Genetic architecture of morin (pentahydroxyflavone) biosynthetic pathway in mulberry ( Morus notabilis ): an in silico approach

Abstract

BACKGROUND:

Morin, (3,5,7,2′,4′-pentahydroxyflavone), is a polyphenolic compound belonging to bio-flavonoids and is predominantly isolated from the family Moraceae. Previous studies demonstrated the health benefits of morin using human and animal models. Despite its importance as a bioactive compound, the genetic architecture of the morin biosynthetic pathway is still unclear.

OBJECTIVE:

To understand the genetic architecture of the morin biosynthetic pathway, the following components were analyzed: (1) cis-responsive element (CRE)-mediated regulation, (2) microRNAs (miRNA)-mediated post-transcriptional silencing, and (3) tissue-specific in silico gene expression.

METHODS:

To understand the genetic architecture of morin biosynthetic pathway, in silico survey was carried out using different web servers (MorusDB, MEME suite, NCBI database, PlantCARE, and psRNATarget) and collected mRNA, protein sequences, and expressed microarray data. TBtools was employed for depicting protein and promoter motifs and the heatmap preparation of tissue-specific expression of genes involved in the morin biosynthesis.

RESULTS:

The current data mining study highlighted the morin biosynthetic pathway associated genes, namely, phenylalanine ammonia-lyase (MnPAL), chalcone synthase A (MnCSA), chalcone-flavonone isomerase (MnCFI), and flavonoid 3′,5′-hydroxylase (MnFH) are transcriptionally regulated by different growth, development, and stress-responsive CREs. Differential expression profiles shown MnPAL (L484_024373) and MnCFI (L484_011241) genes were upregulated across selected tissues. Moreover, miRNA-mediated post-transcriptional silencing was identified.

CONCLUSIONS:

This study will improve our understanding of morin biosynthesis, and it can improve production via metabolic engineering.

Keywords

Morin Flavonol gene expression microRNA

1 Introduction

Recent advances in nutritional genomics have focused on the importance of gene–nutrient interaction to prescribe natural ingredients and/or their active components to their patients and maximize health benefits. Interestingly, the current trends of medicinal and pharmaceutical research primarily focused on natural products specifically obtained from plants. Morin, 3,5,7,2′,4′-pentahydroxyflavone, is a natural flavonol for many types of plants, although it is predominantly isolated from plants belonging to the Moraceae family and it is recognized as a broad spectrum bioactive compound comprising a wide range of pharmacological properties with extremely low cytotoxicity [1, 2]. Recent findings suggest that treatment with morin can protect against different neurotoxicity induced by acrylamide [3], ifosfamide [4] and effectively reduce oxidative stress, inflammation, and apoptosis during the heart and brain damage in the animal system [5]. There is evidence put forward that morin bears several pharmacological effects specific influences the activity of numerous enzymes to produce antibacterial, antioxidant, antidiabetic, anti-inflammatory, antitumoral, antihypertensive, hypouricemic, and neuroprotective [5]. Hence, as a pharmacological compound morin offers potential application and advantages for medicinal purposes. Recent studies suggest that morin is involved in modulating MAPK, NF-κB, JAKs/STRTs, Keap1/Nrf2, and mTOR signal transduction cascades [6 –11]. The chemical structure of morin shows that the 2′ hydroxyl group (-OH) of the B ring forms a hydrogen bond with the1′ oxygen atom of the C ring. Because of this conformational change, the transfer of electrons (e^–) from the B ring to the double bond of the C ring makes morin a potential natural radical scavenger [2, 12]. Hence, we established the impact of morin as a bioactive compound.

Despite the importance of morin, understanding molecular regulation and genetic architecture of metabolic pathways are still not specifically emphasized for the Morus spp. The major constraints to understanding the complex metabolic pathways are (a) compartmentalization of metabolites in cellular organelles [13], (b) interaction of metabolites and proteins, (c) tissue-specific accumulation of the bio-active compound, and (d) influence of the environment on multilevel gene regulation [14, 15]. Recently, trends in bioinformatics provide an excellent opportunity to examine and understand the genetic architecture of complex metabolic pathways that will provide an optimum platform for wet lab-related research [14, 15].

Adequate understanding is a prerequisite that will be helpful to improve the productivity of natural morin by metabolic engineering in the future. In this study, we attempted to understand (1) the number of genes involved in the morin biosynthesis pathway, (2) cis responsive elements (CREs)-mediated regulation, (3) miRNA-mediated post-transcriptional silencing, (4) conserved motifs in protein, and (5) in silico gene expression in different tissues. This study may help to understand the morin biosynthesis pathways as well as their genetic architecture.

2 Materials and methods

2.1 Identification of genes involved in morin biosynthesis in M. notabilis

The biosynthetic pathway and genes involved in morin (pentahydroxyflavone) were recognized by Brugliera et al. [16]. Accordingly, we identified the orthologs of M. notabilis C.K. Schneid using the MorusDB (https://morus.swu.edu.cn/morusdb) [17] and retrieved mRNA and protein sequences.

2.2 Identification of motifs of isoforms

The retrieved protein sequences of the identified isoforms were subjected to the prediction of the conserved motifs using the MEME suite (https://meme-suite.org/meme) [18] web server.

2.3 In silico gene expression analysis

To understand the differential expression pattern of genes involved in morin biosynthesis, we downloaded the expression profiles of five tissues such as root, bark, winter bud, male flower, and the leaf of M. notabilis from MorusDB [17]. TBtools [19] was used to prepare a heatmap of the expression data.

2.4 Promoter structure analysis and annotation of CREs

To understand the transcriptional regulation of identified potential genes involved in morin biosynthesis, we retrieved 500bp upstream promoter sequences from the NCBI database (https://www.ncbi.nlm.nih.gov) [20]. Sequences were then subjected to analysis in the PlantCARE database (https://bioinformatics.psb.ugent.be/webtools/plantcare/html) [21] for identifying the consensus motif present in the promoter region. TBtools [19] was then used to analyze promoter and CREs of selected genes.

2.5 Prediction of miRNA targets

To understand the impact of miRNA-mediated post-transcriptional silencing, putative miRNAs, which target the transcript of genes involved in morin biosynthesis in M. notabilis, were identified using the psRNATarget (https://www.zhaolab.org/psRNATarget) [22] server with the expectation value of 3.5.

3 Results

3.1 Different isoforms involved in morin metabolism

The gene ortholog isoforms involved in the morin biosynthesis of M. notabilis were identified; Fig. 1Ashows the morin biosynthetic pathway. Four orthologs namely, phenylalanine ammonia-lyase (MnPAL), chalcone synthase A (MnCSA), chalcone-flavonone isomerase (MnCFI), and flavonoid 3′,5′-hydroxylase (MnFH) were identified in M. notabilis, which are involved in morin biosynthesis. Investigation on copy number analysis deciphering except MnPAL (L484_024373), there are multiple isoforms of MnCSA (04 isoforms: L484_027525, L484_017929, L484_017930, and L484_003228), MnCFI (04 isoforms: L484_011241, L484_017264, L484_017265, and L484_020757), and MnFH (02 isoforms: L484_028073, L484_027395) present in the M. notabilis genome.

Fig. 1

Identification of a gene involved in morin biosynthesis, tissue expression pattern, and encoded protein structure. (A) Biosynthetic pathway of morin (3,5,7,2′,4′-pentahydroxyflavone); Involvement of enzymes like phenylalanine ammonia-lyase (PAL), chalcone synthase A (CSA), chalcone-flavonone isomerase (CFI), and flavonoid 3′,5′-hydroxylase (FH) and detailed steps were highlighted. (B) Tissue-specific (root, branch bark, male flower, leaf, and winter bud) expression of different isoforms (* mark given for major isoform, identified based on expression potentiality). (C) Structural diversity of proteins involved in morin biosynthesis (the identified conserved motifs were supplemented in Table 1S).

3.2 Structural diversity of proteins

MnPAL, MnCSA, MnCFI, and MnFH belong to the different classes of proteins and comprised a varied length of diverse conserved motifs. MEMEsuite web server analysis suggests that MnPAL (L484_024373) comprises six conserved motifs (Fig. 1B). Both N- and C-terminal domains of all classes of proteins are devoid of any conserved motifs. The identified motifs were situated in the middle position of the protein. All four isoforms (L484_027525, L484_017929, L484_017930, and L484_003228) of MnCSA are of the same length and comprised nine motifs across the peptide. The isoforms of MnCFI (L484_011241, L484_017264, L484_017265, and L484_020757) were varied in length and comprised two conserved motifs. Similarly, the two isoforms of MnFH, L484_028073, and L484_027395 are unequal in length and comprised three conserved motifs.

3.3 Tissue-specific expression of different isoforms

Tissue-specific expression data demonstrate that MnPAL was differentially expressed across all selected tissues such as root, bark, winter bud, male flower, and leaf (Fig. 1C). MnPAL is reported to be upregulated in all tissues compared to other genes/isoforms. L484_011241 and L484_017264 isoforms of MnCFI were upregulated in all tissues compared to the other two isoforms. None of the isoforms of MnCSA and MnFH demonstrated upregulation in selected tissues.

3.4 Developmental- and stress-associated CREs involved in transcriptional regulation

A number of CREs associated with development (14), stress (21), and response to hormones (13) were identified (Fig. 2A), which are spanning across the promoter (500 bp) in selected major genes such as MnPAL (L484_024373), MnCSA (L484_017929), MnCFI (L484_011241), and MnFH (L484_028073). A number of identified motifs with respect to the consensus sequence, start and end site, and functional annotation was retrieved from the PlantCARE database and described in Table 1. Figure 2B shows the proportional distribution of development (light-responsive, meristem expression, and xylem-specific induction), stress (anaerobic induction, drought-inducibility, SA responsive, and wound responsive), and response to hormones (ABA, ethylene, MeJA, and SA). Figure 2C shows the potential sites of CREs across promoter regions.

Fig. 2

(A) Bar diagram represents the number of identified CREs associated with development (14), stress (21), and response to hormones (13). (B) Pie chart represents proportional distribution (in percentage) of development (light-responsive, meristem expression, xylem specific induction), stress (anaerobic induction, drought- inducibility, SA responsiveness, and wound responsiveness), and response to hormones (ABA responsiveness, ethylene responsiveness, MeJA-responsiveness, and SA responsiveness) associated CREs. (C) Dot plot represents the presents of different of CREs across the promoter regions. (D) Distribution of potential sites of CREs across the promoter regions. Different colour boxes represent functional annotation of identified CREs.

Table 1

Detail of identified motifs in terms of consensus sequence, start and end site and functional annotation retrieved from PlantCARE database

Gene ID	Identified Motifs	Motif consensus	Start	length	End	Functional annotation
L484_011241	as-1	TGACG	102	5	107	Multiple stress induction
	CGTCA-motif	CGTCA	102	5	107	MeJA-responsiveness
	TGACG-motif	TGACG	102	5	107	MeJA-responsiveness
	MYC	CATGTG	188	6	194	Drought-inducibility
	ABRE	ACGTG	262	5	267	Abscisic acid responsiveness
	ABRE3a	TACGTG	262	6	268	Abscisic acid responsiveness
	ABRE4	CACGTA	262	6	268	Abscisic acid responsiveness
	G-box	TACGTG	262	6	268	Light responsive
	CAT-box	GCCACT	267	6	273	Meristem expression
	MYB	TAACCA	290	6	296	Drought-inducibility
	MYB-like sequence	TAACCA	290	6	296	Drought-inducibility
	MBS	CAACTG	407	6	413	Drought-inducibility
	Myb	CAACTG	407	6	413	Drought-inducibility
	W box	TTGACC	410	6	416	Salicylic acid responsiveness
	CCAAT-box	CAACGG	421	6	427	MYBHv1 binding site
	MYB recognition site	CCGTTG	421	6	427	Drought-inducibility
L484_024373	WUN-motif	AAATTTCTT	56	9	65	Wound responsiveness
	AC-I	(T/C)C(T/C)(C/T)ACC(T/C)ACC	83	8.5	91.5	Xylem specific induction
	MYB	CAACCA	89	6	95	Drought-inducibility
	STRE	AGGGG	110	5	115	Multiple stress induction
	ABRE	GCCGCGTGGC	164	9	173	Abscisic acid responsiveness
	CCAAT-box	CAACGG	184	6	190	Multiple stress induction
	MYB recognition site	CCGTTG	184	6	190	Drought-inducibility
	MYB	CAACCA	228	6	234	Drought-inducibility
	AC-I	GCTTACCTACCA	273	11	284	Xylem specific induction
L484_027525	STRE	AGGGG	49	5	54	Multiple stress induction
	MYC	CATGTG	94	6	100	Drought-inducibility
	ARE	AAACCA	223	6	229	Anaerobic induction
	G-box	TAACACGTAG	270	9	279	Light responsive
	Box II	ACACGTAGA	272	9	281	Light responsive
	ABRE	ACGTG	273	5	278	Abscisic acid responsiveness
	ABRE3a	TACGTG	273	6	279	Abscisic acid responsiveness
	ABRE4	CACGTA	273	6	279	Abscisic acid responsiveness
	G-box	TACGTG	273	6	279	Light responsive
	ERE	ATTTCATA	318	8	326	Ethylene responsiveness
	ARE	AAACCA	360	6	366	Anaerobic induction
	ARE	AAACCA	455	6	461	Anaerobic induction
L484_028073	I-box	GTATAAGGCC	17	9	26	Light responsive
	STRE	AGGGG	68	5	73	Multiple stress induction
	DRE core	GCCGAC	309	6	315	Drought-inducibility
	CAT-box	GCCACT	322	6	328	Meristem expression
	I-box	AGATAAGG	332	8	340	Light responsive
	GA-motif	ATAGATAA	334	8	342	Light responsive
	G-box	ACACGTGT	419	8	427	Light responsive
	ABRE	CACGTG	420	6	426	Abscisic acid responsiveness
	G-Box	CACGTG	420	6	426	Light responsive
	G-box	CACGTG	420	6	426	Light responsive
	ABRE	ACGTG	421	5	426	Abscisic acid responsiveness

3.5 The impact of miRNAs on morin biosynthesis

A total of 13 putative miRNAs are identified (cre-miR906-5p, gma-miR1516a-3p, mtr-miR2673a, mtr-miR2673b, ddi-miR-7131c-5p, sly-miR168a-3p, aqc-miR477d, mtr-miR5207, mtr-miR5556-5p, vvi-miR477b-5p, aly-miR838-3p, bra-miR9563b-3p, and sly-miR5302b-3p); they may be involved in the post-transcriptional silencing of morin biosynthesis pathway by inhibiting translation or by cleavage mechanism (Table 2). The transcripts of MnCFI (4), MnCSA (2), MnPAL (4), and MnFH (3) were targeted by more than two numbers of miRNAs. The analysis demonstrated that the transcript region near the 3′region of MnCFI and MnCSA, whereas the transcript of MnPAL and MnFH5′regionare more prompt target sites for the identified miRNAs. miRNA cre-miR906-5p and gma-miR1516a-3p were reported to be involved in translational inhibition, thus all remaining miRNAs were inhibited targets by cleavage mechanism.

Table 2
List of miRNAs involved in post-transcriptional silencing of transcripts involved in morin biosynthesis of M. notabilis

Target gene (transcript ID) Identified miRNA Acc. MiRNA Length Start site End site miRNA sequence Type of inhibition

MnCFI cre-miR906-5p 21 22 42 CGGUUGGUGGGCGUGAUCAGC Translation

(L484_011241.t01) gma-miR1516a-3p 21 121 141 CAAAAGAGCUUAUGGCUUGUA Translation

mtr-miR2673a 22 415 436 CCUCUUCCUCUUCCUCUUCCAC Cleavage

mtr-miR2673b 22 415 436 CCUCUUCCUCUUCCUCUUCCAC Cleavage

MnCSA ddi-miR-7131c-5p 21 710 729 GGCUGCUGAAAUUAAUAUGGC Cleavage

(L484_017929.t01) sly-miR168a-3p 21 266 286 CCUGCCUUGCAUCAACUGAAU Cleavage

MnPAL aqc-miR477d 20 1883 1902 CUCUUCUUCAAAGGCUUCUA Cleavage

(L484_024373.t01) mtr-miR5207 23 1746 1768 CAUUAAUGUGGGUUUGGACGGUU Cleavage

mtr-miR5556-5p 21 165 185 UGGAAUUCUUCCGCCAUCCAA Cleavage

vvi-miR477b-5p 22 1882 1903 ACUCUUUCUCAAGGGCUUCUAG Cleavage

MnFH aly-miR838-3p 21 704 724 UUUUCUUCUUCUUCUUGCACA Cleavage

(L484_028073.t01) bra-miR9563b-3p 22 1696 1717 AAAUUAAGAGAUGAAUUCUUAC Cleavage

sly-miR5302b-3p 22 1220 1241 UUUUCAACUAUAGCAUUAUUUU Cleavage

Target gene (transcript ID)	Identified miRNA Acc.	MiRNA Length	Start site	End site	miRNA sequence	Type of inhibition
MnCFI	cre-miR906-5p	21	22	42	CGGUUGGUGGGCGUGAUCAGC	Translation
(L484_011241.t01)	gma-miR1516a-3p	21	121	141	CAAAAGAGCUUAUGGCUUGUA	Translation
	mtr-miR2673a	22	415	436	CCUCUUCCUCUUCCUCUUCCAC	Cleavage
	mtr-miR2673b	22	415	436	CCUCUUCCUCUUCCUCUUCCAC	Cleavage
MnCSA	ddi-miR-7131c-5p	21	710	729	GGCUGCUGAAAUUAAUAUGGC	Cleavage
(L484_017929.t01)	sly-miR168a-3p	21	266	286	CCUGCCUUGCAUCAACUGAAU	Cleavage
MnPAL	aqc-miR477d	20	1883	1902	CUCUUCUUCAAAGGCUUCUA	Cleavage
(L484_024373.t01)	mtr-miR5207	23	1746	1768	CAUUAAUGUGGGUUUGGACGGUU	Cleavage
	mtr-miR5556-5p	21	165	185	UGGAAUUCUUCCGCCAUCCAA	Cleavage
	vvi-miR477b-5p	22	1882	1903	ACUCUUUCUCAAGGGCUUCUAG	Cleavage
MnFH	aly-miR838-3p	21	704	724	UUUUCUUCUUCUUCUUGCACA	Cleavage
(L484_028073.t01)	bra-miR9563b-3p	22	1696	1717	AAAUUAAGAGAUGAAUUCUUAC	Cleavage
	sly-miR5302b-3p	22	1220	1241	UUUUCAACUAUAGCAUUAUUUU	Cleavage

4 Discussion

Flavonoids exist in abundance in plants and play an important role in protecting against stresses, modulating developmental processes, and helping in seed dispersion and pollination by coloring flowers and fruits [23, 24]. Morin is a natural bio-flavonol and is predominantly synthesized in the Moraceae family [2]. Genes involved in flavonoid biosynthesis such as phenylalanine ammonia-lyase (PAL), chalcone synthase A (CSA), chalcone-flavanone isomerase (CFI), and flavonoid 3′,5′-hydroxylase (FH) are extensively examined to understand the evolutionary relationship, as well as expression patterns under multiple abiotic and biotic stresses in different crops [23 , 26]. The central importance to understand the genetic architecture and how morin biosynthesis is modulated by a multi-level gene regulation system (CREs and/or miRNA) has not yet been studied for the Morus spp. Hence, this study provides a platform as to how morin biosynthesis is controlled in M. notabilis from a molecular point of view.

The copy number variation of haploid M. notabilis genome demonstrates that except MnPAL (L484_024373), other genes (MnCSA, MnCFI, and MnFH) comprise multiple isoforms. Copy number of a gene family is essential for understanding gene family expansion and diversification, a key evolutionary drive [27], and for demonstrating the genetic dosage in a given species or genotype [28, 29]. Hence, a single copy of MnPAL offers an excellent platform for understanding complex regulation and subcellular organization of flavonoids biosynthesis in M. notabilis. Thus, for understanding the biosynthesis of flavonoids, the natural haploid species M. notabilis could be an experimental model.

The expression pattern of genes involved in morin biosynthesis differentially expressed across all selected tissues (Fig. 1). Specifically, MnPAL is reported to be upregulated in all tissues compared to other genes/isoforms, although the upregulation of gene MnCFI is minimum. Mulberry is a perennial tree species with huge adaptability and ploidy variation. A recent transcriptional study elucidated a considerable amount of variation in transcriptional abundance between haploid M. notabilis and diploid M. indica [31], moreover higher amount of up-and down-regulated genes were identified in haploid M. notabilis [31]. Therefore, understanding the expression potentiality of genes involved in morin biosynthesis as well as their isoforms in haploid M. notabilis provides a platform for future metabolic engineering.

The influence of the environment at the gene expression/regulation level and characterization of CREs were recommended by several researchers in both model and non-model systems [32 –34]. However, the characterization of promoter structure and distribution of CREs across the promoter of genes involved in morin biosynthesis was not done previously. In the present study, a number of CREs spanning across the promoter region (500 bp) in selected four major genes indicating that morin biosynthetic processes transcriptionally regulated development- (14), stress- (21) and hormone- (13) responsive TFs. CREs associated with development (light-responsive, meristem expression, and xylem-specific induction), stress (anaerobic induction, drought-inducibility, SA responsiveness, and wound responsiveness), and response to hormones (ABA responsiveness, ethylene responsiveness, MeJA-responsiveness, and SA responsiveness) are indicating that all genes are controlled by intra- and extra-cellular factors (Fig. 2). Therefore, CRE-mediated transcriptional regulation implies considerable abiotic factors modulate the morin biosynthesis pathway, though further lab-based research is essential to demonstrate deeper understanding through the development of overexpressed, mutant, and promoter lines.

Furthermore, our result shows that all four genes are subjected to post-transcriptional regulation by many miRNAs either through translational inhibitions or through cleavage mechanisms. In this study, a total of six miRNAs were identified, which are involved in post-transcriptional gene silencing in the morin biosynthesis pathway. Although lab research in the future will require confirming the gene regulation through miRNAs, limited studies have focused on understanding miRNA-mediated gene regulation on mulberry species to date [35].

In the last few years, many in silico approaches were implemented to characterize relevant genes involved in plant cell signalling [36], development [37], gene regulation [38], mitigation of biotic [28], abiotic [39] stresses, and metabolic engineering [40] in the Morus spp. Hence, the present in silico research outcome will enrich the current understanding of the genetic architecture of morin biosynthesis (Fig. 3).

Fig. 3

Complex multi-level gene regulation of morin biosynthesis and signal transduction cascades in the animal cell. At the cellular level TFs, CREs, and miRNA mediated the regulation of genes (MnPAL, MnCHA, MnCHI, and MnFH) and translated proteins involved in morin biosynthesis processes. Simultaneously, morin-mediated signal transduction processes and management of metabolic disorders in the animal cell. Plant cell organelles are denoted in box.

In the broader sense, genetic architecture of a metabolic pathway implies complex genetic communications and their association with environmental factors. Understanding of genetic architecture of any metabolic pathway reveals information regarding the genes involved in the pathway/cascade as well as transcriptional and post-transcriptional regulation in responses to a specific environment. In the recent past, the genetic architecture of tissue-specific glucosinolate accumulation in Brassica napus [41], genetic architecture of Prunus mume floral traits [42], genetic architecture of erucic acid and tocopherol isoform variation in B. napus seeds [43] (Havlickova et al., 2018), genetic architecture of amylose biosynthesis Zea mays [44] were investigated. Moreover, the results of the current data mining study support that TFs, CREs, and miRNA played a role in the genetic architecture of morin biosynthetic pathway by regulating the expression pattern in responses to various extra and intracellular stimuli. Likewise, genetic architecture of the Populus lignin production pathway mediated by miRNA and TF are also characteristics [45]. Hence, the present in silico approach offers a fundamental platform to understand complex genetic interaction and their association with the environmental factors involved in morin biosynthesis processes, which can be take-up for further metabolic engineering to enhance morin productivity.

4.1 Conclusion and follow-up research

With the help of bioinformatics tools, we attempted to identify genes involved in morin biosynthesis, CREs-mediated regulation, miRNA-mediated post-transcriptional silencing, and in silico expression in different tissues. Moreover, this study suggests that the natural haploid species M. notabilis could be an experimental model for understanding morin biosynthesis pathways. The present bioinformatics study will improve our understanding of the genetic architecture of morin biosynthesis, although experimental evidence will be required to understand the impact of intra- and extra-cellular factors on morin biosynthesis. In regards to improving the production of morin following experimental designees should be taken into account: (1) development of overexpressed and mutant lines of genes involved in morin biosynthesis for comparative assessment; (2) creation of transgenic promoter lines; and (3) integrated omic-study under a set of environment. Such an integrated study will provide a deeper understanding of metabolic engraining to improve the production of morin.

Footnotes

Acknowledgments

The authors have no acknowledgments.

Funding

The authors report no funding.

Conflict of interest

The authors have no conflict of interest to report.

The supplementary material is available in the electronic version of this article: .

References

Gupta

, Phromnoi

, Aggarwal

. Morin inhibits STAT3 tyrosine 705 phosphorylation in tumor cells through activation of protein tyrosine phosphatase SHP1. Biochemical Pharmacology. 2013;85(7):898–912.

Rajput

, Wang

, Yan

. Morin hydrate: A comprehensive review on novel natural dietary bioactive compound with versatile biological and pharmacological potential. Biomedicine & Pharmacotherapy. 2021;138, 111511.

Gur

, Kandemir

, Darendelioglu

, Caglayan

, Kucukler

, Kandemir

, Ileriturk

. Morin protects against acrylamide-induced neurotoxicity in rats: an investigation into different signal pathways. Environmental Science and Pollution Research. 2021;28(36):49808–19.

Çelik

, Kucukler

, Çomaklı

, Özdemir

, Caglayan

, Yardım

, Kandemir

. Morin attenuates ifosfamide-inducedneurotoxicity in rats via suppression of oxidative stress,neuroinflammation, and neuronal apoptosis. Neurotoxicology. 2020;76, 126–37.

Kuzu

, Kandemir

, Yildirim

, Kucukler

, Caglayan

, Turk

. Morin attenuates doxorubicin-induced heart and brain damage by reducing oxidative stress, inflammation, and apoptosis. Biomedicine & Pharmacotherapy. 2020;106, 443–53.

Verma

, Malik

, Narayanan

, Mutneja

, Sahu

, Bhatia

, Arya

. Role of MAPK/NF-κB pathway in cardioprotective effect of Morin in isoproterenol induced myocardial injury in rats. Molecular Biology Reports. 2019;46(1):1139–48.

Wang

, Guo

, Wei

, He

, Kou

, Zhou

, Yang

, Fu

. Morin suppresses inflammatory cytokine expression by downregulation of nuclear factor-κB and mitogen-activated protein kinase (MAPK) signaling pathways in lipopolysaccharide-stimulated primary bovine mammary epithelial cells. Journal of Dairy Science. 2016;99(4):3016–22.

Chung

, Oliva

, Dwabe

, Vadgama

. Combination treatment withflavonoid morin and telomerase inhibitor MST-312 reduces cancer stemcell traits by targeting STAT3 and telomerase. International Journalof Oncology. 2016;49(2):487–98.

Tian

, Li

, Shen

, Zhang

, Feng

. Protective effects of morin on lipopolysaccharide/d-galactosamine-induced acute liver injury by inhibiting TLR4/NF-κB and activating Nrf2/HO-1 signaling pathways. International Immunopharmacology. 2017;45, 148–55.

10.

Madan Kumar

, Naveen Kumar

, Manikandan

, Devaraj

, Niranjali Devaraj

. Morin ameliorates chemically induced liver fibrosis in vivo and inhibits stellate cell proliferation in vitro by suppressing Wnt/β-catenin signaling. Toxicology and Applied Pharmacology. 2014;277(2):210–20.

11.

Kandemir

, Yıldırım

, Kucukler

, Caglayan

, Darendelioğlu

, Dortbudak

. Protective effects of morinagainst acrylamide-induced hepatotoxicity and nephrotoxicity: Amulti-biomarker approach. Food and Chemical Toxicology. 2020;138, 111190.

12.

, Browse

. Elevated levels of high-melting-point phosphatidylglycerols do not induce chilling sensitivity in an Arabidopsis mutant. The Plant Cell. 1995;7(1):17–27.

13.

Sweetlove

, Nielsen

, Fernie

. Engineering central metabolism–a grand challenge for plant biologists. The Plant Journal. 2017;90(4):749–63.

14.

Mondal

, Kumar

, Chattopadhyay

. Structural property, molecular regulation and functional diversity of Glutamine Synthetase in higher plants: a data-mining bioinformatics approach. The Plant Journal. 2021;108, 1565–1584.

15.

Mondal

, Madhurya

, Saha

, Chattopadhyay

, Antony

, Kumar

, Roy

. Expression profile, transcriptional and post-transcriptional regulation of genes involved in hydrogen sulphide metabolism connecting the balance between development and stress adaptation in plants: a data-mining bioinformatics approach. Plant Biology. 2021 (https://doi.org/10.1111/plb.13378).

16.

Brugliera

, Tao

, Tems

, Kalc

, Mouradova

, Price

, Stevenson

, Nakamura

, Stacey

, Katsumoto

, Tanaka

. Violet/blue chrysanthemums—metabolic engineering of the anthocyanin biosynthetic pathway results in novel petal colors. Plant and Cell Physiology. 2013;54(10):1696–710.

17.

, Qi

, Zeng

, Xiang

, He

. MorusDB: a resource for mulberry genomics and genome biology. Database. 2014;2014.

18.

Bailey

, Boden

, Buske

, Frith

, Grant

, Clementi

, Ren

, Li

, Noble

. MEME SUITE: tools for motif discovery and searching. Nucleic Acids Research.W. 2009;37(suppl_2):202–8.

19.

Chen

, Chen

, Zhang

, Thomas

, Frank

, He

, Xia

. TBtools: an integrative toolkit developed for interactive analyses of big biological data. Molecular Plant. 2020;13(8):1194–202.

20.

Geer

, Marchler-Bauer

, Geer

, Han

, He

, Liu

, Shi

, Bryant

. The NCBI biosystems database. Nucleic Acids Research.D. 2010;38(suppl_1):492–6.

21.

Lescot

, Déhais

, Thijs

, Marchal

, Moreau

, Van de Peer

, Rouzé

, Rombauts

. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Research. 2002;30(1):325–7.

22.

Dai

, Zhuang

, Zhao

. psRNATarget: a plant small RNA target analysis server (2017 release). Nucleic Acids Research.W. 2018;46(W1):49–54.

23.

Winkel-Shirley

. Flavonoid biosynthesis. A colorful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiology. 2001;126(2):485–93.

24.

Buer

, Imin

, Djordjevic

. Flavonoids: new roles for old molecules. Journal of Integrative Plant Biology. 2010;52(1):98–111.

25.

Seitz

, Ameres

, Schlangen

, Forkmann

, Halbwirth

. Multiple evolution of flavonoid 3′, 5′-hydroxylase. Planta. 2015;242(3):561–73.

26.

Ban

, Qin

, Mitchell

, Liu

, Zhang

, Weng

, Dixon

, Wang

. Noncatalytic chalcone isomerase-fold proteins in Humuluslupulus are auxiliary components in prenylated flavonoidbiosynthesis. Proceedings of the National Academy of Sciences. 2018;115(22):E5223–32.

27.

Perry

. The evolutionary significance of copy number variation in the human genome. Cytogenetic and Genome Research. 2008;123(1-4):283–7.

28.

Guo

, Davis

, Birchler

. Dosage effects on gene expression in a maize ploidy series. Genetics. 1996;142(4):1349–55.

29.

Bianconi

, Dunning

, Moreno-Villena

, Osborne

, Christin

. Gene duplication and dosage effects during the early emergence of C4 photosynthesis in the grass genus Alloteropsis. Journal of Experimental Botany. 2018;69(8):1967–80.

30.

, Zhang

, Qi

, Zhao

, Tao

, Yang

, Lee

, Wang

, Cai

, Li

, Lu

, Draft genome sequence of the mulberry tree Morus notabilis. Nature Communications. 2013;4(1):1–9.

31.

Jain

, Bansal

, Rajkumar

, Sharma

, Khurana

. Draft genome sequence of Indian mulberry (Morus indica) provides a resource for functional and translational genomics. Genomics. 2022;114(3):110346.

32.

Ramesha

, Dubey

, Vijayan

, Ponnuvel

, Mishra

, Suresh

. Genome wide characterization revealed MnMLO2 and MnMLO6Aas candidate genes involved in powdery mildew susceptibility inmulberry. Molecular Biology Reports. 2020;47(4):2889–900.

33.

Biswas

, Mondal

, Srivastava

, Trivedi

, Singh

, Mishra

. In silico characterization, molecular phylogeny, and expression profiling of genes encoding legume lectin-like proteins under various abiotic stresses in Arabidopsis thaliana. BMC Genomics. 2022;23(1):1–22.

34.

Mondal

, Das

. Novel aspects of Cell Division Cycle and ApoptosisRegulator 1 (CCAR1) protein in Morus notabilis: an insilico approach. Plant Signaling & Behavior. 2020;15(10):1795396.

35.

Huang

, Zou

, Wang

. Computational identification of miRNA genes and their targets in mulberry. Russian Journal of Plant Physiology. 2014;61(4):537–42.

36.

Zambounis

, Psomopoulos

, Ganopoulos

, Avramidou

, Aravanopoulos

, Tsaftaris

, Madesis

. ‘In silico’ analysis of the LRR receptor-like serine threonine kinases subfamily in ‘Morus notabilis’. Plant Omics. 2016;9(5):319–26.

37.

Baranwal

, Negi

, Khurana

. Auxin response factor genes repertoire in mulberry: identification, and structural, functional and evolutionary analyses. Genes. 2017;8(9):202.

38.

Sun

, Kumar

, Li

, Yang

, Xie

. In Silico search and biological validation of MicroR171 family related to abiotic stress response in mulberry (Morus alba). Horticultural Plant Journal. 2022;8(2):184–94.

39.

Dhanyalakshmi

, Nataraja

. Universal stress protein-like genefrom mulberry enhances abiotic stress tolerance in Escherichiacoli and transgenic tobacco cells. Plant Biology. 2021;23(6):1190–4.

40.

Wang

, Zhi

, Liu

, Xu

, Zhao

, Wang

, Ren

, Li

, Yu

. Characterization of stilbene synthase genes in mulberry (Morus atropurpurea) and metabolic engineering for the production of resveratrol in Escherichia coli. Journal of Agricultural and Food Chemistry. 2017;65(8):1659–68.

41.

Liu

, Huang

, Yi

, Zhang

, Yang

, Zhang

, Fan

, Zhou

. Dissection of genetic architecture for glucosinolate accumulations in leaves and seeds of Brassica napus by genome-wide association study. Plant Biotechnology Journal. 2020;18(6):1472–1484.

42.

Zhang

, Zhang

, Sun

, Fan

, Ye

, Jiang

, Liu

, Ma

, Shi

, Bao

, Guan

. The genetic architecture of floral traits in the woody plant Prunus mume. Nature Communications. 2018;9(1):1–12.

43.

Havlickova

, He

, Wang

, Langer

, Harper

, Kaur

, Broadley

, Gegas

, Bancroft

. Validation of an updated Associative Transcriptomics platform for the polyploid crop species Brassica napus by dissection of the genetic architecture of erucic acid and tocopherol isoform variation in seeds. The Plant Journal. 2018;93(1):181–192.

44.

, Huang

, Wu

, Wang

. The genetic architecture of amylose biosynthesis in maize kernel. Plant Biotechnology Journal. 2018;16(2):688–695.

45.

Quan

, Du

, Xiao

, Lu

, Wang

, Xie

, Song

, Xu

, Zhang

. Genetic architecture underlying the lignin biosynthesis pathway involves noncoding RNA s and transcription factors for growth and wood properties in populus. Plant Biotechnology Journal. 2019;17(1):302–315.