Differences in Clinical Presentation of Behavioral and Psychological Symptoms of Dementia in Alzheimer’s Disease According to Sex and Education Level

Abstract

Background:

The behavioral and psychological symptoms of dementia (BPSD) seriously affect the quality of life of patients with Alzheimer’s disease (AD) and their caregivers.

Objective:

We aimed to identify associations between demographic/genetic factors and clinical presentations of BPSD.

Methods:

In a cohort of 463 AD patients with BPSD, we retrospectively analyzed sex, education level, AD severity (assessed using the Clinical Dementia Rating and Mini-Mental Status Examination), and BPSD severity (assessed using the Neuropsychiatry Inventory, NPI). Severe BPSD was defined as NPI ≥10 for 3 consecutive years.

Results:

Among patients with severe BPSD (NPI ≥10), we observed more female patients (62.96%) and a lower level of education (6.03±4.77 years) as compared to those with mild BPSD (NPI <10) (female: 51.09%, p = 0.007; education years: 7.91±4.93, p < 0.001). Females had a lower level of education (5.72±4.50 years) and higher scores for depression/dysphoria (1.22±2.05) compared with males (education: 8.96±4.89 years, p < 0.001; depression/dysphoria: 0.78±1.42, p = 0.047). Patients with a high level of education (defined as ≥12 years) had higher scores for appetite/eating (0.90±2.02) than did those without (0.69±1.79; p = 0.001). Genetic analysis showed similar total and subscale NPI scores between patients with and without APOE4 and with and without the GRN rs5848 genotype.

Conclusion:

Our findings indicate potential contributions of sex and education to the presentation of BPSD. Further study is warranted to provide models for tailoring therapeutic programs to individual AD patients according to these factors.

Keywords

Alzheimer’s disease behavioral and psychological symptoms of dementia education level Neuropsychiatric Inventory sex

INTRODUCTION

Alzheimer’s disease (AD), the most common type of dementia among older people, is a progressive neurodegenerative disorder that slowly impairs cognitive function, memory and thinking processes, and eventually the ability to perform daily activities [1]. During the progression of AD, some patients experience behavioral and psychological symptoms of dementia (BPSD) consisting of disturbed emotions, mood, perception, thought, and motor activity and altered personality traits [2]. BPSD are very common in AD patients and are reported to be distressing to both the patients and their caregivers [3]. In addition, BPSD are associated with an unfavorable prognosis and increased use of health care resources [4 –6]. Thus, BPSD are important clinical targets for intervention in AD patients.

The clinical presentations of BPSD include apathy, depression, anxiety, delusions, hallucinations, sexual or social disinhibition, sleep-wake cycle disturbances, aggression, agitation, and other behaviors considered inappropriate [7]. Apathy, depression, anxiety, and agitation are likely the most frequent presentations of BPSD [8 –10]. However, substantial variations in the prevalence, incidence, and longitudinal course have been reported between studies [11]. These differences are multifactorial, involving biological, psychological, and environmental factors. For example, apathy correlates with hypoperfusion in the anterior cingulate cortex and fronto-subcortical region [12]. Hypoperfusion of the frontal and temporal lobes is linked to aggression and psychosis [13]. Changes in cholinergic activity in the frontal and temporal cortices may be associate with aberrant motor and aggressive behaviors [14, 15]. Increased neuroticism may be associated with a higher risk of depression [16, 17]. Psychosocial factors regarding caregivers, including a sense of competence or burden, also contribute to BPSD [18]. The identification of the clinical presentations of BPSD in different populations of AD patients is important for providing treatment tailored to the multifaceted aspects of the patient’s demographic, socioeconomic, psychological, and genetic backgrounds.

The severity of BPSD is reportedly augmented by AD progression [19]. Furthermore, different manifestations of BPSD have been observed between male and female patients [20]. This study analyzes demographic data from 463 AD patients to identify associations between demographic/genetic factors and clinical presentations of BPSD. These results provide important information for developing tailored care strategies for AD patients.

METHODS

Ethics statement

Informed consent was obtained from each participant in accordance with the protocol approved by Chang Gung Memorial Hospital (IRB 98-0137B, 99-0014C, 99-3954C, 101-5008A3, 102-0735A3, 102-5618A3, and 103-3331C).

Patient population

We retrospectively reviewed the medical records of patients diagnosed with AD at the neurology clinics of Chang Gung Memorial Hospital. The diagnosis of AD was based on NINCDS-ADRDA Alzheimer’s Criteria [21] by two neurologists specializing in dementia (HC Kuo and CC Huang). All participants received a standard neurological examination to rule out other neurological disease, major psychiatric illness, and severe visual or hearing impairment. All participants also received blood tests to rule out other systemic diseases including whole blood counts, electrolytes, sugar levels, renal and liver function, serum vitamin B12, and folic acid levels. Serological tests for syphilis and endocrine function of the thyroid and adrenal glands were also performed. All patients received cerebral computed tomography (CT) or magnetic resonance imaging (MRI) to rule out the possibility of other brain lesions. All included patients demonstrated unremarkable findings regarding hemogram, blood biochemistry, thyroid function, folic acid, and vitamin B12 levels and had negative results on the rapid plasma reagin test. For inclusion, the severity of BPSD must have remained unchanged for three consecutive years.

Assessments and measures

The neuropsychiatric status of the patient at the time of venipuncture was assessed using the Clinical Dementia Rating (CDR) [22], Mini-Mental Status Examination (MMSE) [23], and Neuropsychiatric Inventory (NPI) [24]. CDR is an instrument used to assess the presence and severity of dementia using six cognitive and behavioral domains: memory, orientation, judgment and problem solving, community affairs, home and hobbies performance, and personal care. The CDR is scored on a scale of 0–3 : 0, no dementia; 0.5, questionable dementia; 1, mild cognitive impairment; 2, moderate cognitive impairment; 3, severe cognitive impairment [22]. The MMSE, a 30-point questionnaire measuring cognitive impairments, is widely for assessing the elderly in clinical practice. The MMSE includes tests of orientation, attention, memory or recall, registration, calculation, language, and ability to follow simple commands [23]. The NPI is used to assess a wide range of neuropsychological syndromes in dementia patients. For 12 scored items, the test first assesses the presence of the given symptom; if “yes”, the frequency of occurrence and severity are recorded [24]. The NPI scale assesses the frequency and severity of hallucinations, aggression or agitation, depression, anxiety, euphoria, apathy, disinhibition, irritability/emotional lability, hyperactivity, and sleep disturbance. No references in the literature define NPI cut-off values for BPSD severity. Thus, in this study, the severity of NPI was defined according to our clinical experience. Severe BPSD was defined as patients with scores of NPI ≥10 for 3 consecutive years. Patients with NPI <10 for three consecutive years were considered to have mild BPSD.

All subjects had no systemic infection, chronic renal failure, cardiac or liver dysfunction, malignancies, autoimmune diseases, stroke, or neurological diseases other than AD. Education level is reported as the number of years of education. Patients were divided into two groups: >12 years and ≤12 years. Those educated for more than 12 years (i.e., completed elementary school and continued with tertiary education) were considered to have a higher level of education.

Genetic analysis

Genomic DNA was isolated from peripheral leukocytes using a DNA Extraction Kit (Stratagene, San Diego, CA, USA). The presence of polymorphism GRN rs5848 was determined using a pre-designed custom TaqMan SNP genotyping assay (assay ID: C7452046_20) on an ABI 7000 Real Time PCR system according to the manufacturer’s protocol (Applied Biosystem, Foster City, CA, USA). Briefly, each reaction included 20 ng of DNA, 0.9μM of each primer, 0.2μM of probe (probe sequence: TCTGCTCAGGCCTCCCTAGCACCTC[C/T]CCCTAACCAAATTCTCCCTGGACCC) and Universal PCR Master Mix (Applied Biosystems). PCR parameters were 50°C for 2 min, 95°C for 10 min, 40 cycles of 95°C for 15 s, and 60°C for 1 min. The genotyping results were analyzed using SDS software version 1.1 (Applied Biosystem). APOE genotyping was determined using restriction fragment length polymorphism [25].

Statistical analysis

The Statistical Program for Social Sciences (SPSS ver. 23) was used for all statistical analyses. Non-categorical variables were compared using one-way analysis of covariance (ANCOVA) with adjustments for age, sex, education level, and CDR or MMSE, as appropriate. The Bonferroni method was employed for post hoc correction for multiple comparisons. Linear regression analysis was used to explore the relationship between NPI and CDR or MMSE. Chi-square test was used to compare categorical variables including sex and genotypes. The patient genotypes followed the Hardy Weinberg equilibrium. All p values were two-tailed, and p < 0.05 was considered statistically significant. With the estimated standard deviations at the significant level of 0.05, the sample size achieved a power greater than 0.7 for detecting differences in the mean between compared groups.

RESULTS

The demographic data of 188 AD patients with severe BPSD and 275 AD patients with mild BPSD are compared in Table 1. Compared to patients with mild BPSD, significantly more patients with severe BPSD were female, were significantly older, and had significantly higher NPI scores, less education, higher CDR scores, and lower MMSE scores. The frequencies of APOE4 carriers were similar between the two groups. Baseline differences in age at diagnosis, sex, education, CDR, and MMSE were adjusted in subsequent analysis with a general linear model (ANCOVA) to address sex-differences on BPSD presentation.

Table 1

Comparison of demographic and clinical characteristics between AD patients with severe and mild BPSD

	Severe BPSD	Mild BPSD	Total
	(n = 188)	(n = 275)	(n = 463)
Age at diagnosis (y), mean±SD	71.63±7.52	69.61±7.7^a	70.43±7.68
NPI-total score, mean±SD	19.33±9.11	2.30±2.72^a	9.22±10.40
Sex, female (%)	118 (62.8%)	141 (51.3%)^b	259 (55.94%)
Education (y), mean±SD	6.03±4.78	7.90±4.92^a	7.14±4.94
APOE4 carrier, n (%)	56 (29.8%)	84 (30.5%)	140 (30.24%)
CDR, mean±SD	1.20±0.57	0.57±0.28^a	0.82±0.52
MMSE, mean±SD	13.62±7.17	21.74±5.34^a	18.45±7.33

AD, Alzheimer’s disease; BPSD, behavioral and psychological symptoms of dementia; CDR, clinical dementia rating; MMSE, mini-mental status examination; NPI, neuropsychiatric inventory. ^aSignificant difference compared to patients with severe BPSD (NPI ≥10); p < 0.05, Student’s t test. ^bSignificant difference compared to patients with severe BPSD (NPI ≥10); p < 0.05, Chi-square test.

After noting that sex and education level were significantly associated with severe BPSD in AD patients, we further stratified the patients according to these factors. We observed that among all the AD patients, females had significantly less education (5.72±4.50 years) and significantly higher CDR scores (0.87±0.54), lower MMSE scores, and higher NPI scores for depression/dysphoria than did males (Table 2). We also observed that NPI scores correlated significantly with education level (β coefficient = –0.48, p < 0.001), CDR scores (β coefficient = 12.58; p < 0.001), and MMSE scores (β coefficient = –0.768; p < 0.001) (Supplementary Table 1). Therefore, these factors were adjusted in subsequent analyses.

Table 2

Comparison of clinical characteristics and neuropsychiatric inventory (NPI) subscale scores between male and female AD patients

	Female	Male	Total
	(n = 259)	(n = 204)	(n = 463)
Age at diagnosis (y)	70.38±7.53	70.50±7.88	70.43±7.68
Education (y)	5.72±4.50	8.96±4.89^a	7.14±4.94
APOE4 carrier	82 (31.66%)	58 (28.43%)	140 (30.24%)
CDR	0.87±0.54	0.76±0.49^a	0.82±0.52
MMSE	17.18±7.33	20.06±7.02^a	18.45±7.33
NPI total	10.31±11.01	7.83±9.40	9.22±10.40
Delusions	1.18±2.20	0.80±1.99	1.02±2.11
Hallucinations	0.50±1.62	0.29±1.15	0.41±1.43
Agitation/Aggression	1.23±2.15	1.22±2.17	1.22±2.16
Depression/Dysphoria	1.22±2.05	0.78±1.42^b	1.03±1.81
Anxiety	0.86±1.75	0.68±1.76	0.78±1.76
Elation/Euphoria	0.13±0.68	0.07±0.48	0.10±0.60
Apathy/Indifference	0.46±1.45	0.58±1.59	0.51±1.51
Disinhibition	0.51±1.61	0.42±1.44	0.47±1.54
Irritability/Lability	0.87±1.73	0.84±1.51	0.86±1.63
Aberrant motor behaviors	0.95±2.08	0.50±1.61	0.75±1.90
Nighttime behaviors	1.58±2.57	0.98±2.02	1.32±2.36
Appetite/eating	0.81±2.05	0.66±1.58	0.75±1.85

CDR, Clinical Dementia Rating; MMSE, Mini-Mental Status Examination. ^aStatistically significant in comparison with female patients, p < 0.05, Student’s t test. ^bStatistically significant in comparison with female patients, p < 0.05, ANCOVA with adjustment of age, education, CDR, and MMSE.

We further stratified patients according to education level (Table 3). Patients with a high level of education level (>12 years) were significantly older and had significantly lower CDR, higher MMSE, and higher appetite/eating NPI scores compared to those without. The differences in these parameters according to education level remained significant when stratified by sex. Among patients with a high level of education, females demonstrated significantly higher scores for aberrant motor behaviors and nighttime behaviors than did males. These results suggest that both sex and education level affect the clinical presentation of BPSD in AD patients (Table 3; Supplementary Table 2).

Table 3

Clinical characteristics and NPI subscale scores of AD patients according to education level

	High education level^* (+) (>12 y)			High education level (–) (≤12 y)
	Female	Male	Total	Female	Male	Total
	(n = 42)	(n = 82)	(n = 124)	(n = 217)	(n = 122)	(n = 339)
Age at diagnosis (y)	64.36±9.83	68.50±9.56	67.10±9.81	71.54±6.40^c	71.84±6.22^e	71.65±6.33^a
APOE4 carrier	15 (35.71%)	21 (25.61%)	36 (29.03%)	67 (30.88%)	37 (30.32%)	104 (30.68%)
CDR	0.71±0.48	0.68±0.40	0.69±0.43	0.91±0.55^c	0.82±0.54^e	0.87±0.54^a
MMSE	20.79±7.43	22.27±6.29	21.77±6.71	16.48±7.11^c	18.57±71^e	17.23±7.17^a
NPI-total	8.57±8.91	6.37±7.19	7.11±7.85	10.65±11.3	8.81±10.55	9.99±11.09
Delusions	0.69±1.73	0.45±1.51	0.53±1.58	1.28±2.27	1.04±2.23	1.19±2.25
Hallucinations	0.21±1.24	0.15±0.63	0.17±0.88	0.56±1.68	0.39±1.39	0.50±1.58
Agitation/Aggression	1.05±1.72	1.16±2.13	1.12±2.00	1.26±2.23	1.26±2.20	1.26±2.22
Depression/Dysphoria	1.07±2.04	0.66±1.29	0.80±1.59	1.25±2.06	0.87±1.49	1.12±1.88
Anxiety	1.02±1.88	0.44±1.03^f	0.64±1.40	0.83±1.73	0.84±2.10	0.83±1.87
Elation/Euphoria	0.10±0.62	0	0.08±0.50	0.13±0.69	0.12±0.61	0.13±0.66
Apathy/Indifference	0.45±1.15	0.54±1.68	0.51±1.52	0.47±1.50	0.61±1.53	0.52±1.51
Disinhibition	0.33±1.16	0.29±1.13	0.31±1.13	0.54±1.69	0.50±1.61	0.53±1.66
Irritability/Lability	0.81±1.61	0.79±1.55	0.80±1.57	0.88±1.75	0.87±1.48	0.88±1.66
Aberrant motor behaviors	0.76±1.53	0.23±0.89^g	0.41±1.17	0.98±2.18	0.67±1.92	0.87±2.09
Nighttime behaviors	0.95±1.68	0.87±1.80	0.90±1.75	1.71±2.69	1.06±2.16^h	1.47±2.53
Appetite/eating	1.12±2.22	0.79±1.91	0.90±2.02	0.76±2.0^d	0.57±1.31^f	0.69±1.79^b

^*High education level was considered to be > 12 years of education (attended university). CDR, Clinical Dementia Rating; MMSE, Mini-Mental Status Examination. ^aStatistically significant in comparison with patients with high education, p < 0.05, Student’s t test. ^bStatistically significant in comparison with patients with high education, p < 0.05, ANCOVA with adjustment of age, sex, CDR, and MMSE. ^cStatistically significant in comparison with female patients with high education, p < 0.05, Student’s t test. ^dStatistically significant in comparison with female patients with high education, p < 0.05, ANCOVA with adjustment of age, sex, CDR, and MMSE. ^eStatistically significant in comparison with male patients with high education, p < 0.05, Student’s t test. ^fStatistically significant in comparison with male patients with high education, p < 0.05, ANCOVA with adjustment of age, CDR, and MMSE. ^gStatistically significant in comparison with female patients with high education, p < 0.05, ANCOVA with adjustment of age, CDR, and MMSE. ^hStatistically significant in comparison with female patients without high education, p < 0.05, ANCOVA with adjustment of age, CDR, and MMSE.

To identify potential genetic contributions to BPSD, we stratified our patient cohort according to APOE genotypes. The total and subscale NPI scores were similar between patients with different APOE genotypes (Table 4). The effect of GRN rs5848 single nucleotide polymorphism on the presentation of BPSD were investigated. No difference in total or subscale NPI scores was observed between patients of genotype CC, CT, and TT for GRN rs5848 (Table 5).

Table 4

Demographic and subscale scores of Neuropsychiatric Inventory (NPI) in AD patients according to APOE4 genotype

	APOE4 (–)	APOE4 heterozygous	APOE4 homozygous
	(n = 323)	(n = 116)	(n = 24)
Age at diagnosis (y)	69.52±8.86	70.96±7.14	70.45±7.72
Education (y)	6.64±4.95	7.16±5.00	8.16±4.62
CDR	0.88±0.56	0.79±0.48	0.84±0.57
MMSE	18.16±7.62	18.68±6.84	18.19±8.42
NPI-total	9.11±10.15	9.28±10.83	10.42±11.88
Delusions	0.96±2.11	1.09±1.91	1.42±2.96
Hallucinations	0.42±1.46	0.42±1.49	0.17±0.64
Agitation/Aggression	1.21±2.18	1.22±2.07	1.50±2.40
Depression/Dysphoria	0.99±1.73	1.09±2.01	1.21±2.91
Anxiety	0.81±1.73	0.72±1.89	0.71±1.46
Elation/Euphoria	0.11±0.63	0.07±0.43	0.17±0.82
Apathy/Indifference	0.49±1.35	0.46±1.49	1.17±3.00
Disinhibition	0.40±1.37	0.60±1.88	0.71±1.78
Irritability/Lability	0.82±1.55	1.04±1.89	0.50±1.25
Aberrant motor behaviors	0.69±1.84	0.84±1.90	1.13±2.56
Nighttime behaviors	1.46±2.37	1.03±2.36	0.75±2.11
Appetite/eating	0.75±1.86	0.68±1.80	1.00±2.13

CDR, Clinical Dementia Rating; MMSE, Mini-Mental Status Examination.

Table 5

Clinical characteristics and neuropsychiatric inventory (NPI) subscale scores of AD patients according to GRN rs5848 single nucleotide polymorphism

	CC	CT	TT
	(n = 148)	(n = 250)	(n = 67)
Age at diagnosis (y)	69.52±8.86	70.96±7.14	70.45±7.72
Education (y)	6.64±4.95	7.16±5.00	8.16±4.62
CDR	0.88±0.56	0.79±0.48	0.84±0.57
MMSE	18.16±7.62	18.68±6.84	18.19±8.42
NPI-total	10.79±11.79	8.64±10.20	7.96±8.95
Delusions	1.08±2.30	1.07±2.12	0.66±1.57
Hallucinations	0.56±1.73	0.38±1.31	0.19±1.09
Agitation/Aggression	1.47±2.37	1.15±2.08	0.97±1.94
Depression/Dysphoria	1.11±1.80	0.99±1.80	1.00±1.90
Anxiety	0.89±1.68	0.75±1.89	0.67±1.37
Elation/Euphoria	0.14±0.73	0.07±0.47	0.15±0.70
Apathy/Indifference	0.62±1.76	0.42±1.28	0.62±1.70
Disinhibition	0.64±1.84	0.39±1.42	0.36±1.16
Irritability/Lability	0.99±1.76	0.82±1.63	0.70±1.36
Aberrant motor behaviors	0.84±1.91	0.67±1.81	0.85±2.19
Nighttime behaviors	1.67±2.89	1.21±2.14	0.94±1.69
Appetite/eating	0.78±1.89	0.70±1.83	0.85±1.88

CDR, Clinical Dementia Rating; MMSE, Mini-Mental Status Examination.

DISCUSSION

While disease stage and dementia subtype are reported to affect BPSD presentation [19], the influence of other factors such as demographic variables and education have not been extensively explored. We observed that more AD patients with severe BPSD were female, did not attend high school and had advanced stage disease. Female patients had higher scores for depression/dysphoria than did male patients. Patients with higher education had higher scores for appetite/eating, and the females in this group had higher scores for aberrant motor behaviors than did males. Among patients with a high level of education, scores for nighttime behaviors were higher in females than in males. Genotypes for APOE4 and GRN rs5848 polymorphisms do not appear to be associated with BPSD presentation. These results indicate that sex and education level may contribute to the presentations of BPSD.

Compelling evidence suggests a protective role of education against the risk of AD [26 –30]. The proposed concept of ‘cognitive reserve’ is widely used to explain how education could modify cognitive decline and other clinical manifestations of dementia [31]. Cognitive reserve, the presumed ability to tolerate age-related cerebral degeneration without developing clinical symptoms or signs of disease, may result from a complicated interaction between education, occupational complexity, reading ability, intellectual quotient, and dementia [31]. This reserve may be associated with morphological or neurochemical changes in brain [32 –35]. Higher levels of education are associated with greater cortical thickness in the temporal, temporoparietal, and orbitofrontal cortices, greater white matter volume in the inferior frontal areas, increased fiber connectivity in white matter structures connecting the temporoparietal and orbitofrontal lobes [34, 35], decreased fiber integrity in the hippocampus [33], and reduced cortical atrophy [32]. An FDG-PET study also shows greater metabolism in the anterior cingulate cortex in healthy elders with higher education [36]. These findings highlight the effect of early-life cognitive stimulation, as provided by education, for brain health in late life [16]. Consistent with these observations, our study shows that patients with a high education level had lower CDR and higher MMSE scores than did those with less education. Greater cognitive reserve established by a higher level of education may underlie this finding. Interestingly, the severity of appetite/eating problems was higher in patients with a high education level. Reward-dependent traits are common in highly educated patients and are likely related to appetite/eating problems [37, 38]. Further research is needed to understand whether education is associated with structural and functional changes that affect the regulation of appetite and eating.

Although advanced age is a known factor in the pathological and clinical features of AD, lines of evidences suggest that sex also may be an important factor in its development and progression [39, 40]. Both the prevalence and incidence of AD are greater among females, and this difference increases with advancing age [41]. Consistent with our findings, previous studies report that female patients with AD have greater cognitive deficits than do males [42, 43]. The reduced estrogen levels in postmenopausal women and lower cognitive reserve related to fewer years of education may contribute to the relatively poor cognitive function in female patients with AD [44].

We observed a significant difference in depression/dysphoria presentations of BPSD between the sexes. Previous studies have shown that female patients with dementia are prone to have depressive symptoms while male patients frequently demonstrate aggressive and regressive behaviors [45, 46], and women with vascular dementia exhibit more neuropsychiatric symptoms than do males [47]. Similar to our findings, female AD patients in an Italian cohort tended to suffer depression and nighttime behaviors [48]. The present study additionally reveals the tendency of female AD patients to develop anxiety, apathy/indifference, and appetite/eating abnormalities. Our findings contribute to a growing body of evidence showing that sex dimorphism occurs in virtually all neurodegenerative diseases; mitochondrial function and epigenetic modifications likely underlie these sex-dependent differences in disease manifestation [49]. Thus, sex-dependent differences in BPSD presentation are likely contributed by a complex network of diverse factors, including genetics, environmental factors, sociocultural background, and education, all of which may interact with reproductive hormones to affect the presentation of BPSD in AD patients [49].

Several studies investigating the contribution of genetic factors to the clinical manifestations of BPSD demonstrate inconsistent results. Chen et al. report that risk of developing agitation/aggregation and delusions is higher in Taiwanese AD patients who are APOE4 carriers [50]. However, we did not observe these associations in the present study. GRN rs5848, located in the 3^′-untranslated region of the gene, is reported to alter the risk of AD [51 –54], frontotemporal lobe degeneration [55], and Parkinson’s disease [56]. Our results show that the clinical manifestations of BPSD in different rs5848 genotypes are similar. Further studies to identify potential genetic factors contributing to specific BPSD presentations in AD patients are warranted.

Our results demonstrate sex- and education-related differences in the clinical presentation of BPSD. For female patients, interventions for depression/dysphoria, including anti-depressants and behavior therapies, could be important for decreasing their impact on patients and caregivers [57, 58]. Closing the educational gap between sectors of the population is also important for reducing the severity of AD, particularly in female patients [59]. Problems with appetite and eating, which are more common among highly educated patients, may lead to nutritional deficiencies. Improving aberrant motor and nighttime behaviors with medications or non-pharmacological approaches could be helpful, particularly in female patients [57, 58].

Our study is limited by the relatively small cohort size and the natural bias of a retrospective, hospital-based study. The potential effects of medications and other genetic variants were not explored. We did not evaluate the differences in interventions received by patients for psychiatric presentations. This study is also limited by our categorization of BPSD as mild or severe using an NPI cutoff value of 10, a distinction based on our clinical experience for the purpose of this study only. We acknowledge that comparing severe to mild BPSD might not be the most accurate method, because BPSD severity is a continuum of presentations from mild to moderate to severe. Further analysis is needed to identify more factors associated with BPSD manifestations and establish therapeutic programs tailored to each AD patient.

Footnotes

ACKNOWLEDGMENTS

This study was sponsored by Chang Gung Me-morial Hospital, Taipei, Taiwan (CMRPG104-7092C1, CMRPG300071, CMRPG300072, CMRPG3F1613, CMRPG3H0982, CMRPG3G0431 and CMRPG3J1921), and Ministry of Sciences and Technology, Executive Yuan, Taiwan (106-2314-B-182-037-MY2 and 108-2628-B-182-003). The funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Authors’ disclosures available online ().

The supplementary material is available in the electronic version of this article: .

References

Querfurth

, Laferla

(2010) Alzheimer’s disease. N Engl J Med 362, 329–344.

Finkel

, Costa

Silva

, Cohen

, Miller

, Sartorius

(1996) Behavioral and psychological signs and symptoms of dementia: A consensus statement on current knowledge and implications for research and treatment. Psychogeriatr 8 Suppl 3, 497–500.

Huang

, Lee

, Liao

, Wang

, Lai

(2012) Caregiver burden associated with behavioral and psychological symptoms of dementia (BPSD) in Taiwanese elderly. Arch Gerontol Geriatr 55, 55–59.

Beeri

, Werner

, Davidson

, Noy

(2002) The cost of behavioral and psychological symptoms of dementia (BPSD) in community dwelling Alzheimer’s disease patients. J Geriatr Psychiatry 17, 403–408.

Tatsumi

, Nakaaki

, Torii

, Shinagawa

, Watanabe

, Murata

, Sato

, Mimura

, Furukawa

(2009) Neuropsychiatric symptoms predict change in quality of life of Alzheimer disease patients: A two-year follow-up study. Psychiatry Clin Neurosci 63, 374–384.

Ryu

, Ha

, Park

, Yu

, Livingston

(2011) Persistence of neuropsychiatric symptoms over six months in mild cognitive impairment in community-dwelling Korean elderly. Psychogeriatr 23, 214–220.

Kales

, Gitlin

, Lyketsos

(2015) Assessment and management of behavioral and psychological symptoms of dementia. BMJ 350, H369.

Mega

, Cummings

, Fiorello

, Gornbein

(1996) The spectrum of behavioral changes in Alzheimer’s disease. Neurology 46, 130–135.

Lyketsos

, Lopez

, Jones

, Fitzpatrick

, Breitner

, Dekosky

(2002) Prevalence of neuropsychiatric symptoms in dementia and mild cognitive impairment: Results from The Cardiovascular Health Study. JAMA 288, 1475–1483.

10.

Steinberg

, Shao

, Zandi

, Lyketsos

, Welsh-Bohmer

, Norton

, Breitner

, Steffens

, Tschanz

, Cache County Investigators (2008) Point And 5-year period prevalence of neuropsychiatric symptoms in dementia: The Cache County Study. J Geriatr Psychiatry 23, 170–177.

11.

Van Der Linde

, Dening

, Stephan

, Prina

, Evans

, Brayne

(2016) Longitudinal course of behavioural and psychological symptoms of dementia: Systematic review. Br J Psychiatry 209, 366–377.

12.

Huey

, Lee

, Cheran

, Grafman

, Devanand

, Alzheimer’s Disease Neuroimaging Initiative (2017) Brain regions involved in arousal and reward processing are associated with apathy in Alzheimer’s disease and frontotemporal dementia. J Alzheimers Dis 55, 551–558.

13.

International Psychogeriatric Association (2010) The IPA Complete Guides To Behavioral And Psychological Symptoms Of Dementia. International Psychogeriatric Association, Milwaukee, WI.

14.

Lagarde

, Sarazin

, Chauvire

, Stankoff

, Kas

, Lacomblez

, Peyronneau

, Bottlaender

(2017) Cholinergic changes in aging and Alzheimer disease: An [18F]-F-A-85380 exploratory PET study. Alzheimer Dis Assoc Disord 31, 8–12.

15.

Minger

, Esiri

, Mcdonald

, Keene

, Carter

, Hope

, Francis

(2000) Cholinergic deficits contribute to behavioral disturbance in patients with dementia. Neurology 55, 1460–1467.

16.

Pocnet

, Rossier

, Antonietti

, Von Gunten

(2013) Personality traits and behavioral and psychological symptoms in patients at an early stage of Alzheimer’s disease. J Geriatr Psychiatry 28, 276–283.

17.

Prior

, Abraham

, Nicholas

, Chan

, Vanvlymen

, Lovestone

, Boothby

(2016) Are premorbid abnormal personality traits associated with behavioural and psychological symptoms in dementia? J Geriatr Psychiatry 31, 1050–1055.

18.

Feast

, Orrell

, Russell

, Charlesworth

, Moniz-Cook

(2017) The contribution of caregiver psychosocial factors to distress associated with behavioural and psychological symptoms in dementia. J Geriatr Psychiatry 32, 76–85.

19.

Kazui

, Yoshiyama

, Kanemoto

, Suzuki

, Sato

, Hashimoto

, Ikeda

, Tanaka

, Hatada

, Matsushita

, Nishio

, Mori

, Tanimukai

, Komori

, Yoshida

, Shimizu

, Matsumoto

, Mori

, Kashibayashi

, Yokoyama

, Shimomura

, Kabeshita

, Adachi

, Tanaka

(2016) Differences of behavioral and psychological symptoms of dementia in disease severity in four major dementias. One 11, E0161092.

20.

Lee

, Lee

, Kim

(2017) Gender differences in behavioral and psychological symptoms of patients with Alzheimer’s disease. Asian J Psychiatr 26, 124–128.

21.

Mckhann

, Knopman

, Chertkow

, Hyman

, Jack

Jr. , Kawas

, Klunk

, Koroshetz

, Manly

, Mayeux

, Mohs

, Morris

, Rossor

, Scheltens

, Carrillo

, Thies

, Weintraub

, Phelps

(2011) The diagnosis of dementia due to alzheimer’s disease: Recommendations from The National Institute On Aging-Alzheimer’s Association Workgroups On Diagnostic Guidelines For Alzheimer’s Disease. Dement 7, 263–269.

22.

Morris

(1997) Clinical dementia rating: A reliable and valid diagnostic and staging measure for dementia of the Alzheimer type. Psychogeriatr 9 Suppl 1, 173–176; Discussion 177-178.

23.

Folstein

, Folstein

, Mchugh

(1975) “Mini-Mental State”. A practical method for grading the cognitive state of patients for the clinician. J Psychiatr Res 12, 189–198.

24.

Cummings

, Mega

, Gray

, Rosenberg-Thompson

, Carusi

, Gornbein

(1994) The Neuropsychiatric Inventory: Comprehensive assessment of psychopathology in dementia. Neurology 44, 2308–2308.

25.

Wenham

, Price

, Blandell

(1991) Apolipoprotein E genotyping by one-stage PCR. Lancet 337, 1158–1159.

26.

Prince

, Acosta

, Ferri

, Guerra

, Huang

, Rodriguez

JJL

, Salas

, Sosa

, Williams

, Dewey

, Acosta

, Jotheeswaran

, Liu

(2012) Dementia incidence and mortality in middle-income countries, and associations with indicators of cognitive reserve: A 10/66 Dementia Research Group population-based cohort study. Lancet 380, 50–58.

27.

Fratiglioni

, Grut

, Forsell

, Viitanen

, Grafstrom

, Holmen

, Ericsson

, Backman

, Ahlbom

, Winblad

(1991) Prevalence of Alzheimer’s disease and other dementias in an elderly urban population: Relationship with age, sex, and education. Neurology 41, 1886–1892.

28.

Zhang

, Katzman

, Salmon

, Jin

, Cai

, Wang

, Qu

, Grant

, Yu

, Levy

, Klauber

, Liu

(1990) The prevalence of dementia and Alzheimer’s disease in Shanghai, China: Impact of age, gender, and education. Ann Neurol 27, 428–437.

29.

Karp

, Kåreholt

, Qiu

, Bellander

, Winblad

, Fratiglioni

(2004) Relation of education and occupation-based socioeconomic status to incident Alzheimer’s disease. Am J Epidemiol 159, 175–183.

30.

Katzman

(1993) Education and the prevalence of dementia and Alzheimer’s disease. Neurology 43, 13–20.

31.

Fratiglioni

, Wang

(2007) Brain reserve hypothesis in dementia. J Alzheimers Dis 12, 11–22.

32.

Coffey

, Saxton

, Ratcliff

, Bryan

, Lucke

(1999) Relation of education to brain size in normal aging. Implications for the reserve hypothesis. Neurology 53, 189–189.

33.

Piras

, Cherubini

, Caltagirone

, Spalletta

(2011) Education mediates microstructural changes in bilateral hippocampus. Hum Brain Mapp 32, 282–289.

34.

Gordon

, Rykhlevskaia

, Brumback

, Lee

, Elavsky

, Konopack

, Mcauley

, Kramer

, Colcombe

, Gratton

, Fabiani

(2008) Neuroanatomical correlates of aging, cardiopulmonary fitness level, and education. Psychophysiology 45, 825–838.

35.

Liu

, Julkunen

, Paajanen

, Westman

, Wahlund

L-O

, Aitken

, Sobow

, Mecocci

, Tsolaki

, Vellas

, Muehlboeck

, Spenger

, Lovestone

, Simmons

, Soininen

, AddNeuroMed Consortium (2012) Education increases reserve against Alzheimer’s disease—evidence from structural MRI analysis. Neuroradiology 54, 929–938.

36.

Arenaza-Urquijo

, Landeau

, La Joie

, Mevel

, Mezenge

, Perrotin

, Desgranges

, Bartres-Faz

, Eustache

, Chetelat

(2013) Relationships between years of education and gray matter volume, metabolism and functional connectivity in healthy elders. Neuroimage 83, 450–457.

37.

Dura

, Bornstein

(1989) Differences between IQ and school achievement in anorexia nervosa. J Clin Psychol 45, 433–435.

38.

Bardone-Cone

, Wonderlich

, Frost

, Bulik

, Mitchell

, Uppala

, Simonich

(2007) Perfectionism and eating disorders: Current status and future directions. Psychol Rev 27, 384–405.

39.

Howlett

, Richardson

, Austin

, Parsons

, Bate

, Davies

, Gonzalez

(2004) Cognitive correlates of Aβ deposition in male and female mice bearing amyloid precursor protein and presenilin-1 mutant transgenes. Brain Res 1017, 130–136.

40.

Beinhoff

, Tumani

, Brettschneider

, Bittner

, Riepe

(2008) Gender-specificities in Alzheimer’s disease and mild cognitive impairment. J Neurol 255, 117–122.

41.

De Pedro-Cuesta

, Virués-Ortega

, Vega

, Seijo-Martínez

, Saz

, Rodríguez

, Rodríguez-Laso

, Reñé

, De Las Heras

, Mateos

, Martínez-Martín

, Manubens

, Mahillo-Fernandez

, López-Pousa

, Lobo

, Reglà

, Gascón

, García

, Fernández-Martínez

, Boix

, Bermejo-Pareja

, Bergareche

, Benito-León

, De Arce

, Del Barrio

(2009) Prevalence of dementia and major dementia subtypes in Spanish populations: A reanalysis of dementia prevalence surveys, 1990-2008. BMC Neurol 9, 55.

42.

Maylor

, Reimers

, Choi

, Collaer

, Peters

, Silverman

(2007) Gender and sexual orientation differences in cognition across adulthood: Age is kinder to women than to men regardless of sexual orientation. Arch Sex Behav 36, 235–249.

43.

Irvine

, Laws

, Gale

, Kondel

(2012) Greater cognitive deterioration in women than men with Alzheimer’s disease: A meta analysis. J Clin Exp Neuropsychol 34, 989–998.

44.

Gholizadeh

, Sadatmahalleh

, Ziaei

(2018) The association between estradiol levels and cognitive function in postmenopausal women. J Reprod Biomed (Yazd) 16, 455–458.

45.

Kitamura

, Kitamura

, Hino

, Tanaka

, Kurata

(2012) Gender differences in clinical manifestations and outcomes among hospitalized patients with behavioral and psychological symptoms of dementia. J Clin Psychiatry 73, 1548–1554.

46.

Lovheim

, Sandman

, Karlsson

, Gustafson

(2009) Sex differences in the prevalence of behavioral and psychological symptoms of dementia. Psychogeriatr 21, 469–475.

47.

Hsieh

, Chang

, Lin

(2009) Neuropsychiatric profiles of patients with Alzheimer’s disease and vascular dementia in Taiwan. J Geriatr Psychiatry 24, 570–577.

48.

Colombo

, Caltagirone

, Padovani

, Sorbi

, Spalletta

, Simoni

, Ori

, Zagni

(2018) Gender differences in neuropsychiatric symptoms in mild to moderate Alzheimer’s disease patients undergoing switch of cholinesterase inhibitors: A post hoc analysis of the EVOLUTION Study. J Women Health (2002) 27, 1368–1377.

49.

Ullah

, Ahmad

, Bhat

, Abu-Duhier

, Barreto

, Ashraf

(2019) Impact of sex differences and gender specificity on behavioral characteristics and pathophysiology of neurodegenerative disorders. Biobehav Rev 102, 95–105.

50.

Chen

, Ouyang

, Yeh

, Lai

, Liu

, Yen

, Ko

, Yen

, Liu

, Juo

(2012) Apolipoprotein E polymorphism and behavioral and psychological symptoms of dementia in patients with Alzheimer disease. Alzheimer Dis Assoc Disord 26, 135–139.

51.

, Tan

, Wan

, Tan

, Zhang

, Zheng

, Kong

, Wang

, Jiang

, Tan

, Yu

(2017) PGRN is associated with late-onset Alzheimer’s disease: A case-control replication study and meta-analysis. Mol Neurobiol 54, 1187–1195.

52.

Viswanathan

, Mäkinen

, Helisalmi

, Haapasalo

, Soininen

, Hiltunen

(2009) An association study between granulin gene polymorphisms and Alzheimer’s disease in Finnish population. Am J Med Genet B 150B, 747–750.

53.

Kämäläinen

, Viswanathan

, Natunen

, Helisalmi

, Kauppinen

, Pikkarainen

, Pursiheimo

J-P

, Alafuzoff

, Kivipelto

, Haapasalo

, Soininen

, Herukka

S-K

, Hiltunen

(2013) GRN variant Rs5848 reduces plasma and brain levels of granulin in Alzheimer’s disease patients. J Alzheimers Dis 33, 23–27.

54.

Lee

, Chen

, Cheng

, Chiu

(2011) Rs5848 variant of progranulin gene is a risk of Alzheimer’s disease in the Taiwanese population. Dis 8, 216–220.

55.

Rademakers

, Eriksen

, Baker

, Robinson

, Ahmed

, Lincoln

, Finch

, Rutherford

, Crook

, Josephs

, Boeve

, Knopman

, Petersen

, Parisi

, Caselli

, Wszolek

, Uitti

, Feldman

, Hutton

, Mackenzie

, Graff-Radford

, Dickson

(2008) Common variation in the Mir-659 binding-site of GRN is a major risk factor for TDP43-positive frontotemporal dementia. Hum Mol Genet 17, 3631–3642.

56.

Chang

, Chen

, Hsiao

, Huang

, Kuo

, Hsu

, Lee-Chen

, Wu

(2013) Association between GRN Rs5848 polymorphism and Parkinson’s disease in Taiwanese population. One 8, E54448.

57.

Tible

, Riese

, Savaskan

, Von Gunten

(2017) Best practice in the management of behavioural and psychological symptoms of dementia. Adv Neurol Disord 10, 297–309.

58.

Cohen-Mansfield

(2001) Nonpharmacologic interventions for inappropriate behaviors in dementia: A review, summary, and critique. Am J Geriatr Psychiatry 9, 361–381.

59.

Barro

, Lee

(2013) A new data set of educational attainment in the world, 1950–2010. J Dev Econ 104, 184–198.