a cells cultured in 24 wells plate and transfected with wild-type or mutated mouse Ngb promoter plasmids, followed by treated by 5μM of Aβ_25–35 (mean±SD); n = 4, *p < 0.05 compared with N2a cells transfected with P-544(-549/+6). ^#p < 0.05 compared with N2a cells transfected with P-544(-549/+6) and treated with Aβ_25–35 (5μM). C) Supershift assay of NFκB subunits (p65, p50, and cRel) binding to the κB2 site. Biotin-labeled κB2 probes were incubated with the nuclear extract (NE) of N2a cells treated with different dose of Aβ_25–35, with or without addition of antibodies against p50, p65, and cRel. D) Supershift assay of NFκB subunits (p65, p50, and cRel) binding to the κB3 site. Biotin-labeled κB3 probes were incubated with the nuclear extract (NE) of N2a cells treated with different dose of Aβ_25–35, with or without addition of antibodies against p50, p65, and cRel.

OPEN IN VIEWER

Fig. 4

Effect of low dose of Aβ_25–35 on neuronal cell death of primary mouse cortical neurons with Ngb knockdown. A) Representative western blot showing that Ngb protein expression was suppressed by specific Ngb siRNAs. B) Cell viability was measured by MTT assay in primary mouse cortical neurons cultured in 24 wells plate transfected with control siRNA or Ngb siRNA-C, followed by treated with different dose of Aβ_25–35 (mean±SD); n = 4, *p < 0.05 compared with primary cortical neurons transfected with control siRNA and treated with Aβ_25–35 (5μM). C) Cleaved caspase 3 protein levels were measured by western blot in primary mouse cortical neurons cultured in 6 wells plate transfected with control siRNA or Ngb siRNA-C, followed by treated with different dose of Aβ_25–35 (mean±SD); n = 4, *p < 0.05 compared with primary cortical neurons transfected with control siRNA and treated with Aβ_25–35.

OPEN IN VIEWER

Fig. 5

Effect of low dose of Aβ_25–35 on mitochondrial function in primary mouse cortical neurons with Ngb knockdown. A) The mitochondrial membrane potential (MMP) was measured by JC-1 assay in primary mouse cortical neurons cultured in 24 wells plate transfected with control siRNA or Ngb siRNA-C, followed by treated with different dose of Aβ_25–35 (mean±SD); n = 4, *p < 0.05 compared with primary cortical neurons transfected with control siRNA and treated with Aβ_25–35 (0μM). ^#p < 0.05 compared with primary cortical neurons transfected with Ngb siRNA-C and treated with Aβ_25–35 (0μM). ^&p < 0.05 compared with primary cortical neurons transfected with Ngb siRNA-C and treated with Aβ_25–35 (2μM). B) Representative fluorescence microscopic imaging of JC-1 aggregates at 24 h after Aβ_25–35 treatment (Scale bar = 50μm). C) The total intracellular ATP levels were measured in primary mouse cortical neurons cultured in 24 wells plate transfected with control siRNA or Ngb siRNA-C, followed by treated with different dose of Aβ_25–35 (mean±SD); n = 4, *p < 0.05 compared with primary cortical neurons transfected with control siRNA and normal control (Aβ_25–35 0μM). ^#p < 0.05 compared with primary cortical neurons transfected with Ngb siRNA-C and normal control (Aβ_25–35 0μM). (D). The mitochondrial complex III activity was measured in primary mouse cortical neurons cultured in 10 cm dishes transfected with control siRNA or Ngb siRNA, followed by treated with different dose of Aβ_25–35 (mean±SD); n = 3, *p < 0.05 compared with primary cortical neurons transfected with control siRNA and normal control (Aβ_25–35 0μM).

Our previous results have shown that NFκB family members including p50, p65, and cRel were able to physically bind to κB2 or κB3 sites [25]. To investigate the effect of different doses of Aβ_25–35 on the binding capabilities of NFκB family members to κB2 or κB3 sites, in vitro supershift assay was performed. Biotin-labeled κB2 probes were used as DNA targets for binding of nuclear protein extracts of N2a cells that were treated with 0, 2, or 20μM of Aβ_25–35. Without Aβ_25–35, addition of anti-p65 antibody into the reaction produced a notable shifted band, and addition of anti-p50 and anti-cRel antibodies into the reaction produced weak bands. When N2a cells were treated with 2μM of Aβ_25–35, addition of anti-p65, anti-p50, and anti-cRel antibodies caused a dramatic increase in the mobility shift. However, treatment with 20μM of Aβ_25–35 did not further increase the shift bands (Fig. 3C). Supershift assays were also conducted using the biotin-labeled κB3 probes, and similar results were observed (Fig. 3D). Moreover, it is noteworthy that addition of anti-cRel antibody into the reaction mixture did not produce a shift band using nuclear extracts of N2a cells without Aβ_25–35 treatment, whereas addition of anti-cRel antibody resulted in a strong shift band and a weak band using nuclear extracts of N2a cells with 2μM and 20μM of Aβ_25–35 treatment, respectively (Fig. 3D). These data indicated that transcription factor NFκB, κB2 and κB3 sites located in Ngb promoter region are involved in Aβ_25–35-induced Ngbexpression.

Suppression of endogenous Ngb worsens low dose Aβ_25–35-induced neurotoxicity

To investigate whether low dose Aβ_25–35-induced Ngb upregulation is associated with neuroprotection against Aβ_25–35, we applied RNA interference to suppress endogenous Ngb expression, and then investigated the effect of low dose Aβ_25–35 on cell viability. Our data showed that transfection of primary mouse cortical neurons with specific Ngb siRNA but not control siRNA led to a significant reduction of Ngb protein expression assessed by western blot (Fig. 4A). The primary mouse cortical neurons were then transfected with Ngb siRNA or control siRNA for 24 h, followed by treatment with different doses of Aβ_25–35. 2μM or 5μM of Aβ_25–35 did not significantly induce neuronal cell death in control siRNA-transfected group, but 5μM of Aβ_25–35 led to significant neuronal cell death in Ngb siRNA-transfected group (Fig. 4B), suggesting neuroprotective role of endogenous Ngb against Aβ_25–35 s neurotoxicity. Aβ_25–35 could cause apoptosis in primary neurons associated with increased activity of caspase-3 [29], which is the predominant caspase involved in apoptotic signaling pathway [30]. To investigate whether inhibition of Ngb expression worsens Aβ_25–35-induced apoptosis, we examined the effect of low dose Aβ_25–35 on the activation of caspase-3 after knockdown of Ngb expression using specific Ngb siRNA. Our results found that low dose Aβ_25–35 did not cause cleavage of caspase-3 after transfection with control siRNA into primary cortical neurons, but significantly induced caspase-3 cleavage after endogenous Ngb downregulation by transfection with Ngb siRNA(Fig. 4C).

Suppression of endogenous Ngb expression exacerbates Aβ_25–35-induced mitochondrial dysfunction

It has been well documented that Aβ-induced mitochondrial dysfunction is one of key pathological mechanisms of AD [31]. Our previous studies suggested that Ngb rescues mitochondrial dysfunction in primary mouse cortical neurons after oxygen-glucose deprivation [20, 21]. To investigate whether suppression of endogenous Ngb upregulation was associated with exacerbated mitochondrial dysfunction induced by Aβ_25–35, we examined the effect of endogenous Ngb suppression on ΔΨm after Aβ treatment. The fluorescent probe JC-1 was used to determine ΔΨm in primary mouse cortical neurons transfected by Ngb siRNA for 24 h, followed by Aβ_25–35 treatment for another 24 h. The results showed that the JC-1 red/green fluorescence ratio was significantly decreased by Aβ treatment compared to untreated control, while Ngb siRNA plus Aβ led to more reduction compared to Aβ treatment alone (Fig. 5A). Consistently, fluorescence microscopy of JC-1 aggregates also showed that the Ngb siRNA plus Aβ resulted in much more significant decreases of JC-1 aggregates, and an increase of JC-1 monomers (Fig. 5B). In addition, the intracellular ATP levels in primary mouse cortical neurons were measured after treatment with Ngb siRNA and Aβ. The results showed the intracellular ATP levels were decreased by Ngb siRNA transfection, Aβ treatment or Ngb siRNA plus Aβ, while Ngb siRNA plus Aβ led to more reduction compared to the other two groups (Fig. 5A). Mitochondrial complex III is a major source of ROS [32], which significantly contributes to neurotoxicity [33]. Our previous study demonstrated that Ngb physically interacts with mitochondrial complex III subunit Cyc1, resulting in suppression of OGD-induced Complex III activity and ROS generation elevation [21]. We thus further investigated the effect of Ngb suppression and Aβ_25–35 on mitochondrial complex III activity. The results showed that mitochondrial complex III activity in primary mouse cortical neurons was significantly increased in response to 5μM of Aβ_25–35, and 5μM of Aβ_25–35 plus Ngb siRNAtreatment.