Synthesis of Novel Magnetic Quercetin-Neuropeptide Nanocomposite as a Smart Nano-Drug Shuttle System: Investigation of Its Effect on Behavior,Histopathological Characteristics,and Expression of MAPT and APP Genes in Alzheimer’s Disease Rats

Abstract

Background:

Alzheimer’s disease (AD) is the most common type of dementia. The drugs introduced for this disease have many side effects and limitations in use, so the production of a suitable herbal medicine to cure AD patients is essential.

Objective:

The aim of this research is to make a magnetic neuropeptide nano shuttle as a targeted carrier for the transfer of quercetin to the brains of AD model rats.

Methods:

In this work, a magnetic quercetin-neuropeptide nanocomposite (MQNPN) was fabricated and administered to the rat’s brain by the shuttle drug of the Margatoxin scorpion venom neuropeptide, and will be a prospect for targeted drug delivery in AD. The MQNPN has been characterized by FTIR, spectroscopy, FE-SEM, XRD, and VSM. Investigations into the efficacy of MQNPN, MTT, and real Time PCR for MAPT and APP genes expression were performed. After 7 days treatment with Fe₃O₄ (Ctr) and MQNPN treatment in AD rat, superoxide dismutase activity and quercetin in blood serum and brain was detected. Hematoxylin-Eosin staining was applied for histopathological analysis.

Results:

Analysis of data showed that MQNPN increased the activity of superoxide dismutase. The histopathology results of the hippocampal region of AD rats also confirmed their improvement after treatment with MQNPN. MQNPN treatment caused a significant decrease in the relative expression of MAPT and APP genes.

Conclusion:

MQNPN is a suitable carrier for the transfer of quercetin to the rat hippocampus, and has a significant effect in reducing AD symptoms in terms of histopathology, behavioral testing, and changing the expression of AD-related genes.

Keywords

Alzheimer’s disease nano-drug shuttle system nanocomposite neuropeptide quercetin

INTRODUCTION

According to the latest statistics published by the World Health Organization (WHO), dementia is currently the seventh leading cause of death among all diseases and one of the significant causes of disability and dependency among older people globally [1]. Accordingly, today there is a great need to recognize the different dimensions of Alzheimer’s disease (AD) and its effective treatment, and much attention has been paid to natural substances of plant origin to treat this disease. Due to its antioxidant properties, quercetin can help reduce the symptoms and improve AD. Despite its many medicinal properties, quercetin has low bioavailability on account of its poor solubility in water and rapid metabolism, and its lack of targeted transfer limits its use [2 –5]. Today, nano synthesis techniques can be very helpful in solving this problem. The most fundamental problem in the treatment or detection of diseases of the central nervous system is the passage of drugs or contrast agents through the blood-brain barrier, due to the strong connections of endothelial cells in the capillaries of the brain. Using nanotechnology knowledge, methods, and related tools in the development of treatments of neurological disorders are promising [6 –10]. Therefore, to deliver drugs to the central nervous system, using scorpion venom neurotoxins as carriers and carriers along with constructing quercetin and shuttle drug composites can be of great importance [11].

Animal and human streptozotocin is used to model AD in rats [12]. Studies have shown that streptozotocin injection causes the production of flavonoids, the most well-known group of phenolic compounds with strong antioxidant activity found in fruits, vegetables, and other foods [13 –15]. The most common flavonoid found in nature appears in many natural foods such as apples, tea, berries, and onions as glycine or carbohydrates [16]. Quercetin is a polyphenol belonging to this class of flavonoids. It has a wide range of health, biological, antioxidant, anti-inflammatory, immune system regulatory, cardioprotective, and neuroprotective effects [17, 18]. Quercetin’s neuroprotective effects are mainly due to its antioxidant capacity and ability to scavenge free radicals [19]. Studies have also shown that quercetin prevents osteoporosis and can be effective in treating liver damage, Parkinson’s disease, Alzheimer’s disease, and diabetes. Despite the many medicinal properties of quercetin, due to its poor solubility in water and its rapid metabolism, the bioavailability of quercetin is low, and its use is limited [20, 21].

Drug delivery systems engineering has a common border with many sciences, including biomaterial engineering, biology, histology, pharmacy, mathematical analysis, polymer engineering, and so on [22 –25]. This field is one of the youngest in modern science yet has brought significant advances and has a major share of research today. With the advancement of science, engineers and researchers in the field of health have achieved very good results regarding the use of drugs. Typically, after taking the drug, a high dose of the drug enters the body, which decreases after a few hours, and the person must retake the drug, and within the next few hours, the amount is reduced, and this cycle continues. With the advancement of technology, new methods have been invented to solve this problem [26]. In these methods, the patient does not receive a high dose of the drug after taking the drug. In fact, after taking the drug, the drug release system begins to secrete a defined dose [27].

The most important nanostructures used as drug carriers in controlled drug release are: fullerenes [28], carbon nanotubes [29], micelles [30], liposomes [31], Nanoshells [32, 33], and dendrimers [34]. The role of magnetic nanoparticles as drug carriers is more prominent due to their unique properties in addition to the usual properties of other nanomaterials. So far, diverse Fe₃O₄ nanocomposites have been used in drug delivery systems [35 –40]. Few studies have explored the construction of quercetin incorporated Fe₃O₄ nanocomposite for drug administration and achieved successful target drug delivery. However, none of the studies reported the atomic and molecular-level interactions between quercetin and Fe₃O₄ for successfully constructing of the smart nano-drug shuttle system.

In the present study, for the first time, magnetic quercetin neuropeptide nanocomposite as an innovative nano-drug shuttle system was synthesized and the efficiency of this nanocomposite on the expression of MAPT and APP genes (genes that provides instructions for making proteins called tau and amyloid precursor protein, respectively) in an AD rat model was investigated.

METHODS

Materials and instruments

Quercetin (C15H10O7·2H2O; 97%) and MTT were purchased from Sigma-Aldrich Co. Margatoxin was purchased from Peptide Institute (Osaka, Japan). Ferric chloride and ferrous chloride were purchased from Merck Co (Germany) and used as received. X-ray diffraction (XRD) patterns of the samples were obtained by powder X-ray diffraction (XRD, D5000 X-ray, Cu-Kα radiation, Siemens (Germany)). The morphology and microstructure of the synthesized samples were examined by a MIRA3 TESCAN Field Emission scanning electron microscope (Czech). Fourier transform infrared (FTIR) spectroscopy was performed using Bruker VERTEX 80V Model. The magnetic properties of the synthesized magnetic nanoparticles are studied using a Vibrating Sample Magnetometer (VSM) (Lakeshore 7403, USA, applied magnetic field sweeping between±15,000 Qe) at 20°C.

Synthesis of magnetic nanoparticles have an attached amine functional group (NH₂@MNPs)

The nanocomposite was prepared by in situ chemical reduction-induced assembly in the presence of 3-aminopropylphosphonic acid (NH₂-PA). In brief, FeCl₂.4H₂O (0.1305 mg) and FeCl₃.6H₂O (0.2690 mg) were diluted in 15 ml H₂O. The solution pH was adjusted to 10 using NaOH aqueous solution. After that, NH₂-PA (0.15 mg) was dispersed in the solution using an ultrasonic bath for 20 min. The mixture was then sonicated for 6 h. Finally, NH₂@MNPs particles were gained and washed three times with H₂O and dried under air. Similar approach in the absence of NH₂-PA was also made to evaluate to compare the characterization with that of NH₂@MNPs.

Synthesis of quercetin-neuropeptide functionalized magnetic nanoparticles (MQNPN)

The MQNPN was constructed by mixing of NH₂@MNPs (10 mg) dispersion with quercetin (2 mg) and neuropeptide (2 mg) solution in ethanol. The mixture was stirred at 100 rpm. After 10 h reaction, the MQNPN was collected by magnetic separations and washed three times with ethanol. Significantly, in this study, Margatoxin was chosen as a neuropeptide model.

In vivo analysis

In this experiment, 25 adult female rats with an average weight of 250 g were used to establish the AD model and then they were housed in plastic cages maintained in an ideal room temperature under a 12:12-h light: dark cycle.

The following treatments were applied to the AD rat models for 7 days: A) AD Control (without treatment); B) Treatment of 1 cc of nano quercetin (5 nanograms of nano quercetin per day); C) 2 cc treatment (10 nanograms of nano quercetin per day); D) 2 cc nano neuropeptide quercetin treatment (10 ng per day); along with E) healthy control group in three repetitions in the form of a statistical design.

Measurement of quercetin in blood serum and brain

First, rats were injected with 10 ng of quercetin peritoneal for 7 days. Blood samples were taken from the tail area of rats 7 days after the last injection. The studied rats were then killed under anesthesia, and the brain’s hippocampal region was isolated. Hippocampus area of brain of treated rat was prepared after homogenization using 45% ethanol extract and after filtration, and the absorption spectrophotometry was measured at 370 nm. The weight of quercetin in the samples was calculated by regression method obtained with different concentrations of quercetin in phosphate

Y = 0.014+11.13 (A)

Superoxide dismutase (SOD) activity analysis

First, EDTA buffer 0.1 M, NACN 3 mM, NBT 1.5 mM, and 0.1 g of brain extract were homogenized in an ice solution of 1 mol/l Tris and sucrose 0.25/l on ice and filtered in a centrifuge at 14000 rpm at –80°C. 0.5 cc of brain solution supernatant was removed and vortexed in the above buffer and incubated at 37°C for 5 min. Then, it was added to the prepared 0.12 mM riboflavin solution which was in 0.067 M potassium phosphate buffer with pH = 7.8 and incubated for 12 min at room temperature and then examined using a 560 nm spectrophotometer.

Histological assessment

Hematoxylin and Eosin (H&E) staining was applied for histopathological analysis. To achieve this, specimen (2 mm in diameter and 40–50 mm long) was sampled and immediately placed into formalin for 18 h. Alcohol absorbs water from the tissue in order to dehydrate the tissue. The sample was placed in an alcohol series 50%, 70%, and 90% alcohol and absolute alcohol, respectively. Next, alcohol replaced with xylene and clarification process carried out. After clearing, the samples were placed in a molten paraffin and transferred to an auto technicon tissue processor device. After tissues were embedded in paraffin, a microtome instrument was used to prepare cross-sections of paraffin. Slices were prepared by placing the incisions in the tissue sitz bath. The slides are then deparaffinized and clarified, and after drying, they were studied under a microscope.

Behavioral assessment

After rats had spent their resting time (7 days), they were assessed using behavioral tests with patent No. 139750140003009165 Iran.

Molecular studies

RNA extraction

RNA of rat hippocampus tissue was extracted using the TRIzol method. An appropriate amount of TRIzol and chloroform was added to the treated cells. Then, it was incubated for 20 min in room temperature and centrifuged at 10,000 rpm for 8 min at 4°C. After removing 75% of the bright surface solution and the addition of cold isopropanol solution, the RNA precipitated as a white spot. The quality and quantity of the mRNA were determined using the NanoDrop method (Thermo 2000c, Thermo Fisher Scientific, Waltham, MA, USA) at the 260 and 280 nm wavelengths.

Synthesis of cDNA

The cDNA was synthesized using a Qiagen kit and Oligo dT primer. To do so, according to the kit protocol, the kit components were mixed and placed on ice after centrifugation. After mixing 0.001 ml, Oligo dT and 0.002 mg of the RNA template, bring it to a volume of 0.02 ml with DEPS-treated water and heat at 65°C for 5 min. Finally, 0.01 ml of the cDNA synthesis mixture was added to the RNA-Primer mixture and incubated at 42°C for 60 min aftercentrifugation.

Real-time PCR

To evaluate the gene expression quantity, real-time PCR reaction was performed on the constructed cDNA using SYBR Green (Sinaclon, Tehran, Iran) method using gene-specific primers. For this purpose, 10μL of SYBR Green 1× and 1μL of cDNA and 0.7μL of reverse primer were used. Primer design was performed with Primer3 software for the desired genes and the primers as shown in Table 1. Relative analysis at the mRNA level was performed with three replicates using the Pfaffian method with e^–ΔΔct compared with the GAPDH housekeeping gene.

Table 1

Primers required for Real-Time PCR

Genes	Forward Primer	Reverse Primer
Mapt	ACCACCAAAATCCGGAAGAAC	CTGTAGGCGGCTCTTACTGG
App	CCTACGAAGAGGCCACAGAG	ACATCCGCCGTAAAAGAATG
GAPDH-2	ATGTTCGTCATGAGTGGTGTGAA	GATCTCGCTCCTGGAAGATG

Statistical analysis

The results obtained from MTT and SOD tests were analyzed by ANOVA in SPSS V 21 and the mean comparison was performed by Duncan method at a probability level of 0.05%. T-test was used to analyze data related to gene expression. GAPDH was also considered as internal control.

RESULTS

Characterization of synthesized materials

The FTIR spectra of synthesized Fe₃O₄, NH₂@Fe₃O₄, and MQNPN are displayed in Fig. 1a–c. As can be seen in this figure, wide vibrations around 3,445 cm^–1 are related to the OH groups on the surface of the as-prepared materials. Also, the characteristic peaks at 2,921 cm^–1 and 2,868 cm^–1 are attributed to C-H stretching vibration. The Peaks of Fe-O bond are seen in 560 cm^–1. In this figure, the peaks appearing in 3,391 cm^–1 and 1,623 cm^–1 are related to the tensile and flexural vibrations of the surface hydroxyl groups, respectively. The wide peak appearing in 3,416 cm^–1 and the relatively sharp peak appearing in 1,629 cm^–1 are related to the tensile and flexural vibrations of the NH bond, respectively.

Fig. 1

FTIR spectra of Fe₃O₄ (a), NH₂@Fe₃O₄ (b), and MQNPN (c).

X-ray diffraction pattern (XRD) of Fe₃O₄, NH₂@Fe₃O₄, and MQNPN were analyzed in the range of 2θ= 5–80°, and the results are shown in Fig. 2. As can be seen in this figure, all the peaks visible in these patterns correspond to the data reported from the standard XRD pattern (JCPDS card No. 86-2267) and confirm the crystallinity of the nanoparticles. On comparing the unmodified and modified Fe₃O₄ nanoparticles, from this figure, it was observed that surface modification does not change the structure of the nanomagnet. According to Scherrer equation, the crystallite size of Fe₃O₄, NH₂@Fe₃O₄, and MQNPN nanoparticles were 23 nm, 25 nm, and 29 nm, respectively, in agreement with the FESEM image.

Fig. 2

XRD patterns of Fe₃O₄ (a), NH₂@Fe₃O₄ (b), and MQNPN (c).

Figure 3a–c shows the FESEM image of Fe₃O₄, NH₂@Fe₃O₄, and MQNPN with magnifications of 100 nm, respectively. These images show an excellent homogeneous distribution of spherical nanoparticles. Figure 3d shows a TEM image of MQNPN. This image revealed that the nanocomposite is composed of spherical nanoparticles as well as almost all of these nanoparticles are covered with layer of quercetin and margatoxin, deduced from the light coverage surrounded nanoparticles.

Fig. 3

FESEM image of Fe₃O₄ (a), NH₂@Fe₃O₄ (b), and MQNPN (d). TEM image of MQNPN (d).

Magnetic properties of Fe₃O₄ and MQNPN are shown in Fig. 4. According to the VSM results, the saturation magnetization value of Fe₃O₄ was around 88 emu g^–1. The saturation magnetization (Ms) of the MQNPN is about 78 emu g^–1, indicating that this nanocomposite has a good magnetic response in the magnetic field.

Fig. 4

Magnetic properties of Fe₃O₄ (a) and MQNPN (b).

Cell cytotoxicity assay

In order to evaluate the effect of MQNPN on fibroblast cells, concentrations of 0.001 to 2 mg/ml of nanocomposite were evaluated 24 h after treatment (Fig. 5). The results showed that the synthesized nanocomposite at high doses (0.125 mg/ml) is effective on cell survival but has no significant effect at low doses. The number of cells per well was 5,000 and the experiment was performed with two replications.

Fig. 5

Dose-dependent effect of MQNPN on fibroblast cell survival for 24 hours after treatment.

Evaluation of apoptosis in fibroblast cells treated with MQNPN

To evaluate apoptosis and its stages, the results of concentrations of 0.063 and 0.065 mg/ml in treatment with fibroblasts after 24 hours were evaluated (Fig. 6). The results showed that no significant effect was shown by the treatment with these nanoparticles in the stages of apoptosis and necrosis.

Fig. 6

Results of apoptosis in fibroblast cells treated with MQNPN at a) Low Dose, b) High Dose, and c) Control.

Results of MAPT and APP gene expression in AD rats treated with MQNPN

As can be seen in Fig. 7, gene expression analysis showed that the expression of MAPT and APP genes was significantly increased in AD rat. Also, the results of analysis of variance (ANOVA) (Table 2) for relative expression of MAPT and APP genes showed that the expression of these genes was significantly decreased and affected by the studied treatments.

Table 2

Results of analysis of variance for expression of MAPT and APP genes in rat hippocampus with different treatments tested. DF, degrees of freedom; MS, means square

SOV	DF	MS	MS
		MAPT	APP
Treatment	4	24.76^**	19.56^**
Error	10	3.87	4.22

^**significant in 0.01 probability.

Fig. 7

Diagram comparing the relative expression of APP and MAPT genes in different treatments in rat hippocampus compared to healthy control rats. Ctr Alz, control Alzheimer’s disease; Alz, Alzheimer’s disease

Confirmation results of AD

The results confirmed the development of AD in two ways. In the first method, a behavioral testing device was used. Behavioral test was performed using the device being registered under patent number 139750140003009165. In this test, the rats were placed in one part of the baguette and the food was placed in the other part of the baguette. The number of times rats entered the shock area to pick up food was counted using a camera. The result was done with a repetition of 5 rats. A comparison of the three groups in terms of the number of times they enter the electric shock zone over 5 h can be seen in Fig. 8 and Table 3.

Fig. 8

The number of rats entering the shock zone in 5 hours.

Table 3

Results of independent t-test for the number of rats entering the shock zone in 5 h in both healthy and Alzheimer’s disease-induced groups

Rat	Number of times	Standard deviation	T	p
Healthy	13	3.3	11.25	<0.01
AD	36	4.25

According to the observations of statistical analysis by t-test, AD-induced rats, entered the shock zone significantly (p < 0.01) more than healthy rats, and this indicates that AD-induced rats have a problem of forgetfulness.

The second method used a standardized magnetic resonance imaging (MRI) machine to confirm that the rats had AD pathology. The results are shown in Fig. 9. Plaque formation in the hippocampus confirms that the rat has AD pathology.

Histopathology of the hippocampus of the AD rats

Fig. 9

MRI imaging of a healthy rat brain (a) and AD-induced rat brain (b). Blue arrows indicate the AD plaques.

Figure 10 shows histological studies of the hippocampus in rats before and after treatment. According to this study, neuronal eosinophilia in the hippocampus of AD rats has increased, but the image of treated rats is close to that of healthy rats.

Fig. 10

Histopathological results of rat hippocampus using Hematoxylin and Eosin staining. Healthy sample, AD sample, and AD sample after quercetin treatment. Fold = 100×.

Quercetin detection rate in rat serum and brain and transfer rate in brain extract

The chart below shows the detection of quercetin in the serum and brain of rat. The percentage of quercetin transfer in the brain extract of treated rat is also shown in the graph. The results show that quercetin nanoparticles together with margatoxin have the highest transfer rate in rat brain (Fig. 11).

Fig. 11

Detection of quercetin in the serum and brain of rat.

Antioxidant activity: SOD (unit per mg of protein)

The results of SOD activity show that the combination of quercetin and margotoxin in the AD rat samples has the highest antioxidant activity, which is normal and similar. Quercetin has high antioxidant activity in the AD rat samples compared to the control group (untreated AD rats) (Fig. 12).

Fig. 12

Results of independent t-test for the number of rat entrances to the shock zone in 5 hours in both healthy and AD-induced groups.

Cell cytotoxicity assay

MTT Test for effect of MQNPN on L929 fibroblastic cells has shown that the MQNPN at low conditions (0 to 125 ng/ml) has no significant effect on the viability of fibroblastic cells. However, the highest inhibition is observed in high concentrations (highest at a concentration of 1000 ng/ml).

Expression of MAPT and APP genes

Changes in the expression of MAPT and APP genes in the brains of AD rats treated with MQNPN were investigated using real-time PCR. The MAPT genes showed a significant decrease after treatment with MQNPN. Also, expression of App gene decreased compared to AD rats, but it did not reach the expression level of a normal rat. However, the APP gene also showed reduced expression at the control level in treatment with MQNPN. Both nano quercetin treatment and nano quercetin neuropeptide margatoxin (MQNPN) increased SOD activity, compared to the AD control treatment in the brain contents, so that this level was significantly higher in MQNPN treatment than healthy control. The amount of quercetin transfer in MQNPN treatment was higher in the hippocampus tissue, which indicates that the drug delivery is more in this way. The results of histopathology and morphology of the hippocampus tissue also confirmed this result, so that the results of flow cytometry in the desired dose confirmed the reduction of AD symptoms, which shows the lack of toxicity for healthy cells. In the same MQNPN treatment, the expression of the studied genes was beneficial for the improvement of AD.

DISCUSSION

In this study, we have fabricated a novel magnetic quercetin-neuropeptide nanocomposite (MQNPN) as smart nano-drug shuttle system. The product has been analyzed using FT-IR, SEM, TEM, XRD, and VSM techniques. The results of the behavioral testing device showed that the AD-induced rats had symptoms of memory loss. Also, MRI results showed the formation of AD plaques in the hippocampus. Histological examination was used to evaluate the effect of these plaques on neurons in the hippocampal region. The results of histopathological examinations in the hippocampus of AD-induced rats showed that tissue changes had occurred in the hippocampus. The mechanism of targeted drug delivery to the brain area using the shuttle containing margatoxin neuropeptide is carried out through sodium potassium channel and PAMPA diffusion. A decrease in neuronal density was observed in the neurons of the hippocampus and heterochromatin (Eosinization), which caused inflammation and its distance was a sign of necrosis or tissue death. These changes were not observed in healthy rats. Finally, changes in the expression of MAPT and APP genes under the influence of AD and MQNPN treatment were investigated. The results showed that the expression of MAPT and APP genes under the influence of AD in the hippocampus of rats was greatly reduced. While there was a large difference in the expression of these genes in healthy rats and AD rats, MQNPN treatment increased the expression level of these genes. Therefore, it can be said that the results indicate a positive and significant effect of MQNPN on the expression of MAPT and APP genes in an AD rat model. The safety of synthesized nanoparticles on mouse fibroblastic cell line has also been investigated. Flow cytometry has also shown that these seam nanoparticles do not affect the induction of apoptosis or necrosis in fibroblastic cells. Histopathological examination also showed that the hippocampal tissue of the brain was repaired with nanoparticles and quercetin and returned to normal. Also, the behavioral model designed in this study showed that in addition to improving molecular markers and histopathological markers, memory behavior also improved in this study. Improving excellent performance in treatment with a potent antioxidant whose important properties have already been studied (quercetin) as well as the use of iron nanoparticles attached to quercetin, a breeder of snake venom, can be promising, because iron nanoparticles are also present in the brain environment and their electromagnetic properties assist the delivery of these nanoparticles.

Footnotes

ACKNOWLEDGMENTS

The authors thank the Islamic Azad University, Science and Research Branch Tehran, Iran for financial and other supports.

FUNDING

The authors have no funding to report.

CONFLICT OF INTEREST

The authors have no conflict of interest to report.

DATA AVAILABILITY

The data that support the findings of this study are available from the corresponding author upon reasonable request.

References

Ardebili

SMM

, Yeghaneh

, Gharesouran

, Rezazadeh

, Farhoudi

, Ayromlou

, Talebi

, Ghojazadeh

(2011) Genetic association of TNF-α-308G/A and-863C/A polymorphisms with late onset Alzheimer’s disease in Azeri Turk population of Iran. J Res Med Sci 16, 1006.

Ebrahimpour

, Zakeri

, Esmaeili

(2020) Crosstalk between obesity, diabetes, and Alzheimer’s disease: Introducing quercetin as an effective triple herbal medicine. Ageing Res Rev 62, 101095.

, Guo

, Jiang

, Shi

, Sui

, Zhao

(2020) Brain delivery of quercetin-loaded exosomes improved cognitive function in AD mice by inhibiting phosphorylated tau-mediated neurofibrillary tangles. Drug Deliv 27, 745–755.

Lee

, McGeer

(2016) Quercetin, not caffeine, is a major neuroprotective component in coffee. Neurobiol Aging 46, 113–123.

Kim

, Lee

, Kim

, Song

, Lee

(2020) Mesenchymal stem cell therapy and Alzheimer’s disease: Current status and future perspectives. J Alzheimers Dis 77, 1–14.

Latif

, Abbas

, Kormin

, Mustafa

(2019) Green synthesis of plant-mediated metal nanoparticles: The role of polyphenols. Asian J Pharm Clin Res 12, 75–84.

Shah KW (2018) Nanosynthesis Techniques of Silica-Coated Nanostructures, InTech.

Koshani

, Jafari

(2019) Ultrasound-assisted preparation of different nanocarriers loaded with food bioactive ingredients. Adv Colloid Interface Sci 270, 123–146.

Luo

, Yang

, Zhou

Y-F

, Hu

(2020) Dual and multi-targeted nanoparticles for site-specific brain drug delivery. J Control Release 317, 195–215.

10.

Eivazzadeh-Keihan

, Asgharnasl

, Bani

, Radinekiyan

, Maleki

, Mahdavi

, Babaniamansour

, Bahreinizad

, Shalan

, Lanceros-Méndez

(2021) Magnetic copper ferrite nanoparticles functionalized by aromatic polyamide chains for hyperthermia applications. Langmuir 37, 8847–8854.

11.

Oliveira

ICFCF

, Yoshida

EHH

, Dini

MMJMJ

, Paschoal

ABOBO

, Cogo

JCC

, da Cruz-Höfling

, Hyslop

, Oshima-Franco

(2021) Evaluation of protection by caffeic acid, chlorogenic acid, quercetin and tannic acid against the neurotoxicity and lethality of Crotalus durissus terrificus (South American rattlesnake) venom. Toxins 13, 801.

12.

Salkovic-Petrisic

, Knezovic

, Hoyer

, Riederer

(2013) What have we learned from the streptozotocin-induced animal model of sporadic Alzheimer’s disease, about the therapeutic strategies in Alzheimer’s research. J Neural Transm 120, 233–252.

13.

Jabbar

AA-S

, Mohsen

, Ahmed

(2012) Antioxidant activity of n-butanol extract of celery (Apium graveolens) seed in streptozotocin-induced diabetic male rats. Res Pharm Biotechnol 4, 24–29.

14.

Machu

, Misurcova

, Vavra Ambrozova

, Orsavova

, Mlcek

, Sochor

, Jurikova

(2015) Phenolic content and antioxidant capacity in algal food products. Molecules 20, 1118–1133.

15.

Batiha

GE-S

, Beshbishy

, Ikram

, Mulla

, El-Hack

MEA

, Taha

, Algammal

, Elewa

YHA

(2020) The pharmacological activity, biochemical properties, and pharmacokinetics of the major natural polyphenolic flavonoid: Quercetin. Foods 9, 374.

16.

Gupta

, Prakash

(2014) Phytonutrients as therapeutic agents. J Complement Integr Med 11, 151–169.

17.

David

AVA

, Arulmoli

, Parasuraman

(2016) Overviews of biological importance of quercet: A bioactive flavonoid. Pharmacogn Rev 10, 84.

18.

Saeedi-Boroujeni

, Mahmoudian-Sani

M-R

(2021) Anti-inflammatory potential of Quercetin in COVID-19 treatment. J Inflamm (Lond) 18, 3.

19.

Jiménez-Aliaga

, Bermejo-Bescós

, Benedí

, Martín-Aragón

(2011) Quercetin and rutin exhibit antiamyloidogenic and fibril-disaggregating effects in vitro and potent antioxidant activity in APPswe cells. Life Sci 89, 939–945.

20.

Cai

, Fang

, Dou

, Yu

, Zhai

(2013) Bioavailability of quercet: Problems and promises. Curr Med Chem 20, 2572–2582.

21.

Nam

J-S

, Sharma

, Nguyen

, Chakraborty

, Sharma

, Lee

S-S

(2016) Application of bioactive quercetin in oncotherapy: From nutrition to nanomedicine. Molecules 21, 108.

22.

Tiwari

, Tiwari

, Sriwastawa

, Bhati

, Pandey

, Bannerjee

(2012) Drug delivery systems: An updated review. J Pharm Investig 2, 2.

23.

Hazra

, Mandal

, Bhuniya

, Ghosh

(2015) Designing polymeric microparticulate drug delivery system for hydrophobic drug quercetin. Saudi Pharm J 23, 429–436.

24.

Nejati

, Rastegar

, Fathi

, Dadashpour

, Arabzadeh

(2022) Nanoparticle-based drug delivery systems to overcome gastric cancer drug resistance. J Drug Deliv Sci Technol 70, 103231.

25.

Nasiri

, Zarei

, Arsalani

, Pezhhanfar

, Someh

, Panahian

(2023) One-pot synthesis of novel 3D graphene/Fe3O₄/agro-based waste material (Sesamum indicum) nanocomposite for wastewater treatment and artificial neural network modeling. Chem Eng Res Design 190, 451–463.

26.

Scicluna

, Vella-Zarb

(2020) Evolution of nanocarrier drug-delivery systems and recent advancements in covalent organic framework– drug systems. ACS Appl Nano Mater 3, 3097–3115.

27.

Sastry

, Nyshadham

, Fix

(2000) Recent technological advances in oral drug delivery– a review. Pharm Sci Technol Today 3, 138–145.

28.

Hazrati

, Javanshir

, Bagheri

(2017) B₂₄N₂₄ fullerene as a carrier for 5-fluorouracil anti-cancer drug delivery: DFT studies. J Mol Graph Model 77, 17–24.

29.

Liu

, Chen

, Davis

, Sherlock

, Cao

, Chen

, Dai

(2008) Drug delivery with carbon nanotubes for in vivo cancer treatment. Cancer Res 68, 6652–6660.

30.

Aliabadi

, Lavasanifar

(2006) Polymeric micelles for drug delivery. Expert Opin Drug Deliv 3, 139–162.

31.

Daraee

, Etemadi

, Kouhi

, Alimirzalu

, Akbarzadeh

(2016) Application of liposomes in medicine and drug delivery. Artif Cells Nanomed Biotechnol 44, 381–391.

32.

Singhana

, Slattery

, Chen

, Wallace

, Melancon

(2014) Light-activatable gold nanoshells for drug delivery applications. AAPS PharmSciTech 15, 741–752.

33.

Eivazzadeh-Keihan

, Radinekiyan

, Maleki

, Bani

, Hajizadeh

, Asgharnasl

(2019) A novel biocompatible core-shell magnetic nanocomposite based on cross-linked chitosan hydrogels for in vitro hyperthermia of cancer therapy. Int J Biol Macromol 140, 407–414.

34.

Chauhan

(2018) Dendrimers for drug delivery. Molecules 23, 938.

35.

Nasiri

, Arsalani

(2018) Synthesis and application of 3D graphene nanocomposite for the removal of cationic dyes from aqueous solutions: Response surface methodology design. J Clean Prod 190, 63–71.

36.

Beckmann

, Doelemeyer

, Zurbruegg

, Bigot

, Theil

, Frieauff

, Kolly

, Moulin

, Neddermann

, Kreutzer

(2016) Longitudinal noninvasive magnetic resonance imaging of brain microhemorrhages in BACE inhibitor– treated APP transgenic mice. Neurobiol Aging 45, 50–60.

37.

Gárate-Vélez

, Escudero-Lourdes

, Salado-Leza

, González-Sánchez

, Alvarado-Morales

, Bahena

, Labrada-Delgado

, Rodríguez-López

(2020) Anthropogeniciron oxide nanoparticles induce damage to brain microvascularendothelial cells forming the blood-brain barrier. J AlzheimersDis 76, 1527–1539.

38.

Eivazzadeh-Keihan

, Maleki

(2021) Design and synthesis of a new magnetic aromatic organo-silane star polymer with unique nanoplate morphology and hyperthermia application. J Nanostructure Chem 11, 751–767.

39.

Eivazzadeh-Keihan

, Radinekiyan

, Maleki

, Salimi Bani

, Azizi

(2020) A new generation of star polymer: Magnetic aromatic polyamides with unique microscopic flower morphology and in vitro hyperthermia of cancer therapy. J Mater Sci 55, 319–336.

40.

Eivazzadeh-Keihan

, Radinekiyan

, Asgharnasl

, Maleki

, Bahreinizad

(2020) A natural and eco-friendly magnetic nanobiocomposite based on activated chitosan for heavy metals adsorption and the in-vitro hyperthermia of cancer therapy. J Mater Res Technol 9, 12244–12259.

Synthesis of Novel Magnetic Quercetin-Neuropeptide Nanocomposite as a Smart Nano-Drug Shuttle System: Investigation of Its Effect on Behavior,Histopathological Characteristics,and Expression of MAPT and APP Genes in Alzheimer’s Disease Rats

Abstract

Background:

Objective:

Methods:

Results:

Conclusion:

Keywords

INTRODUCTION

METHODS

Materials and instruments

Synthesis of magnetic nanoparticles have an attached amine functional group (NH2@MNPs)

Synthesis of quercetin-neuropeptide functionalized magnetic nanoparticles (MQNPN)

In vivo analysis

Measurement of quercetin in blood serum and brain

Superoxide dismutase (SOD) activity analysis

Histological assessment

Behavioral assessment

Molecular studies

RNA extraction

Synthesis of cDNA

Real-time PCR

Statistical analysis

RESULTS

Characterization of synthesized materials

Cell cytotoxicity assay

Evaluation of apoptosis in fibroblast cells treated with MQNPN

Results of MAPT and APP gene expression in AD rats treated with MQNPN

Confirmation results of AD

Histopathology of the hippocampus of the AD rats

Quercetin detection rate in rat serum and brain and transfer rate in brain extract

Antioxidant activity: SOD (unit per mg of protein)

Cell cytotoxicity assay

Expression of MAPT and APP genes

DISCUSSION

Footnotes

ACKNOWLEDGMENTS

FUNDING

CONFLICT OF INTEREST

DATA AVAILABILITY

References

Synthesis of magnetic nanoparticles have an attached amine functional group (NH₂@MNPs)