Red raspberry (poly)phenolic extract improves diet-induced obesity,hepatic steatosis and insulin resistance in obese mice

Abstract

BACKGROUND:

Red raspberry (Rubus idaeus L.), a natural dietary source of (poly)phenols, has been used as medicine for centuries.

OBJECTIVE:

The purpose of this study is to determine the effect of a red raspberry (poly)phenolic extract (RPE) on diet-induced obesity, hepatic steatosis and insulin resistance, and elucidate the underlying molecular mechanisms.

METHODS:

Male specific pathogen-free C57BL/6J mice were randomly divided into three groups (n = 12 per group), and fed with low-fat diet (10% fat energy), high-fat diet (HFD, 45% fat energy), or HFD supplemented with RPE of 150 mg/kg body weight by intragastric administration for 14 weeks. Obesity-related biochemical indexes and hepatic gene expression levels were determined. The statistical analyses were conducted using one-way analysis of variance (ANOVA) followed by Duncan’s multiple range test.

RESULTS:

The body weight gain, steatosis grade scores and insulin resistance index in the RPE group decreased by 34.48% (P = 0.00), 58.82% (P = 0.00), and 53.77% (P = 0.00), respectively, compared to those in the HFD group. Moreover, RPE supplement significantly changed the expression profile of the genes involved in lipid metabolism and fibroblast growth factor 21 signaling pathway.

CONCLUSIONS:

This study demonstrated that RPE protected from diet-induced obesity and related metabolic disorders by improving the lipid metabolism and fibroblast growth factor 21 resistance.

Keywords

Red raspberry obesity hepatic steatosis insulin resistance fibroblast growth factor 21

1 Introduction

Obesity, characterized by an impaired energy homeostasis and excessive fat accumulation, is a complex multifaceted disease resulting from a complex interaction between genetic background and lifestyles [1, 2]. Obesity is a prominent risk factor for inflammation, insulin resistance, type 2 diabetes, non-alcoholic fatty liver disease (NAFLD) and other metabolic disorders [3]. High-fat diet (HFD) can induce obesity and metabolic disorders in animals that resemble the human metabolic syndrome [4]. The traditional drugs for obesity are usually accompanied by certain limitations, such as ineffectiveness and side-effects [5, 6].

Recently, natural bioactive chemicals widely present in plants received growing attention due to their various bioactivities and minimal side effects [7]. Red raspberry (Rubus idaeus L.), a sweet and nutritious berry, is native to Europe and parts of Asia. Red raspberry is becoming increasingly appreciated for its high contents of vitamin C and bioactive (poly)phenols, including primarily anthocyanins and ellagitannins, which possess antioxidant capacities [8]. Evidence showed that supplementation of red raspberry fruit or extracts could reduce the risk of obesity, inflammation and other diseases [9, 10]. A recent study proved the hepatoprotective effect of whole red raspberry-enriched diet in the obese Zucker rat [11]. However, the effects of dietary supplementation of raspberry (poly)phenols on obesity-associated insulin resistance and hepatic steatosis and the underlying mechanisms remained largely unclear.

In the present study, we aimed to investigate a red raspberry (poly)phenolic extract (RPE) regarding its influence on HFD-induced obesity, insulin resistance and hepatic steatosis in mice.

2 Materials and methods

2.1 Preparation of RPE

Red raspberry fruit (Heritage) was purchased from a local market in Hangzhou, China. The berries were freeze-dried by a Freeze Dryer (Labconco FreeZone, USA), and ground into powder. Amberlite XAD7-HP resins were obtained from Sigma-Aldrich (Sigma-Aldrich, Steinheim, Germany). All the other solvents and reagents were purchased from Aladdin (Aladdin, Shanghai, China) and were of analytical or HPLC grade. The raspberry powder was exhaustively extracted with 0.10% HCl in 80% aqueous methanol. Then, the resulting extracts were centrifuged, and the supernatants were filtered. The filtrate was concentrated in the vacuum-rotary evaporation. Afterwards, the concentrate was reconstituted in water, adsorbed onto the XAD-7HP resin column, and eluted with distilled water to remove the natural fruit sugars and acids. The column was then eluted with acidic methanol (0.10% HCl), and the eluate was concentrated, lyophilized to yield RPE. The content of total (poly) phenols was 21.50% (as gallic acid equivalents), determined using the method described previously [12], and the anthocyanin content was 5.30% (as cyanidin-3-glucoside equivalents), determined by using the pH differential method [13].

2.2 Animals and experimental design

Male specific pathogen-free C57BL/6J mice (four weeks old) were obtained from the National Breeder Center of Rodents (Shanghai, China), and raised under controlled temperature (20–26°C) and humidity (55–60 %) conditions with a 12 h light-dark cycle. All mice had free access to food and water. After acclimatization for one week, the mice were divided randomly into three groups (n = 12 per group): low-fat diet (LFD) group, mice were fed LFD; HFD group, mice were fed HFD; RPE group, mice were fed HFD supplemented with RPE. RPE was dissolved in saline, and administered to the mice at a dose of 150 mg extract/kg body weight (32.25 mg gallic acid equivalents/kg body weight, equivalent to 0.79 g extract/day for 65 kg person, an achievable dosage via available supplements) by oral gavage once a day for 14 weeks. The mice in LFD and HFD group received an equal volume of saline. The application of LFD and HFD in establishment of obesity model has been reported in the previous study [14], and the ingredients of the LFD and HFD were listed in Table 1. The body weight and food intake were measured weekly. The oral glucose tolerance test (OGTT) was conducted at week 12, and the insulin tolerance test (ITT) was performed three days after that. At the end of the experiment, the mice were sacrificed after fasting overnight, and the blood was collected to separate the serum by centrifugation (3000 rpm, 10 min). The livers and white epididymal fat pads were excised, then parts of liver and epididymal adipose tissue were washed with saline and fixed in 10% v/v phosphate buffered formalin solution for histologic analysis. The rest of livers were stored at–80°C for further investigations. All the animal experimental protocols conducted in the study were approved by the Committee on the Ethics of Animal Experiments of Zhejiang University (Permission Number: ZJU201550501, May 1, 2015), and the experimental procedures were conducted in accordance with the National Institutes of Health regulations for the care and use of animals in research.

Table 1
Ingredient and composition of diets (%)

Compositions LFD (3.85 kcal/g) HFD (4.73 kcal/g)

Ingredients (g %)

Sucrose 33.17 20.14

Corn starch 29.86 8.48

Casein 18.96 23.31

Cellulose 4.74 5.83

Maltodextrin 3.32 11.65

Lard 1.90 20.68

Soybean oil 2.37 2.91

Potassium citrate 1.56 1.92

Phosphate dicalcium 1.23 1.51

Carbonate calcium 0.50 0.64

Vitamin Mix 0.95 1.16

Mineral Mix 0.95 1.16

L-cystein 0.28 0.35

Choline bitartrate 0.19 0.23

Energy (kcal %)

Protein 20 20

Carbohydrate 70 35

Fat 10 45

Compositions	LFD (3.85 kcal/g)	HFD (4.73 kcal/g)
Ingredients (g %)
Sucrose	33.17	20.14
Corn starch	29.86	8.48
Casein	18.96	23.31
Cellulose	4.74	5.83
Maltodextrin	3.32	11.65
Lard	1.90	20.68
Soybean oil	2.37	2.91
Potassium citrate	1.56	1.92
Phosphate dicalcium	1.23	1.51
Carbonate calcium	0.50	0.64
Vitamin Mix	0.95	1.16
Mineral Mix	0.95	1.16
L-cystein	0.28	0.35
Choline bitartrate	0.19	0.23
Energy (kcal %)
Protein	20	20
Carbohydrate	70	35
Fat	10	45

LFD, low-fat diet; HFD, high-fat diet.

2.3 Biochemical analysis

The serum levels of triglycerides (TG), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), total cholesterol (TCH), alanine aminotransferase (ALT), aspartate transaminase (AST), and glucose were determined by an automatic biochemistry analyzer (ACCUTE TBA-40FR, Toshiba Medical Systems Co., Tochigi, Japan) according to the manufacturer’s instructions. The serum concentration of nonesterified fatty acid (NEFA) was measured using a commercial kit (Wako Chemicals, Richmond, VA, USA). The serum levels of insulin and FGF21 were analyzed using commercial Elisa assay kits (R & D Systems, Minneapolis, MN, USA) according to the manufacture’s protocols. The total lipids of livers were extracted with chloroform: methanol (2:1, v/v) mixture using the Folch method [15], and the concentrations of the liver TG and TCH were measured using available commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s protocols.

2.4 Histological analysis

Histology evaluations were performed on the liver and epididymal adipose by hematoxylin-eosin (HE) staining and/or Oil Red O staining. The images were captured by an Olympus CX41 camera (Olympus, Tokyo, Japan), and the steatosis grades were calculated as previously described [16].

2.5 Glucose homeostasis

OGTT and ITT were conducted as previously reported [17], with slight modifications. Briefly, the mice were fasted for 12 h and administrated glucose orally (2 g/kg) for the OGTT, or were fasted 4 h and injected intraperitoneally with insulin (0.5 U/kg) for the ITT. The blood samples were collected from the tail-vein to determine the glucose concentrations at the selected time points of 0, 30, 60, 90, and 120 min, respectively, using a blood glucose meter (Accu-Check, Roche, Dublin, Ireland). Homeostatic Model Assessment of insulin resistance (HOMA-IR) and insulin sensitivity (IS) indexes were calculated, as previously described [16].

2.6 Gene expression analysis

Total RNA was extracted from liver by using TRIzol reagent (Invitrogen Carlsbad, CA, USA). cDNA was synthesized by using a reverse transcription kit (TaKaRa, Dalian, Liaoning, China). Quantitative Real-Time PCR was conducted on ABI 7500 system (Applied Biosystems, Foster, CA, USA) by using SYBR Green qPCR Master Mix (Roche Diagnostics Ltd, Lewes, UK). Specific forward and reverse primer sequences were listed in Table 2. The expression level of each gene was normalized to the reference gene, β-actin, and calculated using 2^-^ΔΔCt method [18].

Table 2
The primer sequences used for real-time PCR analysis

Gene Sequence of forward primers (5^′ to 3^′) Sequence of reverse primers (5^′ to 3^′)

Fads2 CACTTAAAGGGTGCCTCAGC CCAAGGACAAACACATGCAG

Fas AGGGGTCGACCTGGTCCTCA GCCATGCCCAGAGGGTGGTT

Scd1 CCGAAGAGGCAGGTGTAGAG TTCTTACACGACCACCACCA

Acox1 GTTCTCACGATGCCAATGC ATGCTGGGGTTACAGGTTTG

Cpt1a TTTGAATCGGCTCCTAATGG CCCAAGTATCCACAGGGTCA

HMGcoR GAGCGTGAACAAGGACCAAG CAGCCATTTTGCCAGAGTTT

Insig1 GTGGAGCTTGCAATCTGTGA CTTCTCCGGAATAGCTCGTG

Insig2 TTCTGGTAGGTCCCACGTTC TTCACACTCTGGCTGGTGAC

Ppar γ GCATTTCTGCTCCACACTATGA TCGCACTTTGGTATTCTTGG

Srebf1 GGAGCCATGGATTGCACATT GCTTCCAGAGAGGAGGCCAG

Fgf21 CGCAGTCCAGAAAGTCTCCT ATTGTAACCGTCCTCCAGCA

Klb TCACCCACTACCAGTTTGCTC CTTCGCTCACCACACACCTA

Fgfr1 GGACTCTCCCATCACTCTGC GGTGCCGCTCTTCATCTTAT

Fgfr2 CCGCTGGTGAGGATAACAAC ATGACTACTTGCCCGAAGCA

β-actin GTGCTATGTTGCTCTAGACTTCG ATGCCACAGGATTCCATACC

Gene	Sequence of forward primers (5^′ to 3^′)	Sequence of reverse primers (5^′ to 3^′)
Fads2	CACTTAAAGGGTGCCTCAGC	CCAAGGACAAACACATGCAG
Fas	AGGGGTCGACCTGGTCCTCA	GCCATGCCCAGAGGGTGGTT
Scd1	CCGAAGAGGCAGGTGTAGAG	TTCTTACACGACCACCACCA
Acox1	GTTCTCACGATGCCAATGC	ATGCTGGGGTTACAGGTTTG
Cpt1a	TTTGAATCGGCTCCTAATGG	CCCAAGTATCCACAGGGTCA
HMGcoR	GAGCGTGAACAAGGACCAAG	CAGCCATTTTGCCAGAGTTT
Insig1	GTGGAGCTTGCAATCTGTGA	CTTCTCCGGAATAGCTCGTG
Insig2	TTCTGGTAGGTCCCACGTTC	TTCACACTCTGGCTGGTGAC
Ppar γ	GCATTTCTGCTCCACACTATGA	TCGCACTTTGGTATTCTTGG
Srebf1	GGAGCCATGGATTGCACATT	GCTTCCAGAGAGGAGGCCAG
Fgf21	CGCAGTCCAGAAAGTCTCCT	ATTGTAACCGTCCTCCAGCA
Klb	TCACCCACTACCAGTTTGCTC	CTTCGCTCACCACACACCTA
Fgfr1	GGACTCTCCCATCACTCTGC	GGTGCCGCTCTTCATCTTAT
Fgfr2	CCGCTGGTGAGGATAACAAC	ATGACTACTTGCCCGAAGCA
β-actin	GTGCTATGTTGCTCTAGACTTCG	ATGCCACAGGATTCCATACC

Acox1, acyl-coenzyme A oxidase 1; Cpt1a, carnitine palmitoyltransferase 1a; Fads2, fatty acid desaturase 2; Fas, fatty acid synthase; Fgfr1; fibroblast growth factor receptor 1; Fgfr2; fibroblast growth factor receptor 2; Fgf21; fibroblast growth factor 21; HMGCoR, 3-hydroxy-3-methyl-glutaryl CoA reductase; Insig1, insulin-induced gene 1; Insig2, insulin-induced gene 2; Klb; β-Klotho; Ppar γ, peroxisome proliferator-activated receptor gamma; Scd1, stearoyl-CoA desaturase 1; Srebf1, sterol regulatory element binding transcription factor 1.

2.7 Statistical analysis

All experimental data were presented as mean±standard deviation (SD). The areas under the OGTT or ITT curves (AUC) were calculated by GraphPad Prism 7.0 software. The statistical analysis was performed by SPSS 22.0 statistical software, and non-normal data was transformed to normal data by log transformation. The statistical significances were analyzed by one-way analysis of variance (ANOVA) followed by Duncan’s multiple range test. P < 0.05 was considered statistically significant.

3 Results

3.1 Effect of RPE on body weight and food intake in mice

As shown in Table 3, there was no significant difference in the initial body weights among the groups (P > 0.05). After 14 weeks, the mice in the HFD group increased more body weights as compared to those fed LFD, while RPE supplement significantly decreased the body weight and weight gain compared to the HFD group (P = 0.00). There were no differences in the food (P = 0.92) or energy intake (P = 0.93) between the HFD group and the RPE group (P > 0.05).

Table 3
Body weight and food intake in mice

Items LFD HFD RPE

Initial BW (g) 19.40±0.98 19.56±1.10 19.49±1.09

Final BW (g) 29.29±2.25^a 47.30±3.01^b 37.66±3.04^c

BW gain (g) 9.89±2.00^a 27.73±3.57^b 18.17±3.14^c

Liver weight/BW (%) 3.56±0.32^a 2.95±0.57^b 3.30±0.61^ab

Food intake (g/mouse/day) 3.16±0.17^a 2.94±0.25^b 2.93±0.25^b

Calorie intake (kcal/mouse/day) 12.16±0.65^a 13.90±1.20^b 13.86±1.20^b

Items	LFD	HFD	RPE
Initial BW (g)	19.40±0.98	19.56±1.10	19.49±1.09
Final BW (g)	29.29±2.25^a	47.30±3.01^b	37.66±3.04^c
BW gain (g)	9.89±2.00^a	27.73±3.57^b	18.17±3.14^c
Liver weight/BW (%)	3.56±0.32^a	2.95±0.57^b	3.30±0.61^ab
Food intake (g/mouse/day)	3.16±0.17^a	2.94±0.25^b	2.93±0.25^b
Calorie intake (kcal/mouse/day)	12.16±0.65^a	13.90±1.20^b	13.86±1.20^b

LFD, low-fat diet; HFD, high-fat diet; RPE, red raspberry polyphenolic extract; BW, body weight. Values are presented as means±SD (n = 12). Means not sharing a common superscript differ significantly among treatments (p < 0.05, ANOVA).

3.2 Effect of RPE on serum lipid parameters in mice

In the serum lipid parameters, the levels of TG, TCH, LDL-C and NEFA in the mice fed HFD were higher compared to those in the LFD group (P < 0.05), while RPE supplement significantly decreased the levels of the above elevated parameters (P < 0.05; Fig. 1A, B, C, D). The concentration of HDL-C was not significantly different in the RPE group compared to the HFD group (Fig. 1E).

Fig. 1

RPE improved the serum lipid profile in mice. (A) Triglycerides (TG). (B) Nonesterified fatty acid (NEFA). (C) Total cholesterol (TCH). (D) Low-density lipoprotein cholesterol (LDL-C). (E) High-density lipoprotein cholesterol (HDL-C). HFD, high-fat diet; LFD, low-fat diet; RPE, red raspberry (poly)phenolic extract. n = 12. Data are expressed as means±SD. Values not sharing a common superscript differ significantly among groups (p < 0.05, ANOVA).

3.3 Effect of RPE on hepatic steatosis and adipose tissue hypertrophy in mice

Histology analysis revealed that RPE supplement alleviated HFD-induced lipid accumulation and formation of steatosis in the liver, accompanied by lower liver weights, hepatic TG and TCH levels, and steatosis grades compared to the HFD group (P < 0.05; Fig. 2A, B, D, E, F, G). The serum ALT and AST levels were also significantly decreased by RPE compared with the HFD group (P < 0.05; Fig. 2H, I). In addition, HE staining of epididymal adipose tissue revealed that RPE supplement minimized the enlarged cell size of adipocyte in HFD-fed mice (Fig. 2C).

Fig. 2

RPE attenuated high-fat diet-induce hepatic steatosis and adipose hypertrophy in mice. (A) H&E staining of liver. (B) Oil red O staining of liver. (C) H&&E staining of epididymal white adipose tissue. (D) Liver weight. (E) Hepatic triglycerides (TG). (F) Hepatic total cholesterol (TCH) levels. (G) Steatosis grade score. (H) Serum alanine aminotransferase (ALT) levels. (I) Serum aspartate transaminase (AST) levels. HFD, high-fat diet; LFD, low-fat diet; RPE, red raspberry (poly)phenolic extract. n = 6 (A, B, C, G), n = 12 (D, E, F, H, I). Data are expressed as mean±SD. Values not sharing a common superscript differ significantly among groups (P < 0.05).

3.4 Effect of RPE on glucose homeostasis in mice

The OGTT and ITT showed that the glucose level in the RPE group was higher than that in the LFD group but lower than in the HFD group at 30, 60, 90 and 120 min, respectively (P < 0.05; Fig. 3A, C). The corresponding AUC values of OGTT and ITT were also significantly decreased by RPE supplement compared with the HFD group (P < 0.05; Fig. 3B, D). Furthermore, long-term HFD feeding induced significant elevations in the serum concentrations of fasting glucose and insulin, accompanied by a higher HOMA-IR but lower IS index compared with the LFD group, while RPE supplement decreased the levels of serum glucose and insulin with a lower HOMA-IR but higher IS index compared with the HFD group (P < 0.05; Fig. 3E, F, G, H).

Fig. 3

RPE improved glucose homeostasis in mice. (A) Oral glucose tolerance test (OGTT). (B) Area under the curve of OGTT. (C) Insulin tolerance test (ITT). (D) Area under the curve of ITT. Fasting serum glucose (E) and insulin (F). Homeostatic Model Assessment of insulin resistance (HOMA-IR; G) and insulin sensitivity (IS) indexes (H). HFD, high-fat diet; LFD, low-fat diet; RPE, red raspberry (poly)phenolic extract. n = 6 (A, B, C, D), n = 12 (E, F, G, H). Data are expressed as mean±SD. Values not sharing a common superscript differ significantly among groups (P < 0.05).

3.5 Effect of RPE on FGF 21 resistance in mice

The serum level of FGF21 in the HFD group was significantly higher than that in the LFD group (P = 0.00; Fig. 4A), and gene expression analysis revealed that HFD feeding significantly upregulated the expression of Fgf21, and downregulated the expressions of FGF21 signaling-related genes, such as β-Klotho (Klb), fibroblast growth factor receptor 1 (Fgfr1) and fibroblast growth factor receptor 2 (Fgfr2) compared to the LFD group (P < 0.05; Fig. 4B). While, RPE supplement significantly decreased the serum level of FGF21 compared to the HFD group (P < 0.05; Fig. 4A), and downregulated the expression of Fgf21, but upregulated the expression of Klb, Fgfr1 and Fgfr2 (P < 0.05; Fig. 4B).

Fig. 4

RPE improved FGF21 resistance in mice. (A) Serum level FGF21. (B) The relative gene expression levels of fibroblast growth factor 21 (FGF21), β-Klotho (Klb), and fibroblast growth factor receptor 1 (Fgfr1) and fibroblast growth factor receptor 2 (Fgfr2). HFD, high-fat diet; LFD, low-fat diet; RPE, red raspberry (poly)phenolic extract. n = 12 (A), n = 4 (B). Data are expressed as mean±SD. Values not sharing a common superscript differ significantly among groups (P < 0.05).

3.6 Effect of RPE on the expression profile of the lipid metabolism-related genes

As shown in Fig. 5A, compared to the LFD group, HFD feeding significantly promoted the expression of lipogenesis-related genes, such as fatty acid synthesis (Fas), fatty acid desaturase 2 (Fads2), and stearoyl-CoA desaturase 1 (Scd1), while RPE supplement significantly suppressed the expression of the above-mentioned genes compared to the HFD group (P < 0.05). Furthermore, the expression levels of fatty acid oxidation-related genes, arnitine palmitoyltransferase 1a (Cpt1a), and acyl-coenzyme A oxidase 1(Acox1) were all decreased in the HFD group compared to the LFD group, while RPE supplement dramatically upregulated the expression of Cpt1a and Acox1 (P < 0.05; Fig. 5B). In addition, among the genes related to cholesterol metabolism, our result revealed that HFD feeding upregulated the expression of 3-hydroxy-3-methyl-glutaryl CoA reductase (HMGCoR), and decreased the expression levels of insulin-induced gene 1 (Insig1) and insulin-induced gene 2 (Insig2), while these effects were significantly reversed by RPE supplement (P < 0.05; Fig. 5C). Furthermore, the expression levels of peroxisome proliferator-activated receptor gamma (Ppar γ) and sterol regulatory element binding transcription factor 1 (Srebf1) in RPE group were found to be higher than the LFD group but lower than the HFD group (P < 0.05; Fig. 5D).

Fig. 5

RPE changed the expression profile of lipid metabolism-related genes in mice The relative expression levels of genes involved in lipogenesis (A), lipolysis (B), and cholesterol metabolism (C). Acox1, acyl-Coenzyme A oxidase 1; Cpt1a, carnitine palmitoyltransferase 1a; Fads2, fatty acid desaturase 2; Fas, fatty acid synthase; HFD, high-fat diet; Insig1, insulin-induced gene 1; HMGCoR, 3-hydroxy-3-methyl-glutaryl CoA reductase; Insig2, insulin-induced gene 2; LFD, mice fed low-fat diet; RPE: red raspberry (poly)phenolic extract; Scd1, stearoyl-CoA desaturase 1. n = 4. Data are expressed as means±SD. Values not sharing a common superscript differ significantly among groups (P < 0.05).

4 Discussion

Studies that advance the positive biological effects of berry consumption continue to increase in the past decades [19 –22]. Especially, red raspberry and its constituents are reported to be potentially useful in health management and treatment of metabolic syndrome [23, 24]. The goal of this study is to focus on the beneficial effects of red raspberry (poly)phenolic extract on HFD-induced obesity, insulin resistance and hepatic steatosis.

Several animal studies reported that dietary whole raspberry or its extracts could reduce the plasm levels of TG, TCH and LDL-C, and increase the level of HDL-C [11 , 26]. A clinical trial reported that mulberry consumption ameliorated TCH and LDL-C concentrations, but no change in TG and HDL-C were observed [27]. Consistent with the previous studies, our results indicated that RPE supplement not only induced a significant reduction in HFD-induced body weight, but also decreased the serum levels of TG, TCH, LDL-C and NEFA. These observations suggested that the (poly)phenolic compounds in red raspberry might be the key contributors to attenuate the risk of obesity and hyperlipidemic. HDL-C is usually referred to be good cholesterol due to its ability to transport the fat molecules, including triglycerides and cholesterol out of artery walls, and most saturated fats or a high-fat diet may increase the level of HDL-C through beta-hydroxybutyrate coupling the Niacin receptor 1 [28]. Consistently, our results showed that the HDL-C level was increased by HFD feeding, but not affected by RPE treatment. In addition, we found that there were no differences in the daily food or energy intake among the different dietary groups, suggesting that RPE decreased HFD-induced body weight, and improved hyperlipidemic without affecting the energy intake of mice.

As a common complication of obesity, hepatic steatosis is characterized by the accumulation of abnormal amounts of fat within the hepatocytes, and can progress to cause nonalcoholic steatohepatitis (NASH), fibrosis, cirrhosis, and hepatocellular carcinoma cirrhosis, and it is considered a preliminary stage of NAFLD [29]. Strawberry extract was reported to attenuate lipid accumulation in HepG2 cells in vitro. Whole red raspberry-enriched diet was reported to inhibit the accumulation of liver TG, suggesting a possible hepatoprotective role of red raspberry in the obese Zucker rat [11]. In the present study, our results revealed that the mice with HFD-induced obesity developed a severe hepatic steatosis, and RPE supplement significantly attenuated the hepatic fatty infiltration and the formation of steatosis. Consistently, biochemistry analysis revealed that RPE treatment also significantly decreased the hepatic TG and TCH, and the serum ALT and AST levels, suggesting a restored liver function.

Fatty acid synthase (Fas) catalyzes the de novo synthesis of fatty acids, and it can produce fat for storage of energy when nutrients are present in excess in the liver [31]. Fatty acid desaturase 2 (Fads2) regulates unsaturation of fatty acids through the introduction of double bonds between defined carbons of the fatty acyl chain [32]. Stearoyl-CoA desaturase 1 (Scd1), a lipid metabolism enzyme, is involved in the synthesis and regulation of unsaturated fatty acids [33]. Hepatic gene expression analysis indicated that RPE supplement downregulated the expression of Fas, Fads2 and Scd1, indicating that RPE supplement could suppresses the de novo lipogenesis by suppression of the expression of lipogenic genes and the transcription factors Ppar γ and Srebf1. Supplementation of whole red raspberry-enriched diet was reported to induce upregulation of microsomal triglyceride transfer protein (Mttp) and downregulation of Fas in the liver of Zucker rat, which suggested the inhibitory effect of red raspberry on lipogenesis [11]. However, no increased lipid oxidation with red raspberry was observed in the previous study. In the present study, the results showed RPE supplement significantly increased the expression of Acyl-coenzyme A oxidase 1 (Acox1) and carnitine palmitoyltransferase 1a (Cpt1a), which are rate-limiting enzymes in fatty acid β-oxidation, and they play a key role in fatty acid metabolism and fat deposition [34, 35], indicating that RPE could induce lipolysis by promoting fatty acid β-oxidation. Furthermore, dietary PPA downregulated the expression of hydroxy-3-methylglutaryl-coenzyme A reductase (HMGCoR), and upregulated the expression of insulin induced gene 1 (Insig1) and insulin induced gene 1 (Insig2). HMGCoR is a rate-limiting enzyme in the cholesterol biosynthesis pathway [36], and Insig1 and Insig2 encode proteins which bind to HMGCoR, and leads to the ubiquitination and degradation of the reductase [37]. Our findings revealed that RPE could decrease the cholesterol synthesis by suppressing the HMGCoR expression and promoting the degradation of this reductase. These data indicated that the regulation of lipid and cholesterol metabolism by RPE supplement might be one of the potential mechanisms underlying the hypolipemic and hypocholesterolemic activities of RPE.

Obesity is commonly associated with insulin resistance, hyperinsulinemia and hyperglycemia, thus increasing the risk of type 2 diabetes [38]. Consistently, we found that the mice with HFD-induced obesity had significantly higher fasting serum glucose and insulin levels, and developed severe insulin resistance compared to the LFD-fed mice. In addition, liver is a major organ involved in glucose homeostasis. Excess hepatic lipid and development of NAFLD may cause severe insulin resistance and type 2 diabetes [39]. The hepatoprotective activity of RPE may also contribute to alleviating insulin resistance induced by HFD feeding. A clinical study reported that dietary intervention with strawberry and cranberry (poly)phenols improved insulin sensitivity in overweight and obese non-diabetic, insulin-resistant human subjects [40]. Maqui berry extract was reported to reduce fasting and postprandial glycemia and insulinemia in pre-diabetic adults [41]. Wilson et al. also reported the role of raw and dried cranberries in decreasing postprandial blood glucose and insulin in adults with type 2 diabetes [42].

A limited number of studies also reported that whole raspberry fruit consumption reduced insulin resistance, and improved insulin sensitivity in skeletal muscle of mice fed HFD [10, 43], but the bioactive components in the fruit and the underlying mechanisms still remained unclear. Our results showed that RPE significantly decreased the serum levels of glucose and insulin, reduced insulin resistance and glucose intolerance, and improved insulin sensitivity compared to the mice fed HFD alone, suggesting that the (poly)phenols might be the main constituents responsible for the beneficial effects of red raspberry on glucose homeostasis.

FGF-21, mainly secreted by the liver, regulates nutritional status through the control of glucose, lipid, and energy metabolism [44]. Emerging evidence shows that administration of exogenous FGF21 may improve metabolic disorders, for instance, improving glucose tolerance, insulin sensitivity and hyperlipemia, regulating lipid oxidation, attenuating hepatic steatosis and reducing body weights [44, 45]. However, the endocrine FGF21 levels are often significantly increased in obesity, glucose intolerance, insulin resistance, and hypertriglyceridemia and liver injury states, suggesting a state of FGF21 resistance due to the impaired FGF21 action in pathological state [46 –48]. In this study, Both the fasting serum FGF21 and the hepatic expression level of Fgf21 were significantly increased in the mice with obesity, which was consistent with the previous findings, indication the compensatory overproduction of endocrine FGF21 in obese state. The endocrine FGF21 requires both fibroblast growth factor receptor (FGFR) and β-Klotho for eliciting the intracellular signaling cascades [49]. Our results indicated that HFD feeding decreased the expression of Klb, Fgfr1 and Fgfr2, suggesting that obesity was accompanied with an impaired action of FGF21. While, RPE supplement significantly upregulated the expression of Klb, Fgfr1 and Fgfr2, but downregulated the expression of Fgf21, and decreased the serum level of FGF21. These data implied that RPE may directly or indirectly improved the expression profile of FGF21 receptor/co-receptor signaling complex receptors, thus attenuating the FGF21 resistance and contributing to its anti-obesity, anti-diabetic and anti-hepatosteatosis effects.

However, one limitation of the study must be acknowledged. Although our study proved the beneficial effects of REP on HFD-induced obesity, hepatic steatosis, and insulin resistance, the specific compound, which is mainly responsible for the beneficial effects of red raspberry, needs to be confirmed in future studies.

5 Conclusions

In summary, REP supplement protected from diet-induced obesity, hepatic steatosis and insulin resistance in mice. The beneficial effects of RPE were associated with the improved lipid and cholesterol metabolism and attenuated FGF21 resistance. This research suggested a potential dietary choice of RPE in the management of obesity, type II diabetes and NAFLD.

Footnotes

Acknowledgments

This research was supported by the National Natural Science Foundation of China (31701031) China Postdoctoral Science Foundation (2016M601006).

Conflict of interest

The authors have no conflict of interest to report.

References

Despres

, Lemieux

. Abdominal obesity and metabolic syndrome. Nature. 2006;444:881–7.

Delzenne

, Rodriguez

, Olivares

, Neyrinck

. Microbiome response to diet: focus on obesity and related diseases. Rev Endocr Metab Disord. 2020;21:369–80.

Jia

. Obesity, metabolic syndrome and bariatric surgery: A narrative review. J Diabetes Investig. 2020;11:294–6.

Marques

, Meireles

, Norberto

, Leite

, Freitas

, Pestana

, et al. High-fat diet-induced obesity Rat model: a comparison between Wistar and Sprague-Dawley Rat. Adipocyte. 2016;5:11–21.

Yun

. Possible anti-obesity therapeutics from nature–a review. Phytochemistry. 2010;71:1625–41.

Powell

, Khera

. Therapeutic approaches to obesity. Curr Treat Options Cardiovasc Med. 2010;12:381–95.

, Jiang

, Guo

, Su

. Natural Products with Anti-obesity Effects and Different Mechanisms of Action. Journal of Agricultural and Food Chemistry. 2016;64:9571–85.

Mullen

, McGinn

, Lean

MEJ

, MacLean

, Gardner

, Duthie

, et al. Ellagitannins, Flavonoids, and Other Phenolics in Red Raspberries and Their Contribution to Antioxidant Capacity and Vasorelaxation Properties. Journal of Agricultural and Food Chemistry. 2002;50:5191–6.

Burton-Freeman

, Sandhu

, Edirisinghe

. Red Raspberries and Their Bioactive Polyphenols: Cardiometabolic and Neuronal Health Links. Adv Nutr. 2016;7:44–65.

10.

Zhao

, Zou

, Gomez

, Wang

, Zhu

, Du

. Raspberry alleviates obesity-induced inflammation and insulin resistance in skeletal muscle through activation of AMP-activated protein kinase (AMPK) α1. Nutr Diabetes. 2018;8:39.

11.

VandenAkker

, Vendrame

, Tsakiroglou

, McGilvrey

, Klimis-Zacas

. Whole Red Raspberry (Rubus idaeus)-Enriched Diet Is Hepatoprotective in the Obese Zucker Rat, a Model of the Metabolic Syndrome. J Med Food. 2020.

12.

Singleton

, Orthofer

, Lamuela-Raventós

. Analysis of total phenols and other oxidation substrates and antioxidants by means of folin-ciocalteu reagent. Methods Enzymol: Academic Press; 1999. pp. 152–78.

13.

Lee

, Durst

, Wrolstad

. Determination of total monomeric anthocyanin pigment content of fruit juices, beverages, natural colorants, and wines by the pH differential method: collaborative study. J AOAC Int. 2005;88:1269–78.

14.

, Qi

, Liu

, Guo

, Zhu

, Chen

, et al. Dietary supplementation with purified mulberry (Morus australis Poir) anthocyanins suppresses body weight gain in high-fat diet fed C57BL/6 mice. Food Chem. 2013;141:482–7.

15.

Folch

, Lees

, Sloane Stanley

. A simple method for the isolation and purification of total lipides from animal tissues. J Biol Chem. 1957;226:497–509.

16.

Song

, Chu

, Xu

, Zheng

. Purified Betacyanins from Hylocereus undatus Peel Ameliorate Obesity and Insulin Resistance in High-Fat-Diet-Fed Mice. J Agric Food Chem. 2016;64:236–44.

17.

Nagy

, Einwallner

. Study of In Vivo Glucose Metabolism in High-fat Diet-fed Mice Using Oral Glucose Tolerance Test (OGTT) and Insulin Tolerance Test (ITT). J Vis Exp. 2018; 56672.

18.

Livak

, Schmittgen

. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402–8.

19.

Seeram

, Shukitt-Hale

. Advances in berry research: The sixth Biennial Berry Health Benefits Symposium. Journal of Berry Research. 2016;6:93–5.

20.

Giampieri

, Alvarez-Suarez

, Cordero

, Gasparrini

, Forbes-Hernandez

, Afrin

, et al. Strawberry consumption improves aging-associated impairments, mitochondrial biogenesis and functionality through the AMP-activated protein kinase signaling cascade. Food Chem. 2017;234:464–71.

21.

Klimis-Zacas

, Vendrame

, Kristo

. Wild blueberries attenuate risk factors of the metabolic syndrome. Journal of Berry Research. 2016;6:225–36.

22.

Forbes-Hernández

, Cianciosi

, Ansary

, Mezzetti

, Bompadre

, Quiles

, et al. Strawberry (Fragaria×ananassa cv. Romina) methanolic extract promotes browning in 3T3-L1 cells. Food Funct. 2020;11:297–304.

23.

Rao

, Snyder

. Raspberries and human health: a review. J Agric Food Chem. 2010;58:3871–83.

24.

VandenAkker

, Vendrame

, Tsakiroglou

, Klimis-Zacas

. Red raspberry (Rubus idaeus) consumption restores the impaired vasoconstriction and vasorelaxation in the aorta of the obese zucker rat, a model of the metabolic syndrome. Journal of Berry Research. 2021;11: DOI: 10.3233/JBR-200567.

25.

Kirakosyan

, Seymour

, Kondoleon

, Gutierrez

, Wolforth

, Bolling

. The intake of red raspberry fruit is inversely related to cardiac risk factors associated with metabolic syndrome. J Funct Foods. 2018;41:83–9.

26.

Khan

, Sharma

, Bhandari

, Ali

, Haque

. Raspberry ketone protects against isoproterenol-induced myocardial infarction in rats. Life Sci. 2018;194:205–12.

27.

Pavadhgul

, Sirikanchanarod

, Bumrungpert

, Kaewruang

, Senawong

. The Effect of Mulberry Fruits Consumption on Lipid Profiles in Hypercholesterolemic Subjects: A Randomized Controlled Trial. Journal of Pharmacy and Nutrition Sciences. 2016;6:7–14.

28.

Soudijn

, van Wijngaarden

, Ijzerman

. Nicotinic acid receptor subtypes and their ligands. Med Res Rev. 2007;27:417–33.

29.

, Li

. Role of farnesoid X receptor in hepatic steatosis in nonalcoholic fatty liver disease. Biomed Pharmacother. 2020;121:109609.

30.

Forbes-Hernández

, Giampieri

, Gasparrini

, Afrin

, Mazzoni

, Cordero

, et al. Lipid Accumulation in HepG2 Cells Is Attenuated by Strawberry Extract through AMPK Activation. Nutrients. 2017;9:621.

31.

Jensen-Urstad

, Semenkovich

. Fatty acid synthase and liver triglyceride metabolism: housekeeper or messenger? Biochim Biophys Acta. 2021;1821:747–53.

32.

Zhao

, Yang

, Wu

, Cao

, Gao

. Integrated transcriptome and phosphoproteome analyses reveal that fads2 is critical for maintaining body LC-PUFA homeostasis. J Proteomics. 2020;229:103967.

33.

Piccinin

, Ntambi

, Moschetta

. Chapter 22 - Lipid metabolism and signaling in cancer. In: Ntambi JM, editor. Lipid Signaling and Metabolism: Academic Press; 2020. pp. 455–67.

34.

Jiao

, Zan

, Liu

, Wang

. Molecular characterization, polymorphism of the ACOX1 gene and association with ultrasound traits in Bos taurus. Genet Mol Res. 2011;10:1948–57.

35.

Schlaepfer

, Joshi

. CPT1A-mediated Fat Oxidation, Mechanisms, and Therapeutic Potential. Endocrinology. 2020;161:bqz046.

36.

Hwang

, Hartman

, Calhoun

, Garland

, Young

, Mitsche

, et al. Contribution of Accelerated Degradation to Feedback Regulation of 3-Hydroxy-3-methylglutaryl Coenzyme A Reductase and Cholesterol Metabolism in the Liver. J Biol Chem. 2016;291:13479–94.

37.

Sever

, Song

, Yabe

, Goldstein

, Brown

, DeBose-Boyd

. Insig-dependent ubiquitination and degradation of mammalian 3-hydroxy-3-methylglutaryl-CoA reductase stimulated by sterols and geranylgeraniol. J Biol Chem. 2003;278:52479–90.

38.

Garciaserrano

, Duarte

JMN

. Brain Metabolism Alterations in Type 2 Diabetes: What Did We Learn From Diet-Induced Diabetes Models? Front Neurosci. 2020;14:229.

39.

Perry

, Samuel

, Petersen

, Shulman

. The role of hepatic lipids in hepatic insulin resistance and type 2 diabetes. Nature. 2014;510:84–91.

40.

Solverson

, Henderson

, Debelo

, Ferruzzi

, Baer

, Novotny

. An Anthocyanin-Rich Mixed-Berry Intervention May Improve Insulin Sensitivity in a Randomized Trial of Overweight and Obese Adults. Nutrients. 2019;11:2876.

41.

Alvarado

, Leschot

, Olivera-Nappa

, Salgado

, Rioseco

, Lyon

, et al. Delphinidin-Rich Maqui Berry Extract (Delphinol®) Lowers Fasting and Postprandial Glycemia and Insulinemia in Prediabetic Individuals during Oral Glucose Tolerance Tests. Biomed Res Int. 2016;2016:9070537.

42.

Wilson

, Luebke

, Morcomb

, Carrell

, Leveranz

, Kobs

, et al. Glycemic responses to sweetened dried and raw cranberries in humans with type 2 diabetes. J Food Sci. 2010;75:H218–23.

43.

Zou

, Kang

, Wang

, de Avila

, You

, Zhu

M-J

, et al. Raspberry supplementation reduces lipid accumulation and improves insulin sensitivity in skeletal muscle of mice fed a high-fat diet. J Funct Foods. 2019;63:103572

44.

Matikainen

. Chapter 39 - Fibroblast Growth Factor 21 is a Regulator of Energy Metabolism in the Liver and Adipose Tissue. In: Watson RR, editor. Nutrition in the Prevention and Treatment of Abdominal Obesity. San Diego: Academic Press; 2014. pp. 461–72.

45.

, Lloyd

, Hale

, Stanislaus

, Chen

, Sivits

, et al. Fibroblast Growth Factor 21 Reverses Hepatic Steatosis, Increases Energy Expenditure, and Improves Insulin Sensitivity in Diet-Induced Obese Mice. Diabetes. 2009;58:250–9.

46.

Chavez

, Molina-Carrion

, Abdul-Ghani

, Folli

, DeFronzo

, Tripathy

. Circulating Fibroblast Growth Factor-21 Is Elevated in Impaired Glucose Tolerance and Type 2 Diabetes and Correlates With Muscle and Hepatic Insulin Resistance. Diabetes care. 2009;32:1542–6.

47.

Zhang

, Yeung

DCY

, Karpisek

, Stejskal

, Zhou

, Liu

, et al. Serum FGF21 levels are increased in obesity and are independently associated with the metabolic syndrome in humans. Diabetes. 2008;57:1246–53.

48.

, Bao

, Xu

, Pan

, Lu

, Wu

, et al. Serum Fibroblast Growth Factor 21 Is Associated with Adverse Lipid Profiles and gamma-Glutamyltransferase But Not Insulin Sensitivity in Chinese Subjects. J Clin Endocr Metab. 2009;94:2151–6.

49.

Yie

, Wang

, Deng

, Tam

, Stevens

, Chen

, et al. Understanding the physical interactions in the FGF21/FGFR/β-Klotho complex: structural requirements and implications in FGF21 signaling. Chem Biol Drug Des. 2012;79:398–410.