Effects of chitosan oligosaccharides postharvest treatment on the quality and ripening related gene expression of cultivated strawberry fruits

Abstract

BACKGROUND:

Chitosan oligosaccharide (COS), degraded from chitosan, has been proved as an effective plant immunity elicitor, eco-friendly, easily soluble in water and influenced several secondary metabolites content to improve fruit qualities.

OBJECTIVE:

The effects of chitosan oligosaccharides (COS) on the quality and ripening related gene expression of strawberry (Fragaria×ananassa cv. qingxiang) during storage were investigated in this study.

METHODS:

COS was dissolved in distilled water at a concentration of 50 and 100 mg·L^–1. Then the fruits were dipped in COS solution and the control group was dipped in equal amount of distilled water for 1 minute. After that the fruits were air-dried and stored at 20±0.5°C with 80±2% relative humidity.

RESULTS:

COS treated fruits significantly delayed the loss of hardness, total sugar and ascorbate content. In addition, COS treatments had positive effect on maintaining higher concentration of total phenol, anthocyanin content and antioxidant activity. Moreover, COS treatments also had positive effect on inhibition of relative gene expression of cell wall polysaccharides degradation pathways, including pectate lyase (FaPL), pectin esterase (FaPE) and endoglucanase (FaEG) and ethylene biosynthesis (FaACS and FaACO) pathway. These findings suggest that the use of COS 100 mg·L^–¹ postharvest treatment is useful for maintaining quality and storage life of strawberry fruits.

CONCLUSION:

COS postharvest treatment appeared to have a beneficial impact on the quality retention, maintained lower activities of cell wall degradation and the ethylene biosynthesis pathway by suppressing the gene expression during storage of strawberry.

Keywords

Chitosan oligosaccharide strawberry postharvest quality cell wall

1 Introduction

Strawberry (Fragaria×ananassa cv. qingxiang) is a nonclimacteric fruit, very short shelf-life and senescent period due to their high degree of perishability and susceptibility to infection caused by several pathogens that can rapidly reduce fruit quality. Due to its taste, sweetness and healthy function, strawberry is one of the most popular and widely consumed berries. Strawberry extracts have higher antioxidant activities than the extracts from orange, grape, banana, apple, and so on [1, 2]. Exogenous application of chitosan, abscisic acid, methyl jasmonate and some chemical agents have been reported to promote the quality and antioxidant activity of strawberry [3 –6]. Chitosan oligosaccharide (COS), degraded from chitosan [7], has been proved as an effective plant immunity elicitor, friendly to environment and easily soluble in water and nontoxic substance [8]. COS is an effective at eliciting plant innate immunity against plant diseases, and has been widely used in many plants, such as, wheat [9], oilseed rape [10], tobacco [11] and tomato [12]. Interestingly, COS treatment promoted polyphenols content in Greek Oregano [13] and improve vitamin and polyphenols contents in cherries [14]. COS not only worked as an effective plant immunity regulator to defense plant diseases, but also influenced several secondary metabolites content in plant to improve fruit qualities. COS treatment could affect ripening and softening of aprium fruits, cherries, strawberries and citrus fruit [14 –16]. The ripening and softening of fruit is the complex process which is controlled by the fruit biochemical process and affected by the environmental factors. Little is known about ripening and the associated signaling pathways in non-climacteric fruits [17, 18]. In plants, ethylene is synthesized from methionine, and the last two steps in ethylene biosynthesis are the main regulatory control points. These steps consist of the conversion of S-adenosyl-l-methionine into 1-aminocyclopropane-1-carboxylic acid (ACC) by ACC synthase (ACS) and the oxidation of ACC to ethylene by ACC oxidase (ACO) [21]. Non-climacteric fruits are able to synthesize ethylene, ethylene is produced in limited amounts during ripening and could affect gene expression and maturation [18 –20].

Several reports implied the role of ethylene during the ripening process of strawberry [22]. Jiang et al. demonstrated that 1-methylcyclopropene (1-MCP), the inhibitor of ethylene action delays changes in strawberry fruit firmness and color [23]. ACS and ACO are the key genes involved in ethylene production. A significant increase in ACO transcript amount was found following the treatment with exogenous ethylene [24]. These studies established a correlation between the expression of these genes and ethylene production. So, in this study, we choose ACS and ACO genes for ethylene pathway investigation.

Depolymerisation of the polysaccharides of cell wall is an important event during fruit postharvest ripening and softening [25]. Experiments with cell wall degradation have emphasized the role of cell wall degradation enzymes in fruit softening. Pectin lyase (PL), polygalacturonase (PG) and endo-1,4-d-glucanase (EG) have been proposed as important enzyme for cell wall degradation, contributing to the lost of fruit firmness. Previous studies showed that these three genes are also excellent candidates for biotechnological improvement of fruit softening in strawberry [26 –28].

However, to our knowledge, there is no scientific literature available regarding the effects and mechanisms of COS on the postharvest quality of strawberry fruit. To gain further insight into ethylene pathway and cell wall degradation process during strawberry ripening after COS postharvest treatment, the expression of the key genes involved in ethylene biosynthesis, FaACS and FaACO, and genes involved in cell wall degradation were analyzed. Therefore, the present study has been undertaken with the objective of elucidating the potential of COS on quality maintain of strawberry fruit and ripening related gene expression during storage.

2 Materials and methods

2.1 Strawberry and chitosan oligosaccharides treatments

Fresh strawberry fruits were harvested from commercial orchard (Zhuanghe City, Liaoning, China) on April 2015 and immediately transported to the laboratory. Then the fruits were graded for their uniformity in size, shape and bright red color, and free from defects and blemishes were selected. These fruits were randomly divided into three groups with 100 fruits in each treatment. COS was dissolved in distilled water at a concentration of 50 and 100 mg·L^–1. Then the fruits were dipped in COS solution and the control group was dipped in equal amount of distilled water for 1 minute. After that the fruits were air-dried and stored at 20±0.5°C with 80±2% relative humidity. Examinations and sampling were conducted daily and 8 fruits from each treatment were collected and immediately frozen in liquid nitrogen, stored at – 80°C for subsequent analysis. A fixed number of strawberries were used to observe the decay rate and determine the weight loss.

2.2 Weight loss, decay and hardness

Strawberry weight loss was calculated by the following formula: WL (%) = (IW-FW)/IW×100, where IW represents the initial fruit weight and FW represents final fruit weight.

The number of decayed fruit with any microorganism infection was recorded daily and calculated by the following equation: D (%) = N_D/N_T×100, where N_D represents the number of decay fruits and N_T represents the number of total fruits.

The hardness was analyze by “TA.XT.plus Texture Analyser” (Stable Micro Systems Ltd., Surrey UK). Fifteen fruits were analyzed and two measurements were done on opposite sides of each fruit, and the average value was expressed in Newton (N).

2.3 Sequential extraction of cell wall polymers

The cell wall preparation was done as described by Brummell [29]. Five grams of frozen fruit was homogenized in 20 mL of 80% ice-cold ethanol using a Polyton homogenizer. Insoluble residue was washed with 80% ice-cold ethanol, re-suspended in Tris-buffered phenol, precipitated with ethanol, washed with 95% ethanol, re-suspended in chloroform: methanol (1:1, v/v), and washed with acetone than extracted with distilled water to produce the water-soluble pectin (WSP). Aliquots (100 mg) of acetone-insoluble cell wall fractions were sequentially extracted twice with CDTA for 24 h, extracted twice with Na₂CO₃ containing 0.1% NaBH₄ for 24 h to isolate CDTA-soluble pectin (CSP) and Na₂CO₃-soluble pectin (NSP), respectively. The depectinate cell wall residue was extracted twice with 4% KOH containing 0.1% NaBH₄ for 48 h, and twice with 24% KOH containing 0.1% NaBH₄ for 48 h to isolate the hemicellulosic and cellulosic fraction, respectively.

2.4 Total sugar (TS), soluble sugar content (SSC) and titratable acidity (TA)

The total sugars content was calculated by anthrone-sulfuric acid colorimetry method with minor modifications [30].

The SSC content of the fruit was determined using hand refractrometer (Atago Co., Japan). Samples were prepared by homogenizing the fruit in a blender. The sample was thoroughly mixed and a few drops of the filtrate was placed on the prism glass of the refractrometer and a direct reading was taken.

The TA was measured by titration of 5 mL of juice with 0.1 N NaOH using phenolphthalein as an indicator and the results were expressed as the percent of TA [31].

2.5 Antioxidant activity, Vitamin C, anthocyanin and total phenol

Antioxidant activity of strawberry was assessed by the DPPH method [32]. Briefly, fruits were crushed in liquid nitrogen to prepare fine powder, which were extracted by methanol with 0.2% acetic acid. Five-gram fruit powder was added to 75 mL solvent in a conical flask and incubated for 2 hours at 60°C. After filtration, residue was extracted again with same solvent. Filtrates were centrifuged at 10,000 rpm for 15 min and clear supernatant was stored at – 20°C for further analysis. All the assays were performed in triplicate and value was represented as mean±SD.

The radical scavenging effect was measured using the following equation: scavenging activity (%) = (A_control–A_sample)/A_control×100

The ascorbate content was calculated in accordance with the 2,6-dichlorophenolind-ophenoltitration method and expressed as mg 100g^–1 FW.

Total anthocyanin was estimated by a pH differential method [33]. Absorbance was measured at 510 nm and 700 nm in buffer at pH 1.00 and pH 4.5, using A = (A₅₁₀–A₇₀₀) pH1.0 – (A₅₁₀–A₇₀₀) pH4.5 with a molar extinction coefficient for cyanidin-3-glucoside of 22,400. Anthocyanin content was calculated by the following formula: Anthocyanin content (mg·100g^–1 FW) = [(A/ɛ×L)×V/m]×MW×100.

Total phenol compounds were determined by the Folin-Ciocalteu method [34]. The results were expressed as mg gallic acid eq. g^–1 FW.

The flavonoid content was measured by a colorimetric assay [35]. Comparisons were made with standards of known rutin concentrations, and the results expressed as mg·g^–1 FW.

2.6 RNA extraction, cDNA preparation and gene expression analysis

Frozen tissues (5 g) were ground to a fine powder in a mortar using a pestle in the presence of liquid nitrogen. Total RNA was extracted using the hot borate method [36]. RNA was quantified by absorbance at 260 nm. After the treatment with RNase-free DNase (Promega Biotech Ibérica. Madrid, Spain), RNA was reverse transcribed into cDNA with AMV Reverse Transcriptase (Takara, Dalian, China). Dilutions of cDNA were used as templates in qRT-PCR.

The qRT-PCR amplification was performed with gene specific primers (Table 1). 26S–18 S was used as internal control for all the strawberry genes. Each reaction was performed in triplicate for each sample in 20 μL volume containing 5 μL cDNA, 25 p mol specific primers, and 10 μL of Power SYBR Green PCR Master Mix (Applied Biosystems) according to the manufacturer’s protocol.

Table 1
Fragaria×ananassa gene-specific oligonucleotides primers pairs used for qRT-PCR. The accession number of each gene was obtained from Gene Bank

Name gene Gene ID Sequence of the 5–3 primers, forward/reverse

FvePL 101301735 CTCGTTTGCGTATCGG

TGCGTGCTCATTCCA

FvePE 101310153 TTGGACCACATTTCGC

GGTCGGCTCATCTTTGT

FveACO 101298627 TACCTCAAGCACCTTCCTCGC

TTAGTGCCAAAGGTAGGACTA

FveACS AY912491 GAGAACACGAAACTCCAAG

CCAAGAAGACATCAACCC

FveEG 101301481 AACGAGTTTGGTTGGGATAA

GCAGGAACGATAGCGAAG

Fa26S-18S X58118 ACCGTTGATTCGCACAATTGGTCATCG

TACTGCGGGTCGGCAATCGGACG

Name gene	Gene ID	Sequence of the 5–3 primers, forward/reverse
FvePL	101301735	CTCGTTTGCGTATCGG
		TGCGTGCTCATTCCA
FvePE	101310153	TTGGACCACATTTCGC
		GGTCGGCTCATCTTTGT
FveACO	101298627	TACCTCAAGCACCTTCCTCGC
		TTAGTGCCAAAGGTAGGACTA
FveACS	AY912491	GAGAACACGAAACTCCAAG
		CCAAGAAGACATCAACCC
FveEG	101301481	AACGAGTTTGGTTGGGATAA
		GCAGGAACGATAGCGAAG
Fa26S-18S	X58118	ACCGTTGATTCGCACAATTGGTCATCG
		TACTGCGGGTCGGCAATCGGACG

Note: The Ct values for each qRT-PCR reaction were normalized in relation to the Ct value corresponding to an inter spacer 26S–18S strawberry RNA gene (housekeeping gene).

PCRs were carried out using the ABIVeriti (Applied Biosystems, USA) for 2 min at 95°C and then for 40 cycles as follows: 5 s at 95°C, 10 s at 58°C and 10 s at 72°C. The specificity of the PCR amplification was confirmed with a melt curve analysis. Relative expression levels were calculated using the 2–ΔΔCt method [37].

2.7 Statistical analysis

The experiment used a completely randomized design with three replicates. The data were subjected to an analysis of non-parametric test (Kruskal Wallis test or Mann-Whitney U test) using SPSS software. Means values were considered significantly different at P≤0.05.

3 Results

3.1 Changes in weight loss, decay and firmness of strawberry

The data recorded from different treatments on weight loss percentage of the strawberry fruits are shown in Fig. 1A. The weight loss increased throughout the storage period both in COS treated and control fruits. COS postharvest treatment had no significant effect on the strawberry weight loss during storage but reduce the weight loss compared to control fruits.

Fig. 1

Weight loss (A), decay rate (B), and hardness (C) in COS postharvest treated and untreated (control) strawberry fruit. Data represent the means±SD. The * represent means significantly different according to Kruskal Wallis test at P < 0.05 level.

Strawberry fruit have a very short shelf life due to high degree of perishability. From our results, it was observed that the decay percentage increased with the prolong of storage time for all treatments (Fig. 1B). No significant effect was observed among the treatment but the 100 mg·L^–1 COS treatments reduced the decay percentage of strawberries compared to the control fruit during storage. The initial decay percentage in control group was 5.00%, which increased to 63.33% whereas 50 mg·L^–1 and 100 mg·L^–1 COS treated fruit was 58.33%, 35.00%, respectively at 7 days of storage. These results suggested that COS have positive effect on postharvest diseases control of strawberries.

Hardness is the most important indices for determination of fruit quality. The level of hardness decreased both in treated and untreated fruits during storage (Fig. 2C). 100 mg·L^–1 COS treated fruit significantly delayed the loss of hardness compared to control fruits.

Fig. 2

Total sugar (A), soluble sugar content (B), and titratable acidity (C) in COS postharvest treated and untreated (control) strawberry fruit. Data represent the means±SD. The *are significantly different according to Kruskal Wallis test at P≤0.05 level.

3.2 Changes in TS, SSC and TA content of strawberry

The TS decreased during the storage period in all treated as well as control samples, with a slow decrease observed with treated fruit. COS 100 mg·L^–1 treatment significantly (P < 0.05) delayed the rate of TS decrease (Fig. 2A). At the end of the storage period (6 DAS), the highest TS (21.59%) was recorded from100 mg·L^–1 COS treated fruit whereas the lowest TS (17.43%) was noted from control fruit.

The SSC of control and COS treated fruits during storage are presented in Fig. 2B. No significant effect was observed among the treatment in respect of SSC content. SSC content at the beginning of storage was 8.19 % Brix and gradually decreased during storage in both treated and untreated strawberry fruit. After 6 days of storage, SSC was 5.32% Brix in100 mg·L^–1 COS treated fruits, while the control group had 4.53% Brix. It was observed that the TA also decreased during the storage period for all treatments (Fig. 2C). No significant effect was observed in case of TA content compared to the control during storage.

3.3 Changes in ascorbate content and antioxidant of strawberry

DPPH radical scavenging activity is an important index for evaluation of fruit antioxidant activity. The results of the DPPH radical scavenging activity in different strawberry postharvest treatments are shown in Fig. 3A. The DPPH radical scavenging activity was higher in 100 mg·L^–1 COS treated fruits than control during the storage and it was reached a peak at 4 days of storage.

Fig. 3

DPPH scavenging activity (A), ascorbate content (B), anthocyanin content (C), flavonoid content (D), and total phenol content (E) in COS postharvest treated and untreated (control) strawberry fruit. Data represent the means±SD. The *are significantly different according to Kruskal Wallis test at P≤0.05 level.

Ascorbate content of strawberry fruits was markedly affected by COS treatment. Our results showed that ascorbate content of strawberry decreased continuously in all treatments during the storage period (Fig. 3B). However, compared with the control group, the ascorbate content was significantly higher in 100 mg·L^–1 COS treated fruits. After 6 days of storage, the highest ascorbate content (59.73 mg/100 g) was noted from 100 mg·L^–1 COS treated fruits while the lowest ascorbate content (51.03 mg/100 g) was recorded from control fruit.

The concentration of anthocyanins in treated and control strawberries during storage is presented in Fig. 3C. COS had positive effect on anthocyanin content, it increased at the beginning of storage period thereafter decreased. After 6 days of storage the highest anthocyanin content (25.30 mg·100g^–1) was recorded from 100mg·L^–1COS treatment whereas the lowest (22.86 mg·100g^–1) was found from control fruit.

Flavonoid and total phenol showed a similar decline tendency during storage (Fig. 3D & E). Moreover, the content of these secondary metabolites decreasing trend in COS group was slower than that in control group during storage. In response to the 100mg·L^–1COS treatment, flavonoid content was significantly higher than control fruit after 4 days of storage. The content of total phenol in COS treatment groups were higher than control group during storage and the 100 mg·L^–1 COS treatment group had significant effect compared to the control all through the storage period. After 6 days of storage period, the highest flavonoid (23.79 mg·100g^–1) and total phenol (0.71 mg·100g^–1) was counted from 100 mg·L^–1 COS treatment group whereas the lowest flavonoid (22.20 mg·100g^–1) and total phenol (0.67 mg·100g^–1) was noted from control group.

3.4 Cell wall composition and ripening related gene expression

The cell wall fractions were usually divided into five parts based on their solubility in different solvents: water soluble pectin, ionic pectin, covalent bonding type of pectin, hemicellulose and cellulose. Pectin solubilization is a common feature of fruit ripening. The results of these cell wall fractions content analysis during storage are shown in Table 2. The content of water soluble pectin (WSP) increased during storage both in control fruit and COS treated fruit.

Table 2
Effect of COS postharvest treatment on strawberry fruit cell wall composition

A (mg·g^–1 FW) B (mg·g^–1 FW) C (mg·g^–1 FW) D (mg·g^–1 FW) E (mg·g^–1 FW)

/d CK COS (100 mg·L^–1) CK COS (100 mg·L^–1) CK COS (100 mg·L^–1) CK COS (100 mg·L^–1) CK COS (100 mg·L^–1)

0 0.12±0.09 0.12±0.09 0.55±00.7 0.55±0.07 0.53±0.05 0.53±0.05 2.06±0.14 2.06±0.14 1.62±0.16 1.62±0.16

2 0.17±0.01 0.17±0.10 0.62±0.06 0.64±0.12 0.54±0.10 0.54±0.07 2.01±0.45 2.05±0.01 1.48±0.23 1.49±0.46

4 0.26±0.06 0.20±0.06 0.67±0.09 0.64±0.15 0.44±0.09 0.53±0.07 1.85±0.47 1.93±0.26 1.06±0.33 1.38±0.45

6 0.34±0.06 0.21±0.05^* 0.73±0.08 0.78±0.12 0.45±0.03 0.50±0.05 1.46±0.67 1.64±0.15 1.13±0.37 1.31±0.23

	A (mg·g^–1 FW)	B (mg·g^–1 FW)	C (mg·g^–1 FW)	D (mg·g^–1 FW)	E (mg·g^–1 FW)
0	0.12±0.09	0.12±0.09	0.55±00.7	0.55±0.07	0.53±0.05	0.53±0.05	2.06±0.14	2.06±0.14	1.62±0.16	1.62±0.16
2	0.17±0.01	0.17±0.10	0.62±0.06	0.64±0.12	0.54±0.10	0.54±0.07	2.01±0.45	2.05±0.01	1.48±0.23	1.49±0.46
4	0.26±0.06	0.20±0.06	0.67±0.09	0.64±0.15	0.44±0.09	0.53±0.07	1.85±0.47	1.93±0.26	1.06±0.33	1.38±0.45
6	0.34±0.06	0.21±0.05^*	0.73±0.08	0.78±0.12	0.45±0.03	0.50±0.05	1.46±0.67	1.64±0.15	1.13±0.37	1.31±0.23

A: WSP; B: CSP; C: NSP; D: Hemicellulose; E: Cellulose. Data represent the means±SD. The ^*are significantly different according to Mann-Whitney U test at P≤0.05 level. CK: Treated by water; COS: Treated by 100 mg·L^–1 COS.

In response to the COS treatment, a reduction trend was exhibited in the WSP content. The WSP content was significantly lower in COS group on the 6^th day after harvest. After 6 days storage, the WSP in control fruits increased from 0.12 to 0.34 mg·L^–1, while COS-treated fruits just increased from 0.12 to 0.21 mg·L^–1. The amount of WSP in COS group is about 61.8% of that in control group. As for other two type of pectin content, the effects of COS is not obvious. Although to a lesser extent, the COS treatment appeared able to delay the cellulose and hemicellulose degradation in late storage time. These results are consistent with the strawberry firmness change after COS treatment.

To explore the effects of COS on cell wall degradation, we examined the expression of important genes in this signaling pathways, including Fa PL, Fa PE and Fa EG. The results of these gene expression in different strawberry treatments are shown in Fig. 4. It can be observed that the expression of Fa PL, Fa PE and Fa EG has a tendency to first rise then decline. The gene expression in control fruit reached a peak at day 4 and 100 mg·L^–1 COS treatment significantly delayed the peak time of gene expression. Moreover, fruit treated with 100 mg·L^–1 COS also resulted in lower level of gene expression compared to the untreated control during the storage.

Fig. 4

Gene expression of some important enzymes involved in cell wall degradation (A.PL: Pectin lyase; B.PE: Pectin esterase; C.EG: Endoglucanase) and ethylene compound biosynthesis (D.ACO: ACC oxidase; E. ACS: ACC synthase) during storage. The error bars represent the standard deviation of three biological replicates.

Then we examined the expression of ethylene synthesis pathway gene including FaACS and FaACO. The results of these gene expression in different strawberry treatments are shown in Fig. 4. For strawberry fruit, the ethylene synthesis activity was sharply enhanced during ripening and was negatively correlated with the loss of flesh firmness. However, for strawberry with COS treated group, the FaACO and FaACS was maintained at a relatively low level and only showed a moderate increase during storage.

It can be observed that the expression of FaACO and FaACS has a tendency to first rise then decline. COS not only delayed the expression time of gene compared to the control but also inhibited gene expression. Moreover, fruit treated with 100 mg·L^–1 COS also resulted in lower level of gene expression of both pathway, relative to the untreated control during the storage. These results indicated that COS may play an important role in postharvest strawberries by affecting the expression of ethylene synthesis and cell wall degradation genes.

4 Discussion

COS was obtained by degradation of chitosan and used as a plant immunity regulator in several plants [38 –40]. It was observed that COS had good efficacy on bacteria, fungi control and maintaining fruits quality [16, 41]. Only a few reports focus on the induction of COS and its preservative function on the maintaining fruit quality. Based on the previous studies, the present study was designed to provide more information about the mechanisms of COS on postharvest storage of strawberry.

4.1 Decay rate and weight loss

After harvest, fresh fruits and vegetables are still living tissues and usually continue to decrease weight due to water loss, which is a serious problem in harvested crops [42]. The previous study showed the efficacy of Aloe vera and ascorbic acid with chitosan coatings on the shelf-life and overall quality of strawberry fruit, edible coatings significantly reduced the weight loss percentage in strawberries during storage [3, 43]. In this study, result showed increasing trend in weight loss during prolonged storage period and the highest weight loss was observed at the end of storage. COS treatment reduced the weight loss but had no significant effect compared to the control (Fig. 1). The possible reason is that COS has no film-forming properties and unable to reduce the respiration rate of fruits due to its lower molecular weight compared to chitosan.

The major postharvest losses of stored fruits are due to fungal infection, physiological disorders, and physical injuries [44]. From the result it can be observed that the decay percentage increased with the storage time in case of all treatments (Fig. 1B), but COS had remarkable effect on the inhibition of the strawberry decay. During storage, the decay rate was always higher in control fruits than the COS treated fruits. Our results were consistent with previous studies on peach and aprium, which reported that 0.5 g·L^–1 COS could decrease 70% decay on peach fruits and 0.5% (w/v) COS treatment could decrease 50% decay on aprium fruits [16]. The better efficiency of both 50 mg·L^–1 and 100 mg·L^–1 COS treatment against strawberry decay was probably due to the antimicrobial activity and induced disease resistance of the COS.

The hardness of the fruit is one of the most important indicator for its shelf life and market value [45]. Strawberry hardness declined rapidly during storage. The taste, appearance and market demand of strawberry fruits largely depend on hardness. Our results showed that COS (100 mg·L^–1) postharvest treatment had a significant effect on the reduction of hardness during storage. These results are in agreement with other scientist [14, 16] those who noted that COS could delay the hardness loss of different fruits, such as strawberries and aprium during storage. During strawberry ripening, softening of the fruit appears mainly due to middle lamella and cell wall degradation, that mostly occurs in the last stages of the ripening process. Our results suggest that COS treatment had a good efficiency to retained strawberry fruit hardness by suppressed the gene expression of cell wall polysaccharides degradation enzymes.

4.2 Total sugar (TS), soluble sugar content (SSC) and titratable acidity (TA)

From Fig. 2, it can be observed that the TS, SSC and TA content of strawberry decreased in all treated as well as untreated fruits with prolonged storage time. It might be due to the metabolic changes in fruit resulting from the use of organic acids in respiratory process [39]. During fruit ripening, complex carbohydrates are converted to simple sugars, and the acidity decreases with the accumulation of sugar [46]. Previous study suggest that the application of abscisic acid could maintained the lowest content of SSC and SSC/TA in postharvest grapes [47]. Similar to previous reports, in this study, 100 mg·L^–1 COS treatment showed good effect for maintaining strawberry fruit quality during storage (Fig. 2). Strawberries treated with 100 mg·L^–1 COS had the highest acidity and the lowest SSC/TA ratio.

4.3 Antioxidant activity

Strawberry is a good source of natural antioxidants which strongly related to the secondary metabolites of fruits. The strawberry secondary metabolites include anthocyanin, flavonoid and total phenol, not only strongly influence the nutrition of the fruits, but also contribute to the antioxidant activity of fruits. From Fig. 3, the ascorbate content and secondary metabolites such as anthocyanins, flavonoids, total phenols content of strawberry continuously decreased during storage. Our results are in line with the previous report, in which strawberry antioxidant capacity, anthocyanins, ascorbate content gradually decreased during storage time [48]. The 50 mg·L^–1 and 100 mg·L^–1 COS treatments could delay the decrease of antioxidant substances content in strawberry. The decrease in phenolic compounds at the end of storage might be due to breakdown of cell structure as the fruit senesce [49]. COS might slow down the respiration rate, which delays the deteriorative oxidation reaction of fruit during storage.

4.4 Ethylene synthesis related gene expression

Ripening in climacteric fruit is regulated by ethylene, which triggers the physiological and biochemical changes related to fruit ripening such as plum, apple, tomato and peach [50 –53]. Strawberry is a non-climacteric fruit, but in recent years there are studies reported that ethylene is possibly involved in the regulation of nonclimacteric fruit ripening [21]. This study showed that COS influenced ethylene pathway by reducing the expression of ACS and ACO gene during storage. Previous report suggested that different ethylene receptors show an increased expression during the ripening of strawberries [54], which was similar to that occurs during climacteric fruit ripening. However, non-climacteric fruits are also able to synthesize ethylene, and in some cases, it has been observed that ethylene can accelerated the post-harvest deterioration. Our results suggested that COS could affect the strawberry preservation by influencing the fruit intrinsic process of postharvest ripening and senescence by the regulation of the ethylene biosynthesis gene.

4.5 Cell wall composition and gene expression

Firmness loss and susceptibility to decay are the two main factors determining the quality of fruits, both are directly or indirectly associated with changes in cell wall structure and composition [55]. During storage, strawberry fruit hardness decreased mainly due to the solubilization and depolymerization of pectins from cell walls. The degradation of pectic substances during storage results in cellulose and hemicellulose disassembly, causing fruit softening [56, 57]. In the COS group, the content of the WSP was lower than that of the control while hemicellulose and cellulose content are slightly higher than the corresponding part of the control at the same storage period. Previous reports found that the firmness of grapes and pears decreased rapidly during storage and correlated with a progressive increase in WSP content and decrease in contents of CSP, NSP, cellulose and hemicellulose [58, 59]. COS treatment delayed the degradation of cell wall components including, cellulose and hemicellulose in strawberry cell wall and produced less degraded cell wall components such as WSP, which might be the key factor that could maintain the hardness of postharvest fruit.

Cell wall structure and composition change are thought to involve the coordinated and interdependent action of numerous cell wall-modifying enzymes, such as pectin esterase (PE) and pectate lyase (PL) [60, 61]. In this study, we found that PL, PE and EG genes presented very high transcript levels in a strawberry, which synchronized with the cell wall degradation during softening fruit, which was similar with previous results that the cell wall degrading was controlled by cell wall modifying enzymes [52 , 63]. COS treatment could inhibit the gene expression of PL, PE and EG in strawberry during the progress of ripening. These results showed that COS could delay the degradation of cell wall by inhibiting cell wall degradation enzyme gene expression, which in consistent with the results of cell wall fractions change.

COS has been proven to be an effective elicitor on fruit disease control. The postharvest effect of COS has been previously studied on other fruits, including citrus [64], chinese jujube fruit [65] and aprium fruits [66]. However, these studies mainly focus on the direct antibacterial activity of COS and its defense reaction induction ability. Few studies have reported COS have influence on the fruit intrinc postharvest softening process. Our results demonstrated that COS could delay strawberry postharvest ripening and softening, maintain the quality during storage, and inhibition cell wall degradation and ethylene pathway. Considering that both the ethylene pathway and cell wall degradation process are well regulated by the fruit intrisinc program, we hypothesized that COS delayed strawberry postharvest deterioration through control these two fundamental physiological process. Some other exogenous chemical compounds were also applicated in retarding fruit postharvest senescence and keeping fruit quality. Among them, both salicylic acid and NO are widely accepted key molecular in plant immunity activation. Lai et al reported that NO could effectively retard ripening of tomato fruit, suppress ethylene production, and influence quality parameters during storage [67]. SA also exhibit a high potential in delaying ripening, enhancing quality, suppressing climacteric respiration and ethylene biosynthesis [68, 69]. These findings give support to our hypothesis that the regulation of fruit postharvest physiology at the molecular level is an important contributor of COS effect on extending fruit shelf life.

Our results showed that COS down-regulated expression of genes involved in cell wall degradation and ethylene biosynthesis, this finding is in consist with the delay effects of COS on strawberry postharvest ripening and softening. It is interesting that COS have positive effect on the ethylene accumulation and cell wall degradation as plant elicitor. We hypothesized that different mechanisms may exist for COS application in different stage of fruit. Previous studies also gave evidences that SA and NO, the well acknowledged plant defense regulator also effectively suppress ethylene production when applied in postharvest fruit.

To explore the effects and mechanism of COS on fruit postharvest, further research are required because information regarding COS application in fruit postharvest is limited and possibly we use 1st time COS as postharvest treatment for maintaining strawberry fruit quality. In future we want to explore the mechanism of COS as postharvest treatment on different fruits for maintaining quality, especially how COS influence the fruit postharvest ripening and softening process.

5 Conclusion

The results of the present study indicate that COS postharvest treatment appeared to have a beneficial impact on the quality retention of strawberry fruit during storage. COS postharvest treatment delayed the fruit firmness, decay percentage, TA, SSC and ascorbate content and had positive effects on maintaining higher concentration of phenolics and anthocyanin content resulting enhanced the strawberry shelf life. Moreover, COS treatment also maintained lower activities of cell wall degradation and the ethylene biosynthesis pathway by suppressing the gene expression.

Conflict of interest

The authors have no conflict of interest to report.

Footnotes

Acknowledgments

This work was supported by CAS Scientific Technological Service Net work (STS) Project (KFJ-EW-STS-143), The National Natural Science Foundation of China (31370391), CAS Youth Innovation Promotion Association (2015144) ,Special Fund of Dalian city for Distinguished Young Scholars (2015R010) and S. K. Bose is grateful for the award of a CAS-TWAS President's PhD Fellowship Programme.

References

Kevers

, Falkowski

, Tabart

, Defraigne

, Dommes

, Pincemail

. Evolution of antioxidant capacity during storage of selected fruits and vegetables. Journal of Agricultural and Food Chemistry. 2007;55:8596–603.

Park

, Im

, Ham

, Kang

, Park

, Namiesnik

, Leontowicz

, Trakhtenberg

, Gorinstein

. Quantitative assessment of the main antioxidant compounds, antioxidant activities and FTIR spectra from commonly consumed fruits, compared to standard kiwi fruit. LWT - Food Science and Technology. 2015;63:346–52.

Gol

, Patel

, Rao

TVR

. Improvement of quality and shelf-life of strawberries with edible coatings enriched with chitosan. Postharvest Biology and Technology. 2013;85:185–95.

Jiang

, Joyce

. ABA effects on ethylene production, PAL activity, anthocyanin and phenolic contents of strawberry fruit. Journal of Plant Growth Regulator. 2003;39:171–4.

Petriccione

, De Sanctis

, Pasquariello

, Mastrobuoni

, Rega

, Scortichini

, Mencarelli

. The effect of chitosan coating on the quality and nutraceutical traits of sweet cherry during postharvest life. Food and Bioprocess Technology. 2014;8:394–408.

Saavedra

, Figueroa

, Poblete

, Cherian

, Figueroa

. Effects of preharvest applications of methyl jasmonate and chitosan on postharvest decay, quality and chemical attributes of Fragaria chiloensis fruit. Food Chemistry. 2016;190:448–53.

Mattaveewong

, Wongkrasant

, Chanchai

, Pichyangkura

, Chatsudthipong

, Muanprasat

. Chitosan oligosaccharide suppresses tumor progression in a mouse model of colitis-associated colorectal cancer through AMPK activation and suppression of NF-kB and mTOR signaling. Carbohydrate Polymers. 2016;145:30–6.

Muanprasat

, Chatsudthipong

. Chitosan oligosaccharide: Biological activities and potential therapeutic applications. Pharmacology and Therapeutics. 2017;170:80–97.

Wang

, Chen

, Zhang

, Wang

, Zhao

, Du

, Yin

. Effects of chitosan oligosaccharides on the yield components and production quality of different wheat cultivars (Triticum aestivum L.) in Northwest China. Field Crops Research. 2015;172:11–20.

10.

Yin

, Li

, Zhang

, Wang

, Lu

, Grevsen

, Zhao

, Du

. Chitosan oligosaccharides-triggered innate immunity contributes to oilseed rape resistance against sclerotinia sclerotiorum. International Journal of Plant Sciences. 2013;174:722–32.

11.

Falcon

, Cabrera

, Costales

, Ramirez

, Cabrera

, Toledo

, Martinez-Tellez MA. The effect of size and acetylation degree of chitosan derivatives on tobacco plant protection against Phytophthora parasitica nicotianae. World Journal of Microbiology and Biotechnology. 2008;24:103–12.

12.

Zhang

, Chen

. Age-dependent variations of volatile emissions and inhibitory activity toward Botrytis cinerea and Fusarium oxysporum in tomato leaves treated with chitosan oligosaccharide. Journal of Plant Biology. 2009;52:332–9.

13.

Yin

, Frette

, Christensen

, Grevsen

. Chitosan oligosaccharides promote the content of polyphenols in Greek oregano (Origanum vulgare ssp. hirtum). Journal of Agricultural and Food Chemistry. 2012;60:136–43.

14.

Kerch

, Sabovics

, Kruma

, Kampuse

, Straumite

. Effect of chitosan and chitooligosaccharide on vitamin C and polyphenols contents in cherries and strawberries during refrigerated storage. European Food Research and Technology. 2011;233: 351–8.

15.

Deng

, Yin

, Yao

, Wang

, Zeng

. Postharvest application of oligochitosan and chitosan reduces calyx alterations of citrus fruit induced by ethephon degreening treatment. Journal of Agricultural and Food Chemistry. 2016;64:7394–403.

16.

, Cao

, Xu

, Zhang

, Wang

, Jiang

. Effects of 1-methylcyclopropene in combination with chitosan oligosaccharides on post-harvest quality of aprium fruits. Scientia Horticulture. 2014;179:301–5.

17.

Giovannoni

. Genetic regulation of fruit development and ripening. Plant Cell. 2004;16:S170–80.

18.

Merchante

, Vallarino

, Osorio

, Aragüez

, et al. Ethylene is involved in strawberry fruit ripening in an organ-specific manner. Journal of Experimental Botany. 2013;64:4421–39.

19.

Trainotti

, Pavanello

, Casadoro

. Different ethylene receptors show an increased expression during the ripening of strawberries: Does such an increment imply a role for ethylene in the ripening of these non-climacteric fruits. Journal of Experimental Botany. 2005;56:2037–46.

20.

Villarreal

, Bustamante

, Civello

, Martinez

. Effect of ethylene and 1-MCP treatments on strawberry fruit ripening. Journal of the Science of Food and Agriculture. 2010;90:683–9.

21.

Yang

, Hoffman

. Ethylene biosynthesis and its regulation in higher plants. Annual Review of Plant Physiology. 1984;35:155–89.

22.

Merchante

, Vallarino

, Osorio

, et al. Ethylene is involved in strawberry fruit ripening in an organ-specific manner. Journal of Experimental Botany. 2013;64(14):4421–39.

23.

Jiang

, Joyce

, Terry

. 1-Methylcyclopropene treatment affects strawberry fruit decay. Postharvest Biology and Technology. 2001;23:227–32.

24.

Livio

, Anna

, Giorgio

. Different ethylene receptors show an increased expression during the ripening of strawberries: Does such an increment imply a role for ethylene in the ripening of these non-climacteric fruits? Journal of Experimental Botany. 2005;(56) 418:2037–46.

25.

Goulao

, Oliveira

. Cell wall modifications during fruit ripening: When a fruit is not the fruit. Trends in Food Science and Technology. 2008;19(1):4–25.

26.

Jimenez-Bermudez

, Redondo-Nevado

, Munoz-Blanco

, Caballero

, Lopez-Aranda

, Valpuesta

, Pliego-Alfaro

, Quesada

, Mercado

. Manipulation of strawberry fruit softening by antisense expression of a pectate lyase gene. Plant Physiology. 2002;128:751–9.

27.

García-Gago

, Pose

, Muñ oz-Blanco

, Quesada

, Mercado

. The polygalacturonase FaPG1 gene plays a key role in strawberry fruit softening. Plant Signaling and Behavior. 2009;4(8):766–8.

28.

Trainotti

, Ferrarese

, Dalla Vecchia

, Rascio

, Casadoro

. Two different endo-β-1,4-glucanases contribute to the softening of the strawberry fruits. Journal of Plant Physiology. 1999;154(3):355–62.

29.

Brummell

, Dal Cin

, Crisosto

, Labavitch

. Cell wall metabolism during maturation, ripening and senescence of peach fruit. Journal of Experimental Botany. 2004;55:2029–39.

30.

Wei

, Mao

, Tu

. Effect of preharvest spraying Cryptococcus laurentii on postharvest decay and quality of strawberry. Biological Control. 2014;73:68–74.

31.

Asghari

, Abdollahi

. Changes in quality of strawberries during cold storage in response to postharvest nitric oxide and putrescine treatments. Acta Alimentaria. 2013;42:529–39.

32.

Patras

, Brunton

, Da Pieve

, Butler

. Impact of high pressure processing on total antioxidant activity, phenolic, ascorbic acid, anthocyanin content and color of strawberry and blackberry purees. Innovative Food Science and Emerging Technologies. 2009;10:308–13.

33.

Antunes

, Cuquel

, Zawadneak

MAC

, Mogor

, Resende

JTV

. Postharvest quality of strawberry produced during two consecutive seasons. Horticultura Brasileira. 2014;32:168–73.

34.

Hartmann

, Patz

, Andlauer

, Dietrich

, Ludwig

. Influence of processing on quality parameters of strawberries. Journal of Agricultural and Food Chemistry. 2008;56:9484–9.

35.

Meyers

, Watkins

, Pritts

, Liu

. Antioxidant and antiproliferative activities of strawberries. Journal of Agricultural and Food Chemistry. 2003;51:6887–92.

36.

Landi

, Feliziani

, Romanazzi

. Expression of defense genes in strawberry fruits treated with different resistance inducers. Journal of Agricultural and Food Chemistry. 2014;62:3047–56.

37.

Livak

, Schmittgen

. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods. 2001;25:402–8.

38.

Jia

, Meng

, Zeng

, Wang

, Yin

. Chitosan oligosaccharide induces resistance to Tobacco mosaic virus in Arabidopsis via the salicylic acid-mediated signaling pathway. Scientific Reports. 2016;6:26144.

39.

Duong Van

, Tong

, Tanaka

, Yasunaga

, Hamanaka

, Hiruma

, Uchino

. Controlling the weight loss of fresh produce during postharvest storage under a nano-size mist environment. Journal of Food Engineering. 2011;106:325–30.

40.

Sogvar

, Koushesh Saba

, Emamifar

. Aloe vera and ascorbic acid coatings maintain postharvest quality and reduce microbial load of strawberry fruit. Postharvest Biology and Technology. 2016;114:29–35.

41.

EL Ghaouth

, Ponnampalam

, Castaigne

, Arul

. Chitosan coating to extend the storage life of tomatoes. Hortscience. 1992;27:1016–8.

42.

Valero

, Martinezromero

, Valverde

, Guillen

, Serrano

. Quality improvement and extension of shelf life by 1-methylcyclopropene in plum as affected by ripening stage at harvest. Innovative Food Science and Emerging Technologies. 2003;4:339–48.

43.

, Zhao

, Zhang

, Hou

, Dong

. Transcriptome analysis and ultrastructure observation reveal that hawthorn fruit softening is due to cellulose/hemicellulose degradation. Frontier Plant Science. 2016;7:1524.

44.

, Yang

, Yan

, Kennedy

, Meng

. Chitosan and oligochitosan enhance the resistance of peach fruit to brown rot. Carbohydrate Polymers. 2013;94:272–7.

45.

Cantín

, Fidelibus

, Crisosto

. Application of abscisic acid (ABA) at veraison advanced red color development and maintained postharvest quality of 'Crimson Seedless' grapes. Postharvest Biology and Technology. 2007;46:237–41.

46.

Cao

, Sofic

, Prior

. Antioxidant capacity of tea and common vegetables. Journal of Agricultural and Food Chemistry. 1996;44:3426–31.

47.

Guo

, Cao

, Sofic

, Prior

. High-performance liquid chromatography coupled with coulometric array detection of electroactive components in fruits and vegetables: Relationship to oxygen radical absorbance capacity. Journal of Agricultural and Food Chemistry. 1997;45:1787–96.

48.

Odriozola-Serrano

, Soliva-Fortuny

, Martin-Belloso

. Influence of storage temperature on the kinetics of the changes in antho-cyanins, vitamin C, and antioxidant capacity in fresh-cut strawberries stored under high-oxygen atmospheres. Journal of Food Science. 2009;74:184–91.

49.

Macheix

, Fleuriet

, Bilot

Fruit Phenolics. CRC Press, 1990. Inc., Florida.

50.

Bulens

, Van de Poel

, Hertog

MLATM

, De Proft

, Geeraer

, Nicolai

. Influence of harvest time and 1-MCP application on postharvest ripening and ethylene biosynthesis of ‘Jonagold’ apple. Postharvest Biology and Technology. 2012;72:11–9.

51.

Hayama

, Tatsuki

, Ito

, Kashimura

. Ethylene and fruit softening in the stony hard mutation in peach. Postharvest Biology and Technology. 2006;41:16–21.

52.

Khan

, Singh

. 1-MCP application suppresses ethylene biosynthesis and retards fruit softening during cold storage of ‘Tegan Blue’ Japanese plum. Plant Science. 2009;176:539–44.

53.

Klee

, Giovannoni

. Genetics and control of tomato fruit ripening and quality Attributes. Annual Review of Genetics. 2011;45:41–59.

54.

Trainotti

, Pavanello

, Casadoro

55.

Vorwerk

, Somerville

. The role of plant cell wall polysaccharide composition in disease resistance. Trends Plant Science. 2004;9:203–9.

56.

Cheng

, Duan

, Jiang

, Sun

, Yang

, He

, Liang

, Luo

. Modification of hemicellulose polysaccharides during ripening of postharvest banana fruit. Food Chemistry. 2009;115:43–7.

57.

Duan

, Cheng

, Yang

, Yi

, Ruenroengklin

, Lu

, Luo

, Jiang

. Modification of pectin polysaccharides during ripening of postharvest banana fruit. Food Chemistry. 2008;111:144–9.

58.

Chen

, Sun

, Lin

, Hung

, Zhang

, Lin

. Paper-based 1-MCP treatment suppresses cell wall metabolism and delays softening of Huanghua pears during storage. Journal of the Science of Food and Agriculture. 2017; 97:2547–52.

59.

Deng

, Wu

, Li

. Changes in firmness, cell wall composition and cell wall hydrolases of grapes stored in high oxygen atmospheres. Food Research International. 2005;38:769–76.

60.

Brummell

, Harpster

. Cell wall metabolism in fruit softening and quality and its manipulation in transgenic plants. Plant Molecular Biology. 2001;47:311–40.

61.

Marin-Rodriguez

, Orchard

, Seymour

. Pectate lyases, cell wall degradation and fruit softening. Journal of Experimental Botany. 2012;53:2115–9.

62.

Draye

, Van Cutsern

. Pectin methylesterases induce an abrupt increase of acidic pectin during strawberry fruit ripening. Journal of Plant Physiology. 2008;165:1152–60.

63.

Ortiz

, Seymour

, Tucker

, Lara

. Cell wall disassembly during the melting phase of softening in 'Snow Queen' nectarines. Postharvest Biology and Technology. 2010;58:88–92.

64.

Deng

, Zeng

, Zhou

, Huang

. Effects of postharvest oligochitosan treatment on anthracnose disease in citrus (Citrus sinensis L. Osbeck) fruit. European Food Research and Technology. 2015;240:795–804.

65.

Yan

, Li

, Zhao

, Chen

, Cao

, Jiang

. Effects of oligochitosan on postharvest Alternaria rot, storage quality, and defense responses in Chinese jujube (Zizyphus jujuba Mill. cv. Dongzao) fruit. Journal of Food Protection. 2011;74(5):783–8.

66.

, Cao

, Xu

, et al. Effects of 1-methylcyclopropene in combination with chitosan oligosaccharides on post-harvest quality of aprium fruits. Scientia Horticulturae, 2014;179:301–5.

67.

Tongfei

, Yuying

, Boqiang

, Guozheng

, Shiping

. Defense responses of tomato fruit to exogenous nitric oxide during postharvest storage. Postharvest Biology and Technology. 2011;62(2);127–32.

68.

Aghdam

, Asghari

, Babalar

, Sarcheshmeh

MAA

. 8-Impact of salicylic acid on postharvest physiology of fruits and vegetables. Eco-Friendly Technology for Postharvest Produce Quality. 2016;243–68.

69.

Kant

, Arora

. Effects of salicylic acid on postharvest physiology of tomato. Indian Journal of Horticulture. 2014;71(2):247–52.