Decreased Orexin Receptor 1 mRNA Expression in the Locus Coeruleus in Both Tau Transgenic rTg4510 and Tau Knockout Mice and Accompanying Ascending Arousal System Tau Invasion in rTg4510

Abstract

Background:

Sleep/wake disturbances (e.g., insomnia and sleep fragmentation) are common in neurodegenerative disorders, especially Alzheimer’s disease (AD) and frontotemporal dementia (FTD). These symptoms are somewhat reminiscent of narcolepsy with cataplexy, caused by the loss of orexin-producing neurons. A bidirectional relationship between sleep disturbance and disease pathology suggests a detrimental cycle that accelerates disease progression and cognitive decline. The accumulation of brain tau fibrils is a core pathology of AD and FTD-tau and clinical evidence supports that tau may impair the orexin system in AD/FTD. This hypothesis was investigated using tau mutant mice.

Objective:

To characterize orexin receptor mRNA expression in sleep/wake regulatory brain centers and quantify noradrenergic locus coeruleus (LC) and orexinergic lateral hypothalamus (LH) neurons, in tau transgenic rTg4510 and tau^–/– mice.

Methods:

We used i n situ hybridization and immunohistochemistry (IHC) in rTg4510 and tau^–/– mice.

Results:

rTg4510 and tau^–/– mice exhibited a similar decrease in orexin receptor 1 (OX₁R) mRNA expression in the LC compared with wildtype controls. IHC data indicated this was not due to decreased numbers of LC tyrosine hydroxylase-positive (TH) or orexin neurons and demonstrated that tau invades TH LC and orexinergic LH neurons in rTg4510 mice. In contrast, orexin receptor 2 (OX₂R) mRNA levels were unaffected in either model.

Conclusion:

The LC is strongly implicated in the regulation of sleep/wakefulness and expresses high levels of OX₁R. These findings raise interesting questions regarding the effects of altered tau on the orexin system, specifically LC OX₁Rs, and emphasize a potential mechanism which may help explain sleep/wake disturbances in AD and FTD.

Keywords

Alzheimer’s disease frontotemporal dementia in situ hybridization locus coeruleus orexin orexin receptor rTg4510 sleep tau

INTRODUCTION

Sleep/wake disturbances are common in Alzhe-imer’s disease (AD) and frontotemporal dementia (FTD), in which they often present very early in the course of disease progression, typically preceding cognitive impairment [1 –9]. Common sleep disturbances include insomnia, sleep fragmentation, exc-essive daytime sleepiness, decreased NREM/REM sleep, considerable shifts in circadian rhythms and an abnormally elevated level of arousal around bedtime (sundowning syndrome) [4 , 10–16]. Numerous lines of evidence suggest that a bidirectional relationship exists between sleep/wake impairments and AD pathology. Thus, a positive feedback loop has been proposed in which the initial AD pathology disrupts the sleep-wake cycle, resulting in lack of sleep and sleep fractionation, which subsequently negati-vely affects disease development to exacerbate and accelerate AD pathology [3, 4]. Animal models are currently being used to delve deeper into the potential mechanisms mediating these processes; however, the root causes of these sleep/wake disturbances remain to be determined.

Although not as severe, sleep/wake disruptions in AD parallel some of the distinguishing features of the neurological disorder narcolepsy with cataplexy (type 1 narcolepsy) [17 –21], which in humans is cau-sed by the loss of orexin-producing neurons and is characterized, amongst other features, by highly fra-gmented sleep including fast transitions from wakefulness to (REM) sleep, with a sudden loss of muscle tone (cataplexy). Furthermore, mice with disruptive modifications of the orexin system (at the gene, neu-ronal, peptide or receptors level) all exhibit remarkably similar phenotypes [22 –29], which echo the characteristic symptoms of human type 1 narcolepsy, cementing orexin neuron loss as the primary mechanism underlying this disorder.

The orexin system [30, 31] plays a crucial role in the regulation of sleep and wakefulness [32, 33]. The two neuropeptides orexin A and orexin B are produced by neuronal cells restricted exclusively to the lateral hypothalamus (LH) [34 –36]. Orexin fibers br-oadly innervate the central nervous system [34, 36] and the neuropeptides act on two G-protein coupled receptors –orexin receptor 1 (OX₁R) and ore-xin receptor 2 (OX₂R). A widespread, but distinct expression profile of the two receptors is observed throughout the brain [37]. Dense orexinergic innervation and high orexin receptor expression levels are found especially in brain regions involved in the regulation of arousal; accordingly, activation of orexin receptors promotes wakefulness [37], whereas antagonism of OX₂R, or of both OX₂R and OX₁R, promotes sleep [33, 38]. The arousal promoting effects of orexin originate from their excitatory inputs to wake-active neuronal populations, including the noradrenergic locus coeruleus (LC), histaminergic tuberomammillary nucleus (TMN), serotonergic dorsal raphe nucleus (DRN), dopaminergic ventral tegmental area (VTA), and the cholinergic basal forebrain [39]. In particular, the LC and TMN play key roles in the regulation of arousal and express almost exclusively OX₁R and OX₂R, respectively [37]. Dysfunctions in the orexin system therefore has the potential to cause sleep/wake disturbances. Since AD and type 1 narcolepsy share some common symptoms including sleep/wake fragmentation and excessive daytime sleepiness [4 , 10–21] (albeit not others such as cataplexy), it is of interest to determine whether a dysregulation of the orexin system occurs in the early stages of AD, as is currently being investigated in humans [40 –43]. Indeed, clinical evidence supports the concept that orexin signaling is altered in AD: CSF orexin levels are elevated [41 , 45] and negatively correlate with daytime somnolence [41]. Additionally, there is a reduced expression of OX₁R mRNA in the hippocampus of AD patients [46].

The characteristic lesions of AD are extracellular senile or neuritic plaques composed of aggregated amyloid-β peptides and intracellular neurofibrillary tangles comprised of hyperphosphorylated tau protein [47 –54]. Many preclinical studies have focused on the amyloid-β aspect of the bidirectional relationship between sleep and AD pathology [55 –58]; however, it is plausible that tau may also play a key role in this process. Patients with FTD exhibit sub-stantial sleep and circadian disturbances [6 , 9], which are similar to, and possibly even more severe than those experienced by AD patients [8]. Further-more, as with AD [41], orexin levels also negatively correlate with daytime somnolence in FTD [59]. Although FTD is genetically heterogeneous, one genetic variant (FTD-tau) [60] is caused by a mutat-ion in the tau gene (MAPT) located on chromosome 17 [61, 62]; sporadic tauopathy also exists in FTD. Furthermore, both tau transgenic mice and tau^–/– (knockout (KO)) mice show disrupted sleep/wake-fulness phenotypes [63, 64]. Together these data may point to a role of altered tau function and/or its negative neurobiological consequences in mediating sleep/wake disturbances in AD and FTD.

In light of these findings, the present study aimed to test whether manipulating tau affects the orexin system and thus may be implicated in the underlying mechanisms of sleep/wake dysregulation in both AD and FTD-tau. This study characterizes and quantifies ore-xin receptor mRNA expression and orexin neuronal counts in the brain of 1) rTg4510 mice which overex-press human tau harboring the FTD-associated P301L mutation, and 2) tau^–/– mice, using in situ hybri-dization (ISH) and immunohistochemistry (IHC) techniques, focusing in particular on brain regions associated with the regulation of sleep and wakefulness.

MATERIALS AND METHODS

Animals

This study used the rTg4510 transgenic mouse model of tauopathy [65, 66] and tau^–/– mice on a C57BL/6 background (ISH experiments) or 129SV/ BL6 background (IHC experiments) [67, 68].

rTg4510 mice were bred in house, as previously described [65, 66]. In brief, FBV/N mice expressing a form of human tau containing the MAPT P301L mutation (responsible for FTD-tau in humans) downstream of a tetracycline operon-responsive element were crossed with 129SVeV mice expressing a tetra-cycline-controlled transactivator under control of the Ca^2 +-calmodulin-dependent protein kinase II (CaMKII) promotor. In this mouse, constitutive expression of the tau transgene (in the absence of doxycycline) is specifically restricted to forebrain structures due to the CaMKII promotor.

Tau KO (tau^–/–) or wildtype (WT) (tau^+/+) mice as initially described in Dawson et al. [67] were bred in house as previously reported [68]. All mice were genotyped using a standardized polymerase chain reaction (PCR) assay for tail DNA (Transnetyx Inc., Cordova, TN, USA).

5.2-month-old male rTg4510 (n = 6) and WT (n =6) mice were used for ISH experiments, whereas 5.9–6.3-month-old male and female mice (n = 6 per genotype) were used for IHC experiments. We se-lected these ages as modified variants of tau and tangle-like inclusions have already begun to develop; however, advanced neurodegeneration and extensive neuronal or synaptic loss have yet to occur [65].

6-month-old tau^–/– (n = 5 males; n = 4 females) and tau^+/+ (n = 5 males; n = 3 females) mice were used in this study for ISH experiments and 8-month-old male mice (n = 6 per genotype) were used for IHC experiments. We selected these ages given the fragmented sleep [64] and olfactory deficit [69] phenotype manifested in these mice by these ages.

All mice were group-housed in standard transparent individually ventilated cages (29.5×16×13 cm) with sawdust and tissue paper nesting material. The holding room was under a 12 h light/dark cycle (lights on at 0700 h). Standard rodent food and water were available ad libitum. All experimentation was performed in accordance with the Prevention of Cruelty to Animals Act (2004), under the guidelines of the National Health and Medical Research Council Code of Practice for the Care and Use of Animals for Experimental Purposes in Australia (2013) and approved by The Florey Animal Ethics Committee (AEC number: 16-022). All efforts were made to minimize animal suffering.

Perfusion and brain collection

In situ hybridization

Mice were culled during the inactive phase (be-tween 1000–1600 h). All sample collection was per-formed under RNase-free conditions (all instruments and surfaces were pre-treated with RNase Zap®, Sigma-Aldrich). Mice were terminally anaesthetized with a lethal dose of sodium pentobarbitone (80 mg/ kg) and perfused with approximately 3 times their bl-ood volume (estimated as 7%of body weight) of 0.01 M phosphate-buffered saline (PBS) containing heparin (55.6 mg/L), immediately followed by the same volume of 4%paraformaldehyde (PFA). Brains were extracted and post-fixed in 4%PFA for 24 h at 4°C, washed (2×30 mins) in ice-cold 0.1%die-thylpyrocarbonate (DEPC)-treated PBS and then equilibrated in 30%(w/v) molecular grade sucrose in DEPC-treated PBS until the brains sunk (2-3 days). Brains were snap-frozen in isopentane cooled on dry ice and stored at –80°C until sectioning.

Immunohistochemistry

Mice were culled during the inactive phase (between 0940–1230 h). Mice were terminally anaesthetized and perfused as above. Brains were extracted and post-fixed in 4%PFA for 4 h at 4°C, washed (3×5 min) in ice-cold 0.1 M phosphate buffer (PB) and then stored in PB at 4°C until sectioning.

Cryosectioning

All brains were placed in a –20°C freezer the day before sectioning. 30μm-thick coronal sections of a 1 in 5 series (A⟶E) were cut through the brain (minus the olfactory bulbs) on a cryostat (Leica Microsystems, Wetzlar, Germany). Sections were mounted 12 sections per slide on positively charged Superfrost Ultra Plus glass slides (Thermo Scientific) and air-dried for at least 1-2 h at room temperature to ensure adequate adherence. Slides were then stored at –80°C, with desiccant, until ISH procedures. All cryosectioning was performed under RNase-free conditions.

Vibratome sectioning

Fixed brains were sectioned on a vibratome (Slicer HR2, Sigmann-Elektronik, Hüffenhardt, Germany). 100μm-thick sagittal sections were cut through the brain and collected in 24-well plates filled with PB. Anatomical markers (via The Mouse Brain in Stereotaxic Coordinates [70]) were used to identify the range of sections where orexin neurons are located (i.e., the LH). These sections (from approximately 1.5 mm lateral to 0.4 mm lateral) were selected for IHC experiments. Sections outside of this defined region were stained in consecutive rounds if microscopy revealed that the full extent of the appropriate region had not been captured. Staining was considered complete for each brain when the preceding section (more lateral) and succeeding section (more medial) did not contain any orexin neurons. Typically, n = 12–15 sections per brain, containing orexin neurons, were included.

In situ hybridization

Generation of digoxigenin (DIG) labelled cRNA probes

The forward and reverse primers used to amplify the mouse orexin receptor probe sequences were designed using Vector NTI® software (ThermoFisher Scientific) as previously described [71, 72].

Briefly, the Ensembl database was used to identify target sequences for the genes of interest (mHcrtr1 and mHcrtr2) and to design the forward and reverse primers. The primer sequences were as follows: mHcrtr1 forward primer: TGAACTCTACCCCAAGATCTATCACA; mHcrtr1 reverse primer: GAATTCTAATACGACTCACTATAGGGAGAGTGAATATGTCTGTGGGGACCTTT; mHcrtr2 forward primer: ATTCCCGGAACTTCTTCTGTGGTT; mHcrtr2 reverse primer: GAATTCTAATACGACTCACTATAGGGAGATGACATCTCACATCGAAGGCTTGA. Underlined sequences represent the T7 recognition sites located in the reverse primers.

All primers were initially made up to a 40μM stock solution in endotoxin free TE buffer (Invitrogen) and then diluted with molecular grade ultrapure water (Invitrogen) to a working solution of 2μM.

cDNA containing both the mHcrtr1 and mHcrtr2 sequences for the cRNA probes were generated from RNA extracted from the trigeminal ganglion of a C57BL/6 mouse using a Qiagen RNAEasy® kit (Chatsworth, CA, USA). RNA concentration and purity were determined using a Nanodrop 1000 Spectrophotometer. Reverse-transcription (RT) of RNA was performed using SuperScript® III (Invitrogen) acc-ording to the manufacturer’s instructions.

PCR was performed on a mixture containing PCR mastermix (5 Prime), the relevant forward primer, the relevant reverse primer, molecular grade ultrapure water and cDNA. Thermal cycler settings were as follows: 1 hold at 94°C (3 min) followed by 12 touchdown cycles of 94°C (40 s), 68–57°C (40 s, 1°C decrease per cycle), 72°C (90 s), then 35 cycles of 94°C (40 s), 56°C (40 s), 72°C (90 s), and finally holds of 72°C (10 min) and 12°C (∞).

The PCR product (containing the specific T7 polymerase promotor sequence) was used to generate the cRNA probes by in vitro transcription. Briefly, a master mix containing 1x transcription buffer (Roche), 10 mM Dithiothreitol (DTT; Sigma-Aldrich), DIG-RNA labelling mix (Roche), molecular grade ultrapure water, RNAse out (Invitrogen), the generated PCR templates and T7 RNA polymerase (Roche) was incubated at 37°C for 90 min. DNase (Roche) was then added to destroy the DNA template and the solution was incubated at 37°C for a further 7 min. The reaction was stopped with molecular grade 0.5 M ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich) and the nucleic acid precipitated with 8 M lithium chloride solution (Sigma-Aldrich). 70μl of 100%ethanol was then added and the solution stored at –20°C overnight. The following day probe mixtures were centrifuged at 21,000×g for 10 min at room temperature, the supernatant was discarded, and the pellet was re-suspended in 70%ethanol in ultrapure water. Following re-centrifugation at 21,000×g for 5 min at room temperature the supernatant was discarded, and the pellet allowed to air dry for 45 min. The pellet was suspended in ultrapure water and 100 mM DTT was added to a final concentration of 10 mM. To confirm generation of the cRNA probes, 5μl of solution was run in a 0.6%agarose gel for 12 mins at 70V and imaged on a Bio-Rad Chemi Doc™ MP imager (Hercules, CA, USA) coupled with Bio-Rad Image Lab™ software version-4.1. OX₁R and OX₂R cRNA probes were stored at –80°C until required.

ISH protocol

One slide from series B, C, and D and two from series E (due the small size of the LC brain structure located in this series) were allocated to hybridization with the OX₁R receptor probe from each mouse. One slide from series B, C, D, and E was allocated to hybridization with the OX₂R receptor probe. During workup of the ISH protocol and validation of the cRNA probes, several ‘no probe’ controls were also run. No detectable staining was observed (Fig. 1A–C).

Fig. 1

Representative sections hybridized with orexin receptor RNA probes. Coronal brain sections following in situ hybridization procedures hybridized with No probe (A-C); OX₁R RNA probe (D-F) or OX₂R RNA probe (G-I). The locus coeruleus (LC) expresses abundant OX₁R and is distinctly visible in F. CA1, CA1 subfield of hippocampus; CA2, CA2 subfield of hippocampus; CA3, CA3 subfield of hippocampus; CTX, cerebral cortex; DG, dentate gyrus; DRN, dorsal raphe nucleus; LC, locus coeruleus; LH, lateral hypothalamus; PVT, paraventricular nucleus of the thalamus; TMN, tuberomammillary nucleus.

All steps performed prior to hybridization of the cRNA probes were conducted under RNase-free conditions. Required slides were removed from –80°C storage and allowed to dry at room temperature for 1-2 h. Slides were placed in Hellendahl jars and washed (2×10 min) in DEPC-PBS then placed flat in slide boxes (Kartell Labware) filled with 50 ml of humidifying buffer containing 50%formamide (Sigma-Aldrich) and 1x salts solution. The OX₁R and OX₂R RNA probes were diluted (1:100) separately in hybridization buffer containing 50%formamide, 10%dextran sulphate (ThermoFisher Scientific), 1x salts solution, 1 mg/ml RNA from yeast (Sigma-Aldrich) and 1x Denhardt’s solution (Invitrogen) then heated in a water bath at 70°C for 20 min. 300μl of the relevant probe mixture were added to each slide, a coverslip was added and the lid of the slide box closed and sealed with masking tape. Sli-des were incubated overnight in an oven at 60°C to allow hybridization of the cRNA probe to the com-plimentary mRNA sequence of the respective ore-xin receptors. The following day the coverslips were detached via gravity and the slides washed (2×30 min) at 60°C in Hellendahl jars containing pre-heated (∼20 min) washing solution consisting of 1x saline sodium citrate (SSC), 50%formamide and 0.1%Tween-20 (Sigma-Aldrich). The slides were then washed (5×10 min) at room temperature on a rocker with 1x MABT solution (100 mM maleic acid (Sigma-Aldrich), 150 mM sodium chloride (Sigma-Aldrich), 0.1%Tween-20 (Sigma-Aldrich), pH 7.5). Slides were then incubated for 90 min at room temperature with blocking solution consisting of 2%Roche blocking reagent (Roche), 1x MABT and 20%inactivated sheep serum (Sigma-Al-drich). After blocking, the slides were incubated with Sheep anti-DIG-AP Fab fragments (Roche, Cat. No. 11093274910) in blocking solution (1:2000), overnight at 4°C in slide boxes containing water to allow binding to the DIG-labelled cRNA probe. The following day, excess antibody solution was re-moved, and the slides washed (5×10 min) in 1x MABT solution at room temperature on a rocker. This was followed by (2×10 min) washes with al-kaline phosphatase (AP) buffer consisting of 100 mM sodium chloride, 50 mM magnesium chloride, 100 mM Tris pH 9.5 and 0.1%Tween-20. Staining solution was prepared by dissolving 5%(w/v) Mo-wiol (polyvinylalcohol 4–88; Sigma-Aldrich) in AP buffer with heating and stirring and then adding 20μl/ml of nitro-blue tetrazolium/5-bromo-4-chloro-3’-indolyphosphate (NBT/BCIP; Roche). Slides were dried and positioned in slide boxes then 400μl of staining solution was added. The NBT/BCIP re-agent generates an intense purple/black precipitate when reacted with the AP-conjugated antibody. The reaction was allowed to proceed at room temperature and monitored using a dissection microscope every 30–60 min until sufficient staining had developed, typically 6–8 h. Excess solution was then removed and slides were washed (3×10 min) with PBS at room temperature on a rocker. Slides were air-dried and then mounted with Fluorescence Mounting Medium (DAKO), a coverslip added and then stored at 4°C in the dark until imaging.

Immunohistochemistry

Floating sections were blocked in 1 ml of PB containing 10%normal donkey serum (S-30, Merck Millipore) and 1.5%Triton-X-100 (T8787, Sigma Aldrich), while on an orbital shaker at room temperature (RT) for 3-4 h. Sections were then incubated with primary antibodies labelling orexin-A (C-19, sc-8070, raised in goat, 1:500; Santa Cruz Biotechnology), tyrosine hydroxylase (TH; ab112, raised in rabbit, 1:1000; Abcam), neuronal marker NeuN (ABN90, raised in guinea pig, 1:500; Sigma-Ald-rich) and phosphorylated tau (p-tau (rTg4510 mice and their WT controls only); Phospho-Tau (Thr231) monoclonal antibody (AT180), MN1040, raised in mouse, 1:1000; ThermoFisher Scientific) in 500 ml of PB containing 3%normal donkey serum and 1.5%Triton-X-100 and placed on an orbital shaker at 4°C for 42 h (up to 65 h for instances where the primary antibody cocktail was re-used). Sections were washed in PB (3×10 min) and incubated with secondary antibodies (DyLight™ 405 AffiniPure Donkey anti-guinea pig IgG (H + L); Jackson ImmunoResearch, Alexa Fluor® 488 Donkey anti-goat IgG (H + L) cross-adsorbed; ThermoFisher Scientific, Alexa Fl- uro® 594 AffiniPure F(ab’)₂ Fragment Donkey anti-mouse IgG (H + L); Jackson ImmunoResearch, Alexa Fluor® 647 AffiniPure F(ab’)₂ Fragment Donkey anti-rabbit IgG (H + L); Jackson ImmunoResearch; all at 1:500) for 2-3 h on an orbital shaker at RT. Sections were then mounted, a coverslip added and stored at –20°C until imaging.

Image acquisition and analysis

In situ hybridization

ISH-stained slides were scanned using a Pannoramic Scan II (3DHISTECH) digital slide scanner. Images were captured using Pannoramic Scanner version 1.22 SP software (3DHISTECH) and manually viewed using CaseViewer version 2.2 software (3DHISTECH) to determine appropriate sections for analysis. Once sections were assigned for quantitative analysis, the relevant images were exported as TIFF files using Pannoramic Viewer version 1.15.4 (3DHISTECH).

The brain regions analyzed included the cerebral cortex, DRN, hippocampus, LH, LC, paraventricular nucleus of the thalamus, TMN and the VTA (Fig. 1). 2-3 sections per brain region were selected for analysis using Fiji/ImageJ software [73] and mRNA receptor expression was quantified using custom written analysis scripts.

An investigator blinded to animal genotype and sex manually outlined the individual brain regions of interest (ROI) (see [74]) using the freehand region tool and the area and outline of the region was mea-sured and saved. A Gaussian blur (sigma = 2) was applied to the image and the background staining subtracted using a rolling ball subtraction (radius = 50). After background subtraction, positive staining was extracted from the image using the color deconvolution plugin built into Fiji/ImageJ and the extent of positive staining was thresholded using the IJ_IsoData auto threshold algorithm. The automatically set threshold value was then manually adjusted to closely match the intensity of staining on the section. The original image was positioned side by side with the thresholded image when setting the threshold value, for accuracy and consistency. Once the threshold was set, the ROIs were reloaded onto the image and the area of positive staining within the ROI was calculated. Therefore, the percentage of stain-positive pixels in a target region was determined and was considered a reliable estimate of the relative expression of OX₁R or OX₂R receptor mRNA. Typically, 2-4 + ROI replicates per brain region were used, taken from up to 3 different brain sections, and averaged together for the overall value specified for that brain region.

Immunohistochemistry

Images were acquired using a Leica SP8 confocal microscope and Leica Application Suite X (version 1.5.5.19976) with resonant scanner. Multiple tiles were scanned through the entire depth of each slice to capture all neurons for each region, and mosaic merged for counting.

Orexin neurons were counted using Imaris x64 software (version 9.3.1, Bitplane AG, Zurich, Swi-tzerland). For each image, ‘surface’ areas were created. Quality threshold, Volume and Sphericity were adjusted for each image so that all orexin neurons were covered by a surface. ‘Seed points diameter’ was enabled and set to 11.0. Due to their anatomy and brightness, the mislabeling of orexin fibers was common, but not evenly so throughout all sections, therefore all wrongly labeled fibers were manually deleted.

TH-labeled LC neurons were counted in 3D using SyGlass virtual reality software (Isto Visio Inc., Morgantown, WV, USA). The ROI tool was used to vis-ualize all densely packed neurons throughout the entire depth of the slice.

Statistical analysis

Statistical analyses were performed using the software package GraphPad Prism (Version 8.3.0 for Windows). Effects of sex or brain region hemisphere on expression of OX₁R or OX₂R were first analyzed by Student’s t-test to determine if any sex or hemisphere differences were evident. Percentage OX₁R or OX₂R mRNA expression were analyzed using Student’s t-test between genotypes (rTg4510 versus WT; or tau^–/– versus tau^+/+) for both receptors (OX₁R and OX₂R) and within each brain region. Total orexin and TH-positive neuron counts were analyzed using Student’s t-test between genotypes. Orexin neuron distribution in the LH were analyzed using a mixed-effects model (REML) with Sidak’s multiple comparisons test. For all analyses, p < 0.05 was considered to be statistically significant.

RESULTS

rTg4510 and tau^–/– mice do not exhibit brain hemisphere or sex differences in orexin receptor mRNA expression

There was no difference between brain hemispheres (Supplementary Figure 1) or sex (Supplementary Figure 2) in either the rTg4510 or tau^–/– strain, therefore averages across hemispheres were used and the data from the two sexes pooled for subsequent analyses. Representative images of ISH staining are shown in Fig. 1 and Supplementary Figure 3.

Decreased orexin receptor 1 mRNA expression in the locus coeruleus of rTg4510 mice

rTg4510 mice exhibited a decreased OX₁R mRNA expression in the LC compared with their WT controls (M_WT –M_rTg4510 = 11.47, t = 3.216, df = 9. p = 0.0105, Fig. 2A). rTg4510 mice also exhibited an increased OX₁R mRNA expression in the CA1 subfield of the hippocampus (M_WT –M_rTg4510 = –15.55, t = 3.260, df = 9, p = 0.0098, Fig. 2A). No statistically significant differences were observed in OX₁R mRNA expression between genotypes in any other brain region measured.

Fig. 2

Orexin receptor mRNA expression in the rTg4510 mouse brain. Percentage expression of OX₁R mRNA (A) and OX₂R mRNA (B) per brain region. Data are means±SEM. n = 4–6 per brain region. ^*p < 0.05, ^**p < 0.01 versus WT within brain region, by Student’s t-test. CA1, CA1 subfield of hippocampus; CA2, CA2 subfield of hippocampus; CA3, CA3 subfield of hippocampus; CTX, cerebral cortex; DG, dentate gyrus; DRN, dorsal raphe nucleus; LC, locus coeruleus; LH, lateral hypothalamus; PVT, paraventricular nucleus of the thalamus; TMN, tuberomammillary nucleus; VTA, ventral tegmental area.

OX₂R mRNA expression showed no difference between genotypes in any brain region (Fig. 2B).

Decreased orexin receptor 1 mRNA expression in the locus coeruleus of tau^–/– mice

Tau^–/– mice also exhibited decreased OX₁R mRNA expression in the LC compared with their respective tau^+/+ controls (M_WT –M_tauKO =10.76, t = 2.939, df = 14, p = 0.0108, Fig. 3A). No differences were observed in OX₁R mRNA expression between genotypes in any other brain region measured.

Fig. 3

Orexin receptor mRNA expression in the tau^–/– mouse brain. Percentage expression of OX₁R mRNA (A) and OX₂R mRNA (B) per brain region. Data are means±SEM. n = 7–9 per brain region. ^*p < 0.05 versus WT within brain region, by Student’s t-test. CA1, CA1 subfield of hippocampus; CA2, CA2 subfield of hippocampus; CA3, CA3 subfield of hippocampus; CTX, cerebral cortex; DG, dentate gyrus; DRN, dorsal raphe nucleus; LC, locus coeruleus; LH, lateral hypothalamus; PVT, paraventricular nucleus of the thalamus; TMN, tuberomammillary nucleus; VTA, ventral tegmental area.

Analogous to rTg4510 mice, no differences were observed in OX₂R mRNA expression between genotypes for any brain region measured (Fig. 3B).

Orexin neurons are similarly distributed throughout the lateral hypothalamus in rTg4510 and tau^–/– mice

Total orexin neuron counts in the LH were not sta-tistically different between rTg4510 and WT controls (M_WT - M_rTg4510 = –4.667, t = 0.07634, df = 9, p =0.9408, Fig. 4A) and were evenly distributed throu-ghout the LH (Fig. 4B).

Fig. 4

Orexin neuron counts in the lateral hypothalamus of rTg4510 and tau^–/– mice. Total orexin neuron counts (A) and orexin neuron distribution (B) in the lateral hypothalamus (LH) of rTg4510 mice; n = 5-6 per group. Total orexin neuron counts (C) and orexin neuron distribution (D) in the LH of tau^–/– mice. Data are means ± SEM. n = 6 per group.

Analogous to rTg4510 mice, no differences were observed in total orexin neuron counts in the LH of tau^–/– mice compared with their WT controls (M_WT –M_tauKO = 14.00, t = 0.1915, df = 10, p =0.852, Fig. 4C) and were similarly evenly distributed (Fig. 4D).

Phospho-tau staining was present in the hippocampus of rTg4510 mice, as expected (Fig. 5). Interestingly, although neuronal count did not differ between rTg4510 and WT mice, phospho-tau invasion into orexin positive neurons was also evident (Fig. 5), although invasion affected relatively few orexin neurons in the LH (Supplementary Figure 4).

Fig. 5

Representative images of phospho-tau immunohistochemistry in rTg4510 mice. Phosphorylated tau (AT180) is present in the rTg4510 hippocampus (B-B”’), lateral hypothalamus orexin (Ox) neurons (D-D”’) and locus coeruleus tyrosine hydroxylase (TH) neurons (F-F”’) but not in WT mice (A-A”’, C-C”’, E-E”’), respectively. Leica SP8 confocal, 40x oil lens, N.A. 1.30, scan format 1024×1024, zoom 2.5–3.55; scale bar 10μm.

rTg4510 and tau^–/– mice did not exhibit changes in TH-positive neuronal counts in the locus coeruleus

TH-positive neuronal counts were not statistically different between rTg4510 mice and their WT controls (M_WT - M_rTg4510 = –37.70, t = 0.2489, df = 9, p = 0.8091, Fig. 6A), nor between tau^–/– mice and their WT controls (M_WT –M_tauKO = –22.00, t = 0.2220, df = 9, P = 0.8293, Fig. 6B).

Fig. 6

TH-positive neuron counts in the locus coeruleus of rTg4510 and tau^–/– mice. Total TH-positive neuron counts in the locus coeruleus (LC) of rTg4510 (A) and tau^–/– (B) mice. Data are means±SEM. n = 5-6 per group.

Similar to rTg4510 LH orexin neurons, select LC TH neurons were positive for phospho-tau staining (Fig. 5). Again, the representation of affected neurons was relatively sparse (Supplementary Figure 4). Examination of these neurons showed predominantly cytoplasmic staining of varying extent (Supplementary Figure 5) and location, from expression in the cytoplasm nearest the axon hillock sparing some organelles, to invasion of the entire cytoplasm and altered cellular morphology (Fig. 5, Supplementary Figures 5, 6).

DISCUSSION

The aim of this study was to quantify orexin receptor mRNA levels and orexin neuron counts in the brain of rTg4510 and tau^–/– mice compared to their WT controls, with a particular focus on brain regions involved in the regulation of sleep and wakefulness. The principle finding was a similarly decreased OX₁R mRNA expression in the LC of both mouse strains investigated. An increased OX₁R mRNA expression was also observed in the CA1 hippocampal subfield in rTg4510 mice. Orexin and TH-positive neuronal counts were not altered between tau mutant mice and their respective WTs, thus the decreased OX₁R mRNA expression was likely not due to a loss of LC cells. Similar findings across both strains regarding orexin receptor expression raises interesting questions about the potential mechanisms by which altered tau function may be influencing the orexin system. Furthermore, given the critical role the LC plays in the regulation of sleep and wakefulness, these results suggest a process which could help to explain the sleep disturbances reported in AD and FTD.

In the present study, OX₁R mRNA expression in the LC was reduced in both rTg4510 and tau^–/– mice. The LC is a central node in the arousal pathway, a highly conserved network that promotes and maintains wakefulness [75] in humans and rodents. Wakefulness is promoted via the release of noradrenaline (NA), and over half of the brain NA and all neocortex NA comes from the LC [76, 77]. The LC is a critical effector of sleep-to-wake transitions [78 –80] and it receives particularly dense projections from orexinergic neurons of the LH [34]. A number of studies emphasise the functional integration of orexin and LC neurons in gating sleep/wake arousal states [78 , 81–83]. The present data therefore suggest that alterations in tau affect the relationship between the orexinergic and LC/noradrenergic components of the ascending arousal system at a molecular level.

These changes may be associated with previously described sleep/wake phenotypes in both tau transgenic and tau^–/– mice. The PS19 tau transgenic mouse, which harbors a similar tau mutation (P301S) to the rTg4510 mouse used here (P301L), exhibits a progressive hyperarousal phenotype [63]. Similarly, Cantero et al. [64] observed that tau^–/– mice also exhibit a hyperarousal phenotype, in addition to severe sleep fragmentation. We have also ascertained that rTg4510 mice, at the ages investigated in the present study, manifest a marked hyperarousal phenotype [84, 85]. In this regard, it is interesting to note that OX₁R KO mice also exhibit a mildly fragmented sleep/wake phenotype [86], whereas dual receptor KO mice exhibit a more severe narcoleptic/cataplectic phenotype [24]. This aligns with the alteration of OX₁R in the LC observed in the present study and with the sleep/wake disturbances reported in tau mutant strains. Proportional decreases in OX₁R mRNA expression of 25–30%of WT levels were observed in the LC in this experiment. Previous studies utilising siRNA demonstrate that even subtle reductions in mRNA expression (10–20%) can result in profound behavioural effects [87 –89], and suggest that the limited changes in receptor expression observed here may be contributing to the characteristic sleep/wake phenotypes of tau mutant mice. Furthermore, given the influence of orexin on arousal, the reported elevation in orexin CSF levels in AD [41 , 90], and the positive correlation between CSF orexin levels and total/phosphorylated tau levels in AD [41 , 92], it will be of interest to assess other aspects of the orexin system in tau transgenic and tau^–/– mice in the future.

The focal effect of OX₁R mRNA reduction in the LC is of particular interest since it has been amply demonstrated that the LC is selectively vulnerable in AD. Braak and colleagues suggest that the dev-elopment of tau pathology specifically affects brain regions involved in the regulation of sleep/wake-fulness first, particularly the LC [93, 94], and propose this precedes amyloid pathology by a considerable period in AD [52 , 95–97]. Pathological tau variants affecting these regions may thus contribute to sleep/wake disruptions in AD and FTD-tau patients. Al-though the two disorders share certain similarities [98 –100], it should, however, be noted that the neurodegenerative processes underlying AD and FTD-tau are not identical and further investigations into histopathological changes in orexinergic neurons of the LH, the LC and other components of the ascending reticular activating system (ARAS) in FTD-tau are warranted. Selective vulnerability of the LC to tau pathology has also been demonstrated in preclinical models. Iba et al. [101] inj-ected recombinant tau fibrils into the hippocampus or cortex/striatum of tau transgenic (P301S) mice. Immunohistochemical analysis showed time- and region-specific development of tau pathology throughout the brain, with the LC exhibiting rapid and advanced pathology despite being physically distant from the injection site [101]. In fact, tau pathology developed faster and was more advanced in the LC than at the injection site itself, demonstrating that the LC is particularly vulnerable to the progression of tau pathology. The present data further suggest that excitatory input to the LC, in the form of orexin, is modulated under conditions of altered tau.

The mechanism responsible for altering OX₁R expression in the LC in tau mutant mice in the present study has yet to be defined. Given the selective vulnerability of LC neurons [101], we hypothesised that tau invasion into the LC may be responsible for the decreased OX₁R mRNA expression in rTg4510 mice. To further investigate this, we performed IHC to assess orexin-positive neurons of the LH and TH-positive neurons in the LC of rTg4510 and tau^–/– mice. LC and LH neuronal counts were not altered between tau mutant and WT mice, indicating that the decrease in OX₁R mRNA expression was not simply due to the death of LC cells. Indeed, IHC confirmed that select rTg4510 LC and LH neurons were positive for phosphorylated human tau, indicating invasion of tau into the LC and LH from the forebrain-expressed transgene. The loss of LC neurons has been associated with AD pathology in both humans [102 –106] and rodent models [107 –109], and pertinently for this study, extended wakefulness/disrupted sleep has also been demonstrated to cause LC cell loss in WT mice [110, 111]. Nevertheless, the present data indicates that orexin receptor changes in the LC likely precedes these processes and may be related to the invasion of tau into LC and LH neurons.

Almost identical results were observed in the LC across the two strains investigated here. This is int-eresting given that tau pathology in the form of a toxic gain of function may contribute to the observed alterations in rTg4510 mice; however, the same mechanism cannot be proposed in the tau^–/– mice given the absence of tau. Tau hyperphosphorylation has been suggested to induce tau loss of function [112], an explanation which is compatible with the phenocopy of tau transgenic and tau^–/– mice in the present study, and indeed with the similar hyperarousal and fragmented sleep/wake phenotype between tau^–/– [64] and P301S mice [63]. Given the two distinct mouse models used in the current study, it appears that irrespective of the specific mechanism by which tau function is lost, the resulting phenotype is similar at both a functional (hyperarousal and sleep/wake fragmentation) and molecular (OX₁R expression) level.

An increase in OX₁R mRNA expression in the CA1 subfield of the hippocampus was also observed in rTg4510 mice but not in tau^–/– mice. Changes in hippocampal OX₁R have been reported in AD postmortem tissue using PCR methods, although specific subfields were not analyzed [46]. It is difficult to interpret these findings based solely on our present data and in the context of scarce literature regarding specific orexin receptor/system changes in the hippocampus in AD. In contrast to rTg4510 mice, no changes in the expression of OX₁R was observed in the CA1 subfield of tau^–/– mice. The reasons for this are not clear, although it should be noted that the two models are on different background strains, and thus may have contributed to this difference. Alternatively, it may be related to differences in the level of hippocampal function between the two tau mutants. Akbari et al. [113] found that antagonism of OX₁R in the CA1 subfield impaired spatial memory in rats, supporting a role for these receptors in hippocampal-learning. rTg4510 mice show hippocampal-dependent cognitive deficits at the age investigated in our study (∼6 months of age) [65 , 114], whereas tau^–/– mice do not [68, 115]. Hippocampal-dependent learning and memory deficits in tau^–/– mice are dependent on age and background strain. Tau^–/– mice, however, exhibit background-strain dependent hippocampal memory deficits only by 12 months of age [68]. It would therefore be of interest in future studies to assess CA1 OX₁R in tau^–/– mice when such deficits have manifested. Certainly, sleep-wake deficits and reduced LC OX₁R mRNA expression are concurrent in both transgenic and null mutation tau mutants at the ages investigated here.

In conclusion, we demonstrate here that rTg4510 and tau^–/– mice exhibit decreased OX₁R mRNA expression in the LC compared to WT controls, with IHC studies suggesting this is not simply due to a loss of LC cells. The similar findings across the two models suggest a comparable molecular mech-anism, which may relate to the loss of function of tau in both the KO and the rTg4510 model. The dif-ferences observed in the LC aligns with the current literature regarding the vulnerability of the LC and spread of tau pathology in AD. These findings sug-gest that tau mediates alterations of the interconn-ections between the orexinergic and LC/noradren-ergic systems which may underly changes in sleep/wakefulness in tauopathies. Given the LC’s crucial role in arousal regulation, our data offer an insight into how sleep/wake disturbances may manifest early during the progression of AD.

Footnotes

ACKNOWLEDGMENTS

The authors thank Andrew Lawrence, Sanjida Mir, Tina Carter, Leah Beauchamp, The Florey Advanced Microscopy and Immunohistochemistry Service, and the Imaging, FACS and Analysis Core (Monash Institute of Pharmaceutical Sciences) for expert technical assistance and advice. This work was funded by the Alzheimer’s Association Grant 2016-NIRG-396905 to LHJ and DH. The Florey Institute of Neuroscience and Mental Health acknowledge the support of the Victorian Government and in particular the funding from the Operational Infrastructure Support Grant.

Authors’ disclosures available online ().

The supplementary material is available in the electronic version of this article: .

References

Prinz

, Vitaliano

, Vitiello

, Bokan

, Raskind

, Peskind

, Gerber

(1982) Sleep, EEG and mental function changes in senile dementia of the Alzheimer type. Neurobiol Aging 3, 361–370.

Moran

, Lynch

, Walsh

, Coen

, Coakley

, Lawlor

(2005) Sleep disturbance in mild to moderate Alzheimer’s disease. Sleep Med 6, 347–352.

, Lucey

, Holtzman

(2014) Sleep and Alzheimer disease pathology–a bidirectional relationship. Nat Rev Neurol 10, 115–119.

Lim

, Gerstner

, Holtzman

(2014) The sleep-wake cycle and Alzheimer’s disease: What do we know? Neurodegener Dis Manag 4, 351–362.

Westerberg

, Mander

, Florczak

, Weintraub

, Mesulam

, Zee

, Paller

(2012) Concurrent impairments in sleep and memory in amnestic mild cognitive impairment. J Int Neuropsychol Soc 18, 490–500.

Anderson

, Hatfield

, Kipps

, Hastings

, Hodges

(2009) Disrupted sleep and circadian patterns in frontotemporal dementia. Eur J Neurol 16, 317–323.

Bathgate

, Snowden

, Varma

, Blackshaw

, Neary

(2001) Behaviour in frontotemporal dementia, Alzheimer’s disease and vascular dementia. Acta Neurol Scand 103, 367–378.

Bonakis

, Economou

, Paparrigopoulos

, Bonanni

, Maestri

, Carnicelli

, Di Coscio

, Ktonas

, Vagiakis

, Theodoropoulos

, Papageorgiou

(2014) Sleep in frontotemporal dementia is equally or possibly more disrupted, and at an earlier stage, when compared to sleep in Alzheimer’s disease. J Alzheimers Dis 38, 85–91.

Liu

, Miller

, Kramer

, Rankin

, Wyss-Coray

, Gearhart

, Phengrasamy

, Weiner

, Rosen

(2004) Behavioral disorders in the frontal and temporal variants of frontotemporal dementia. Neurology 62, 742–748.

10.

Crowley

(2011) Sleep and sleep disorders in older adults. Neuropsychol Rev 21, 41–53.

11.

Slats

, Claassen

, Verbeek

, Overeem

(2013) Reciprocal interactions between sleep, circadian rhythms and Alzheimer’s disease: Focus on the role of hypocretin and melatonin. Ageing Res Rev 12, 188–200.

12.

Peter-Derex

, Yammine

, Bastuji

, Croisile

(2015) Sleep and Alzheimer’s disease. Sleep Med Rev 19, 29–38.

13.

Musiek

, Xiong

, Holtzman

(2015) Sleep, circadian rhythms, and the pathogenesis of Alzheimer disease. Exp Mol Med 47, e148.

14.

Urrestarazu

, Iriarte

(2016) Clinical management of sleep disturbances in Alzheimer’s disease: Current and emerging strategies. Nat Sci Sleep 8, 21–33.

15.

Cagnin

, Fragiacomo

, Camporese

, Turco

, Busse

, Ermani

, Montagnese

(2017) Sleep-wake profile in dementia with Lewy bodies, Alzheimer’s disease, and normal aging. J Alzheimers Dis 55, 1529–1536.

16.

Bonanni

, Maestri

, Tognoni

, Fabbrini

, Nucciarone

, Manca

, Gori

, Iudice

, Murri

(2005) Daytime sleepiness in mild and moderate Alzheimer’s disease and its relationship with cognitive impairment. J Sleep Res 14, 311–317.

17.

Mignot

(1998) Genetic and familial aspects of narcolepsy. Neurology 50, S16–22.

18.

Siegel

, Boehmer

(2006) Narcolepsy and the hypocretin system–where motion meets emotion. Nat Clin Pract Neurol 2, 548–556.

19.

Sakurai

(2007) The neural circuit of orexin (hypocretin): Maintaining sleep and wakefulness. Nat Rev Neurosci 8, 171–181.

20.

Scammell

(2015) Narcolepsy. N Engl J Med 373, 2654–2662.

21.

Kornum

, Knudsen

, Ollila

, Pizza

, Jennum

, Dauvilliers

, Overeem

(2017) Narcolepsy. Nat Rev Dis Primers 3, 16100.

22.

Chemelli

, Willie

, Sinton

, Elmquist

, Scammell

, Lee

, Richardson

, Williams

, Xiong

, Kisanuki

, Fitch

, Nakazato

, Hammer

, Saper

, Yanagisawa

(1999) Narcolepsy in orexin knockout mice: Molecular genetics of sleep regulation. Cell 98, 437–451.

23.

Kalogiannis

, Hsu

, Willie

, Chemelli

, Kisanuki

, Yanagisawa

, Leonard

(2011) Cholinergic modulation of narcoleptic attacks in double orexin receptor knockout mice. PLoS One 6, e18697.

24.

Willie

, Chemelli

, Sinton

, Tokita

, Williams

, Kisanuki

, Marcus

, Lee

, Elmquist

, Kohlmeier

, Leonard

, Richardson

, Hammer

, Yanagisawa

(2003) Distinct Narcolepsy syndromes in Orexin receptor-2 and Orexin null mice: Molecular genetic dissection of Non-REM and REM sleep regulatory processes. Neuron 38, 715–730.

25.

Bernard-Valnet

, Yshii

, Queriault

, Nguyen

, Arthaud

, Rodrigues

, Canivet

, Morel

, Matthys

, Bauer

, Pignolet

, Dauvilliers

, Peyron

, Liblau

(2016) CD8 T cell-mediated killing of orexinergic neurons induces a Narcolepsy-like phenotype in mice. Proc Natl Acad Sci U S A 113, 10956–10961.

26.

Beuckmann

, Sinton

, Williams

, Richardson

, Hammer

, Sakurai

, Yanagisawa

(2004) Expression of a poly-glutamine-ataxin-3 transgene in orexin neurons induces Narcolepsy-cataplexy in the rat. J Neurosci 24, 4469–4477.

27.

Branch

, Navidi

, Tabuchi

, Terao

, Yamanaka

, Scammell

, Diniz Behn

(2016) Progressive loss of the orexin neurons reveals dual effects on wakefulness. Sleep 39, 369–377.

28.

Hara

, Beuckmann

, Nambu

, Willie

, Chemelli

, Sinton

, Sugiyama

, Yagami

, Goto

, Yanagisawa

, Sakurai

(2001) Genetic ablation of orexin neurons in mice results in Narcolepsy, hypophagia, and obesity. Neuron 30, 345–354.

29.

Tabuchi

, Tsunematsu

, Black

, Tominaga

, Maruyama

, Takagi

, Minokoshi

, Sakurai

, Kilduff

, Yamanaka

(2014) Conditional ablation of orexin/hypocretin neurons: A new mouse model for the study of Narcolepsy and orexin system function. J Neurosci 34, 6495–6509.

30.

de Lecea

, Kilduff

, Peyron

, Gao

, Foye

, Danielson

, Fukuhara

, Battenberg

, Gautvik

, Bartlett

, 2nd, Frankel

, van den Pol

, Bloom

, Gautvik

, Sutcliffe

(1998) The hypocretins: Hypothalamus-specific peptides with neuroexcitatory activity. Proc Natl Acad Sci U S A 95, 322–327.

31.

Sakurai

, Amemiya

, Ishii

, Matsuzaki

, Chemelli

, Tanaka

, Williams

, Richardson

, Kozlowski

, Wilson

, Arch

, Buckingham

, Haynes

, Carr

, Annan

, McNulty

, Liu

, Terrett

, Elshourbagy

, Bergsma

, Yanagisawa

(1998) Orexins and orexin receptors: A family of hypothalamic neuropeptides and G protein-coupled receptors that regulate feeding behavior. Cell 92, 573–585.

32.

Sutcliffe

, de Lecea

(2002) The hypocretins: Setting the arousal threshold. Nat Rev Neurosci 3, 339–349.

33.

Hoyer

, Jacobson

(2013) Orexin in sleep, addiction and more: Is the perfect insomnia drug at hand? Neuropeptides 47, 477–488.

34.

Peyron

, Tighe

, van den Pol

, de Lecea

, Heller

, Sutcliffe

, Kilduff

(1998) Neurons containing hypocretin (orexin) project to multiple neuronal systems. J Neurosci 18, 9996–10015.

35.

van den Pol

, Gao

, Obrietan

, Kilduff

, Belousov

(1998) Presynaptic and postsynaptic actions and modulation of neuroendocrine neurons by a new hypothalamic peptide, hypocretin/orexin. J Neurosci 18, 7962–7971.

36.

Nambu

, Sakurai

, Mizukami

, Hosoya

, Yanagisawa

, Goto

(1999) Distribution of orexin neurons in the adult rat brain. Brain Res 827, 243–260.

37.

Marcus

, Aschkenasi

, Lee

, Chemelli

, Saper

, Yanagisawa

, Elmquist

(2001) Differential expression of orexin receptors 1 and 2 in the rat brain. J Comp Neurol 435, 6–25.

38.

Jacobson

, Chen

, Mir

, Hoyer

(2017) Orexin OX2 receptor antagonists as sleep aids. Curr Top Behav Neurosci 33, 105–136.

39.

Saper

, Fuller

, Pedersen

, Lu

, Scammell

(2010) Sleep state switching. Neuron 68, 1023–1042.

40.

Liguori

, Chiaravalloti

, Nuccetelli

, Izzi

, Sancesario

, Cimini

, Bernardini

, Schillaci

, Mercuri

, Fabio

(2017) Hypothalamic dysfunction is related to sleep impairment and CSF biomarkers in Alzheimer’s disease. J Neurol 264, 2215–2223.

41.

Liguori

, Romigi

, Nuccetelli

, Zannino

, Sancesario

, Martorana

, Albanese

, Mercuri

, Izzi

, Bernardini

, Nitti

, Sancesario

, Sica

, Marciani

, Placidi

(2014) Orexinergic system dysregulation, sleep impairment, and cognitive decline in Alzheimer disease. JAMA Neurol 71, 1498–1505.

42.

Liguori

, Spanetta

, Izzi

, Franchini

, Nuccetelli

, Sancesario

, Di Santo

, Bernardini

, Mercuri

, Placidi

(2020) Sleep-wake cycle in Alzheimer’s disease is associated with tau pathology and orexin dysregulation. J Alzheimers Dis 74, 501–508.

43.

Friedman

, Zeitzer

, Lin

, Hoff

, Mignot

, Peskind

, Yesavage

(2007) In Alzheimer disease, increased wake fragmentation found in those with lower hypocretin-1. Neurology 68, 793–794.

44.

Liguori

, Nuccetelli

, Izzi

, Sancesario

, Romigi

, Martorana

, Amoroso

, Bernardini

, Marciani

, Mercuri

, Placidi

(2016) Rapid eye movement sleep disruption and sleep fragmentation are associated with increased orexin-A cerebrospinal-fluid levels in mild cognitive impairment due to Alzheimer’s disease. Neurobiol Aging 40, 120–126.

45.

Gabelle

, Jaussent

, Hirtz

, Vialaret

, Navucet

, Grasselli

, Robert

, Lehmann

, Dauvilliers

(2017) Cerebrospinal fluid levels of orexin-A and histamine, and sleep profile within the Alzheimer process. Neurobiol Aging 53, 59–66.

46.

Davies

, Chen

, Pink

, Carter

, Saunders

, Sotiriadis

, Bai

, Pan

, Howlett

, Payne

, Randeva

, Karteris

(2015) Orexin receptors exert a neuroprotective effect in Alzheimer’s disease (AD) via heterodimerization with GPR103. Sci Rep 5, 12584.

47.

Dickson

(1997) The pathogenesis of senile plaques. J Neuropathol Exp Neurol 56, 321–339.

48.

Selkoe

(1997) Neuroscience - Alzheimer’s disease: Genotypes, phenotype, and treatments. Science 275, 630–631.

49.

Selkoe

(2001) Alzheimer’s disease: Genes, proteins, and therapy. Physiol Rev 81, 741–766.

50.

Blennow

, de Leon

, Zetterberg

(2006) Alzheimer’s disease. Lancet 368, 387–403.

51.

Ballard

, Gauthier

, Corbett

, Brayne

, Aarsland

, Jones

(2011) Alzheimer’s disease. Lancet 377, 1019–1031.

52.

Braak

, Braak

(1991) Neuropathological staging of Alzheimer-related changes. Acta Neuropathol 82, 239–259.

53.

Holtzman

, Morris

, Goate

(2011) Alzheimer’s disease: The challenge of the second century. Sci Transl Med 3, 77sr71.

54.

Querfurth

, LaFerla

(2010) Alzheimer’s disease. N Engl J Med 362, 329–344.

55.

Bero

, Yan

, Roh

, Cirrito

, Stewart

, Raichle

, Lee

, Holtzman

(2011) Neuronal activity regulates the regional vulnerability to amyloid-beta deposition. Nat Neurosci 14, 750–756.

56.

Cirrito

, Yamada

, Finn

, Sloviter

, Bales

, May

, Schoepp

, Paul

, Mennerick

, Holtzman

(2005) Synaptic activity regulates interstitial fluid amyloid-beta levels in vivo. Neuron 48, 913–922.

57.

Kang

, Lim

, Bateman

, Lee

, Smyth

, Cirrito

, Fujiki

, Nishino

, Holtzman

(2009) Amyloid-beta dynamics are regulated by orexin and the sleep-wake cycle. Science 326, 1005–1007.

58.

Roh

, Huang

, Bero

, Kasten

, Stewart

, Bateman

, Holtzman

(2012) Disruption of the sleep-wake cycle and diurnal fluctuation of beta-amyloid in mice with Alzheimer’s disease pathology. Sci Transl Med 4, 150ra122.

59.

Liguori

, Romigi

, Mercuri

, Nuccetelli

, Izzi

, Albanese

, Sancesario

, Martorana

, Sancesario

, Bernardini

, Marciani

, Placidi

(2014) Cerebrospinal-fluid orexin levels and daytime somnolence in frontotemporal dementia. J Neurol 261, 1832–1836.

60.

Forrest

, Kril

, Stevens

, Kwok

, Hallupp

, Kim

, Huang

, McGinley

, Werka

, Kiernan

, Gotz

, Spillantini

, Hodges

, Ittner

, Halliday

(2018) Retiring the term FTDP-17 as MAPT mutations are genetic forms of sporadic frontotemporal tauopathies. Brain 141, 521–534.

61.

Hutton

, Lendon

, Rizzu

, Baker

, Froelich

, Houlden

, Pickering-Brown

, Chakraverty

, Isaacs

, Grover

, Hackett

, Adamson

, Lincoln

, Dickson

, Davies

, Petersen

, Stevens

, de Graaff

, Wauters

, van Baren

, Hillebrand

, Joosse

, Kwon

, Nowotny

, Che

, Norton

, Morris

, Reed

, Trojanowski

, Basun

, Lannfelt

, Neystat

, Fahn

, Dark

, Tannenberg

, Dodd

, Hayward

, Kwok

, Schofield

, Andreadis

, Snowden

, Craufurd

, Neary

, Owen

, Oostra

, Hardy

, Goate

, van Swieten

, Mann

, Lynch

, Heutink

(1998) Association of missense and 5’-splice-site mutations in tau with the inherited dementia FTDP-17. Nature 393, 702–705.

62.

Goedert

, Spillantini

(2006) A century of Alzheimer’s disease. Science 314, 777–781.

63.

Holth

, Mahan

, Robinson

, Rocha

, Holtzman

(2017) Altered sleep and EEG power in the P301S Tau transgenic mouse model. Ann Clin Transl Neurol 4, 180–190.

64.

Cantero

, Hita-Yanez

, Moreno-Lopez

, Portillo

, Rubio

, Avila

(2010) Tau protein role in sleep-wake cycle. J Alzheimers Dis 21, 411–421.

65.

Ramsden

, Kotilinek

, Forster

, Paulson

, McGowan

, SantaCruz

, Guimaraes

, Yue

, Lewis

, Carlson

, Hutton

, Ashe

(2005) Age-dependent neurofibrillary tangle formation, neuron loss, and memory impairment in a mouse model of human tauopathy (P301L). J Neurosci 25, 10637–10647.

66.

Santacruz

, Lewis

, Spires

, Paulson

, Kotilinek

, Ingelsson

, Guimaraes

, DeTure

, Ramsden

, McGowan

, Forster

, Yue

, Orne

, Janus

, Mariash

, Kuskowski

, Hyman

, Hutton

, Ashe

(2005) Tau suppression in a neurodegenerative mouse model improves memory function. Science 309, 476–481.

67.

Dawson

, Ferreira

, Eyster

, Ghoshal

, Binder

, Vitek

(2001) Inhibition of neuronal maturation in primary hippocampal neurons from tau deficient mice. J Cell Sci 114, 1179–1187.

68.

Lei

, Ayton

, Moon

, Zhang

, Volitakis

, Finkelstein

, Bush

(2014) Motor and cognitive deficits in aged tau knockout mice in two background strains. Mol Neurodegener 9, 12.

69.

Beauchamp

, Chan

, Hung

, Padman

, Vella

, Liu

, Coleman

, Bush

, Lazarou

, Hill

, Jacobson

, Barnham

(2018) Ablation of tau causes an olfactory deficit in a murine model of Parkinson’s disease. Acta Neuropathol Commun 6, 57.

70.

Paxinos

, Franklin

KBJ

(1997) The mouse brain in stereotaxic coordinates, Academic Press, San Diego, CA.

71.

Bron

, Wood

, Brock

, Ivanusic

(2014) Piezo2 expression in corneal afferent neurons. J Comp Neurol 522, 2967–2979.

72.

Bron

, Yin

, Russo

, Furness

(2013) Expression of the ghrelin receptor gene in neurons of the medulla oblongata of the rat. J Comp Neurol 521, 2680–2702.

73.

Schindelin

, Arganda-Carreras

, Frise

, Kaynig

, Longair

, Pietzsch

, Preibisch

, Rueden

, Saalfeld

, Schmid

, Tinevez

, White

, Hartenstein

, Eliceiri

, Tomancak

, Cardona

(2012) Fiji: An open-source platform for biological-image analysis. Nat Methods 9, 676–682.

74.

Lazic

(2009) Statistical evaluation of methods for quantifying gene expression by autoradiography in histological sections. BMC Neurosci 10, 5.

75.

Saper

, Scammell

, Lu

(2005) Hypothalamic regulation of sleep and circadian rhythms. Nature 437, 1257–1263.

76.

de Lecea

, Carter

, Adamantidis

(2012) Shining light on wakefulness and arousal. Biol Psychiatry 71, 1046–1052.

77.

Valentino

, Van Bockstaele

(2008) Convergent regulation of locus coeruleus activity as an adaptive response to stress. Eur J Pharmacol 583, 194–203.

78.

Carter

, Brill

, Bonnavion

, Huguenard

, Huerta

, de Lecea

(2012) Mechanism for hypocretin-mediated sleep-to-wake transitions. Proc Natl Acad Sci U S A 109, E2635–2644.

79.

Yamaguchi

, Hopf

, Li

, de Lecea

(2018) In vivocell type-specific CRISPR knockdown of dopamine beta hydroxylase reduces locus coeruleus evoked wakefulness. Nat Commun 9, 8.

80.

Carter

, Yizhar

, Chikahisa

, Nguyen

, Adamantidis

, Nishino

, Deisseroth

, de Lecea

(2010) Tuning arousal with optogenetic modulation of locus coeruleus neurons. Nat Neurosci 13, 1526–1533.

81.

Hagan

, Leslie

, Patel

, Evans

, Wattam

, Holmes

, Benham

, Taylor

, Routledge

, Hemmati

, Munton

, Ashmeade

, Shah

, Hatcher

, Jones

, Smith

, Piper

, Hunter

, Porter

, Upton

(1999) Orexin A activates locus coeruleus cell firing and increases arousal in the rat. Proc Natl Acad Sci U S A 96, 10911–10916.

82.

Horvath

, Peyron

, Diano

, Ivanov

, Aston-Jones

, Kilduff

, van Den Pol

(1999) Hypocretin (orexin) activation and synaptic innervation of the locus coeruleus noradrenergic system. J Comp Neurol 415, 145–159.

83.

Gompf

, Aston-Jones

(2008) Role of orexin input in the diurnal rhythm of locus coeruleus impulse activity. Brain Res 1224, 43–52.

84.

Keenan

, Daykin

, Wright

, Barnham

, Allocca

, Hoyer

, Jacobson

(2018) The effect of human mutant tau on cognition and sleep in the rTg4510 mouse model of tauopathy. Soc Neurosci Abstr, Program No. 048.10.

85.

Keenan

, Cornthwaite-Duncan

, Daykin

, Oberrauch

, Brian

, Metha

, Barnham

, Allocca

, Hoyer

, Jacobson

(2019) Orexin receptor antagonistinduced effects on sleep, cognition and tau pathology in the rTg4510 mouse model of tauopathy. Soc Neurosci Abstr, Program No. 538.05.

86.

Willie

, Chemelli

, Sinton

, Yanagisawa

(2001) To eat or to sleep? Orexin in the regulation of feeding and wakefulness. Annu Rev Neurosci 24, 429–458.

87.

Thakker

, Natt

, Husken

, van der Putten

, Maier

, Hoyer

, Cryan

(2005) siRNA-mediated knockdown of the serotonin transporter in the adult mouse brain. Mol Psychiatry 10, 782–789, 714.

88.

O’Connor

, Thakker

, Schmutz

, van der Putten

, Hoyer

, Flor

, Cryan

(2013) Adult siRNA-induced knockdown of mGlu7 receptors reduces anxiety in the mouse. Neuropharmacology 72, 66–73.

89.

Hoyer

, Thakker

, Natt

, Maier

, Huesken

, Muller

, Flor

, H

VDP

, Schmutz

, Bilbe

, Cryan

(2006) Global down-regulation of gene expression in the brain using RNA interference, with emphasis on monoamine transporters and GPCRs: Implications for target characterization in psychiatric and neurological disorders. J Recept Signal Transduct Res 26, 527–547.

90.

Dauvilliers

, Lehmann

, Jaussent

, Gabelle

(2014) Hypocretin and brain beta-amyloid peptide interactions in cognitive disorders and Narcolepsy. Front Aging Neurosci 6, 119.

91.

Deuschle

, Schilling

, Leweke

, Enning

, Pollmacher

, Esselmann

, Wiltfang

, Frolich

, Heuser

(2014) Hypocretin in cerebrospinal fluid is positively correlated with Tau and pTau. Neurosci Lett 561, 41–45.

92.

Osorio

, Ducca

, Wohlleber

, Tanzi

, Gumb

, Twumasi

, Tweardy

, Lewis

, Fischer

, Koushyk

, Cuartero-Toledo

, Sheikh

, Pirraglia

, Zetterberg

, Blennow

, Lu

, Mosconi

, Glodzik

, Schuetz

, Varga

, Ayappa

, Rapoport

, de Leon

(2016) Orexin-A is associated with increases in cerebrospinal fluid phosphorylated-tau in cognitively normal elderly subjects. Sleep 39, 1253–1260.

93.

Braak

, Del Tredici

(2015) The preclinical phase of the pathological process underlying sporadic Alzheimer’s disease. Brain 138, 2814–2833.

94.

Stratmann

, Heinsen

, Korf

, Del Turco

, Ghebremedhin

, Seidel

, Bouzrou

, Grinberg

, Bohl

, Wharton

, den Dunnen

, Rub

(2016) Precortical phase of Alzheimer’s disease (AD)-related tau cytoskeletal pathology. Brain Pathol 26, 371–386.

95.

Braak

, Alafuzoff

, Arzberger

, Kretzschmar

, Del Tredici

(2006) Staging of Alzheimer disease-associated neurofibrillary pathology using paraffin sections and immunocytochemistry. Acta Neuropathol 112, 389–404.

96.

Braak

, Braak

(1995) Staging of Alzheimer’s disease-related neurofibrillary changes. Neurobiol Aging 16, 271–278.

97.

Braak

, Thal

, Ghebremedhin

, Del Tredici

(2011) Stages of the pathologic process in Alzheimer disease: Age categories from 1 to 100 years. J Neuropathol Exp Neurol 70, 960–969.

98.

Ballatore

, Lee

, Trojanowski

(2007) Tau-mediated neurodegeneration in Alzheimer’s disease and related disorders. Nat Rev Neurosci 8, 663–672.

99.

Goedert

, Ghetti

, Spillantini

(2012) Frontotemporal dementia: Implications for understanding Alzheimer disease. Cold Spring Harb Perspect Med 2, a006254.

100.

Spillantini

, Goedert

(2013) Tau pathology and neurodegeneration. Lancet Neurol 12, 609–622.

101.

Iba

, Guo

, McBride

, Zhang

, Trojanowski

, Lee

(2013) Synthetic tau fibrils mediate transmission of neurofibrillary tangles in a transgenic mouse model of Alzheimer’s-like tauopathy. J Neurosci 33, 1024–1037.

102.

Bondareff

, Mountjoy

, Roth

(1982) Loss of neurons of origin of the adrenergic projection to cerebral cortex (nucleus locus ceruleus) in senile dementia. Neurology 32, 164–168.

103.

Bondareff

, Mountjoy

, Roth

, Rossor

, Iversen

, Reynolds

, Hauser

(1987) Neuronal degeneration in locus ceruleus and cortical correlates of Alzheimer disease. Alzheimer Dis Assoc Disord 1, 256–262.

104.

German

, Manaye

, White

, 3rd, Woodward

, McIntire

, Smith

, Kalaria

, Mann

(1992) Disease-specific patterns of locus coeruleus cell loss. Ann Neurol 32, 667–676.

105.

German

, White

, Sparkman

(1987) Alzheimer’s disease: Neurofibrillary tangles in nuclei that project to the cerebral cortex. Neuroscience 21, 305–312.

106.

Manaye

, McIntire

, Mann

, German

(1995) Locus coeruleus cell loss in the aging human brain: A non-random process. J Comp Neurol 358, 79–87.

107.

Manaye

, Mouton

, Xu

, Drew

, Lei

, Sharma

, Rebeck

, Turner

(2013) Age-related loss of noradrenergic neurons in the brains of triple transgenic mice. Age (Dordr) 35, 139–147.

108.

O’Neil

, Mouton

, Tizabi

, Ottinger

, Lei

, Ingram

, Manaye

(2007) Catecholaminergic neuronal loss in locus coeruleus of aged female dtg APP/PS1 mice. J Chem Neuroanat 34, 102–107.

109.

Liu

, Yoo

, Savonenko

, Stirling

, Price

, Borchelt

, Mamounas

, Lyons

, Blue

, Lee

(2008) Amyloid pathology is associated with progressive monoaminergic neurodegeneration in a transgenic mouse model of Alzheimer’s disease. J Neurosci 28, 13805–13814.

110.

Zhang

, Zhu

, Zhan

, Fenik

, Panossian

, Wang

, Reid

, Lai

, Davis

, Baur

, Veasey

(2014) Extended wakefulness: Compromised metabolics in and degeneration of locus ceruleus neurons. J Neurosci 34, 4418–4431.

111.

Zhu

, Fenik

, Zhan

, Somach

, Xin

, Veasey

(2016) Intermittent short sleep results in lasting sleep wake disturbances and degeneration of locus coeruleus and orexinergic neurons. Sleep 39, 1601–1611.

112.

Iqbal

, Alonso Adel

, Chen

, Chohan

, El-Akkad

, Gong

, Khatoon

, Li

, Liu

, Rahman

, Tanimukai

, Grundke-Iqbal

(2005) Tau pathology in Alzheimer disease and other tauopathies. Biochim Biophys Acta 1739, 198–210.

113.

Akbari

, Naghdi

, Motamedi

(2006) Functional inactivation of orexin 1 receptors in CA1 region impairs acquisition, consolidation and retrieval in Morris water maze task. Behav Brain Res 173, 47–52.

114.

Blackmore

, Meftah

, Murray

, Craig

, Blockeel

, Phillips

, Eastwood

, O’Neill

, Marston

, Ahmed

, Gilmour

, Gastambide

(2017) Tracking progressive pathological and functional decline in the rTg4510 mouse model of tauopathy. Alzheimers Res Ther 9, 77.

115.

Morris

, Hamto

, Adame

, Devidze

, Masliah

, Mucke

(2013) Age-appropriate cognition and subtle dopamine-independent motor deficits in aged tau knockout mice. Neurobiol Aging 34, 1523–1529.

Decreased Orexin Receptor 1 mRNA Expression in the Locus Coeruleus in Both Tau Transgenic rTg4510 and Tau Knockout Mice and Accompanying Ascending Arousal System Tau Invasion in rTg4510

Abstract

Background:

Objective:

Methods:

Results:

Conclusion:

Keywords

INTRODUCTION

MATERIALS AND METHODS

Animals

Perfusion and brain collection

In situ hybridization

Immunohistochemistry

Cryosectioning

Vibratome sectioning

In situ hybridization

Generation of digoxigenin (DIG) labelled cRNA probes

ISH protocol

Immunohistochemistry

Image acquisition and analysis

In situ hybridization

Immunohistochemistry

Statistical analysis

RESULTS

rTg4510 and tau–/– mice do not exhibit brain hemisphere or sex differences in orexin receptor mRNA expression

Decreased orexin receptor 1 mRNA expression in the locus coeruleus of rTg4510 mice

Decreased orexin receptor 1 mRNA expression in the locus coeruleus of tau–/– mice

Orexin neurons are similarly distributed throughout the lateral hypothalamus in rTg4510 and tau–/– mice

rTg4510 and tau–/– mice did not exhibit changes in TH-positive neuronal counts in the locus coeruleus

DISCUSSION

Footnotes

ACKNOWLEDGMENTS

References

rTg4510 and tau^–/– mice do not exhibit brain hemisphere or sex differences in orexin receptor mRNA expression

Decreased orexin receptor 1 mRNA expression in the locus coeruleus of tau^–/– mice

Orexin neurons are similarly distributed throughout the lateral hypothalamus in rTg4510 and tau^–/– mice

rTg4510 and tau^–/– mice did not exhibit changes in TH-positive neuronal counts in the locus coeruleus