Evaluation of intercellular communication between normal human prostate epithelial cells and prostate cancer cell lines in co-culture model

Abstract

BACKGROUND:

Recent evidences have provided new aspects to metastasis formation with respect to intercellular communication/interaction.

OBJECTIVE:

The purpose of this research was to present an in vitro co-culture-principle application for intercellular communication between normal human prostate epithelial cells and prostate cancer cell lines.

METHODS:

Two prostate cancer cell-lines including androgen-independent DU-145 and PC-3 and the PNT1A, normal human prostate epithelial cell-line, were used in co-culture design. Prostate cancer cells and normal prostate epithelial cells were allowed to grow on the same culture medium without direct cell-to-cell contact and to communicate with each other. After a period of six-days, expression profiles of seven marker genes, including EGFR, SOX2, CD133, CD44, CASPASE 3, CASPASE 9, and IL-6 were determined using qPCR analysis. Comparison of experimental co-cultures with control groups was performed based on repetitive measurements.

RESULTS:

Expression analysis indicated that several of the genes were expressed at different levels in DU145 and PC-3 cells co-cultured with PNTA1. In this context, SOX2, CASPASE 9, and IL-6 genes were over-expressed up to 2–16 times in co-culture set up.

CONCLUSIONS:

This study may provide important clues regarding intercellular communication between normal and cancer cell lines. However, further experiments are needed to confirm the present results and to evaluate novel aspects of cancer development.

Keywords

Intercellular communication co-culture metastasis tumor microenvironment cancer

Abbreviations

TME

Tumor microenvironment

Extracellular vesicles

QRT-PCR

Quantitative real-time PCR

JAK-STAT

Janus kinase-signal transmission and transcription activators

Interleukin

EGFR

Epidermal growth factor receptor

SOX2

Sex determining region Y-box transcription factor 2

1 Introduction

Prostate cancer is defined as malign changes that are seen in the prostate which is an important component of the male reproduction system. About 9% of all cancer-related deaths or cases in men are caused by prostate cancer. Predisposing reasons include age, genetic factors, family history, race, hormones and diet [1]. Despite advances in therapeutic options for cancer, metastasis still remains one of the most major challenges in clinical practice. Metastasis is an exceedingly complex process and is the dispersion of cancer cells in the body. It has been reported that close to 90% of cancer-related deaths are linked to metastasis caused by cells that move to distant regions after leaving the original tumor. A cancer cell that leaves the tumor tissue may move inside the body by reaching blood circulation and the lymphatic system and it may reach a different tissue keep multiplying there. This situation is called the metastasis of a tumor. At least, the concept of metastasis had been described this way up to now, while this point of view is gradually changing due to the discovery of the Tumor Microenvironment (TME). TME is highly important for the biology of cancer. Its effects on cancer’s etiology, progress, metastasis and resistance to treatment are known [2, 3]. Nevertheless, recent evidences have provided new aspects to metastasis formation with respect to intercellular communication/interaction. There have been accumulating experimental evidences that intercellular communication and signal transfer through TME is highly associated with metastasis formation. TME mechanisms generate their biologically plausible affects by means of factors stimulating angiogenesis, affecting cell adhesion, mobility, invasion, and the migration of cancer cells [4 –7]. In this context, in vitro models using cancer cell lines are valuable tools for evaluating molecular mechanisms and monitoring alterations in the corresponding gene expression profiles [8].

In metastasis formation, it has been generally accepted that, cancer cells need to move in the body through blood circulation and the lymphatic system, select a tissue/group of cells to settle in, and finally create a tumor formation in their corresponding target tissues. However, there is still room for improvements in understanding the association between intercellular communication mechanisms and metastasis development. Therefore, in this study, we aimed to investigate whether or not metastasis can be formed without migration of cancer cells. Hence, we used an in vitro co-culture method to evaluate the gene expression changes in response to cellular communication between prostate tumor cells and healthy prostate epithelium cells. For this evaluation we selected a set of genes, including IL-6, CASPASE 9, CASPASE 3, EGFR, CD44, and SOX2, which are among the diagnosis criteria of prostate cancer. Thus, these experimental results may provide insight into the basis for a better understanding of the role of intercellular communication mechanisms and may contribute to the hypothesis that cancer can metastasize by converting non-cancerous cells into cancer cells without the need for cancer cells.

2 Materials and methods

2.1 Cell culture

In the present study, the PNT1A, normal human prostate epithelial cell line, and the androgen-independent PC-3 and DU-145 prostate cancer cell lines (ATCC, Bethesda, MD) were cultured. Figure 1 shows the microscobic morphology of cell lines. All cell lines were grown in RPMI 1640 medium (Gibco Life Technologies, Grand Island, New York), supplemented with 1% L-glutamine, 10% fetal bovine serum (FBS) and 1% penicillin (100 U/mL) – streptomycin (100 μg/ml). Cells were maintained in standard cell culture incubation conditions in a 95% humidified air with 5% CO₂ supplementation at 37°C. Cell monolayer’s grown by attaching to the base of culture flasks were monitored daily for survival, proliferation and contamination under an inverted microscope (Olympus CKX41, Tokyo, Japan).

Fig.1

Microscobic morphology of PC-3, DU 145 and PNT1A cell lines (4×10).

2.2 Generation of co-culture model

Co-cultures were designed as DU145/PNT1A and PC-3/PNT1A. Initially, 1.5×10⁵ PNT1A cells, maintained in 2 ml RPMI cell culture medium (containing, 10% FBS, 1% L-glutamine, 1% penicillin - streptomycin), were seeded to each well of the six-well microplate. Polycarbonate transwell filters with 0.4 μm pore size and 30 mm diameter (Millicell Hanging Cell Culture Inserts, Merck Millipore Corp.) were placed in four wells. Afterwards, 1.5×10⁵ PC-3 cells were plated onto two filters, while 1.5×10⁵ DU145 cells onto the remaining two filters, in 2 ml RPMI culture medium. Thus, cells were allowed to grow on the same culture medium without direct cell-to-cell contact and to communicate with each other. The PNT1A cells cultured on the remaining two wells served as a negative-control. Experimental co-culture and control groups were evaluated based on two repetitive measurements. Microplates were incubated at 37°C for six days in 5% CO₂ incubator (Heraeus BB15, Thermo Fisher Scientific, Waltham, MA, USA). At the seventh day, transwell filters and the cells grown on them (PC3 and DU145 cells) were removed. Afterwards, PNT1A cells attached to the base of the six-well microplate were dissociated by trypsinization and were prepared for RNA isolation. Figure 2 presents a summary of the experimental design with respect to co-culture set up.

Fig.2

A summary of the experimental design for the co-culture model.

2.3 RNA Extraction and qPCR

Extraction of total RNA from cells from both control (PNTA1) and co-culture set up was done using the innuPREP RNA Mini Kit (Analytik-Jena, Jena, Germany). The concentration range (ng/μl) and purity (absorbance at 260–280 nm) of the RNA samples were measured with a spectrophotometer (NanoDrop 2000c, Thermo Scientific, Wilmington, DE, USA). Reverse-transcription of total RNA (1 μg) was performed using a Universal cDNA Synthesis Kit (Exiqon, Vedbaek, Denmark) according to the manufacturer’s instructions.

Expression analyses of seven genes selected by their functional roles, including EGFR, SOX2, CD133, CD44, CASPASE 3, CASPASE 9, and IL-6 were carried out by Quantitative real-time PCR (qPCR) method with the Roche LightCycler 480 (Roche Diagnostics, Tokyo, Japan). ACTB (actin, beta) was used as a reference gene for relative quantification. List of primers is presented in Table 1. Expression profiles were determined by evaluating the fold change expression values of the target/reference genes. In this respect, it is essential to perform a normalization to a reference gene because the total input amount may vary from sample-to-sample in relative quantification. This reference gene (ACTB, in this study), provides a basis for normalizing sample-to-sample differences. To report fold change results, the software incorporates all those factors. In the current study, analyses were performed by using Roche LightCycler 480 software (Roche Diagnostics).

Table 1
List of primers and genes that were investigated for expression

Gene Forward Primer Sequence Reverse Primer Sequence

EGFR GGAAAAGAAAGTTTGCCAAGG CCAAGGACCACCTCACAGTT

SOX2 ATGGGTTCGGTGGTCAAGT CTGATCATGTCCCGGAGGT

CD133 TCCACAGAAATTTACCTACATTG CAGCAGAGAGCAGATGACCA

CD44 TCCAACACCTCCCAGTATGACA GGCAGGTCTGTGACTGATGTACA

CASPASE 3 CATACTCCACAGCACCTGGTT GGCACAAAGCGACTGGAT

CASPASE 9 TCAGGCCCCATATGATCG GACTCCCTCGAGTCTCCAGAT

IL-6 ATGCAATAACCACCCCTGAC CTGCAGCCACTGGTTCTGT

ACTB^* CCCAGCACAATGAAGATCAA CGATCCACACGGAGTACTTG

Gene	Forward Primer Sequence	Reverse Primer Sequence
EGFR	GGAAAAGAAAGTTTGCCAAGG	CCAAGGACCACCTCACAGTT
SOX2	ATGGGTTCGGTGGTCAAGT	CTGATCATGTCCCGGAGGT
CD133	TCCACAGAAATTTACCTACATTG	CAGCAGAGAGCAGATGACCA
CD44	TCCAACACCTCCCAGTATGACA	GGCAGGTCTGTGACTGATGTACA
CASPASE 3	CATACTCCACAGCACCTGGTT	GGCACAAAGCGACTGGAT
CASPASE 9	TCAGGCCCCATATGATCG	GACTCCCTCGAGTCTCCAGAT
IL-6	ATGCAATAACCACCCCTGAC	CTGCAGCCACTGGTTCTGT
ACTB^*	CCCAGCACAATGAAGATCAA	CGATCCACACGGAGTACTTG

^*Reference gene (β-actin).

3 Results

The differences in expression levels and the fold change values are given in Table 2. Results indicated that, selected genes, which have substantial impact on development, progression and diagnosis in prostate cancer, showed considerable differences in expression levels. Of these genes, especially, SOX2, CASPASE 9, and IL-6 showed a significant up-regulation with a fold change >2. SOX2 was up-regulated 16.12- and 4.13-fold in DU145/PNT1A and PC-3/PNT1A co-cultures, respectively. Moreover, IL-6 gene expression increased by 4.16- and 2.67-fold in the same co-cultures. The expression of CASPASE 9 gene showed a significant increase (fold change >2) in only DU145/PNT1A as shown in Table 2.

Table 2
Expression levels (expressed in fold change) of the selected genes in co-culture model

Gene PNT1A and DU 145/PNT1A co-culture PNT1A and PC3/PNT1A co-culture

EGFR 1.47 1.67

SOX2 16.12 4.13

CD133 1.87 1.46

CD44 1.60 0.00

CASPASE 3 1.14 0.86

CASPASE 9 2.06 1.64

IL-6 4.16 2.67

Gene	PNT1A and DU 145/PNT1A co-culture	PNT1A and PC3/PNT1A co-culture
EGFR	1.47	1.67
SOX2	16.12	4.13
CD133	1.87	1.46
CD44	1.60	0.00
CASPASE 3	1.14	0.86
CASPASE 9	2.06	1.64
IL-6	4.16	2.67

In the present experimental design, PNTA1 cells (normal prostate epithelial cell line), which were cultured together with co-cultures but in different wells under the same conditions, were used to perform a comparative assessment and to eliminate the influence of cell-culturing on the genes. This approach provided us with an opportunity to acquire an adequate comparison of expression profiles.

4 Discussion

There is still a strong need for studies on novel aspects of the subject of the converting non-cancerous cells into cancer cells in connection with intercellular communication. In the present study, an evaluation of gene expression alterations for EGFR, SOX2, CD133, CD44, CASPASE 3, CASPASE 9, and IL-6 was performed using a co-culture model.

According to our results, the expression of the SOX2 gene increased 16.12- and 4.13-fold in the DU145/PNT1A and PC3/PNT1A co-culture models, respectively. SOX2, which is a member of the SRY (Sex-determining region Y)-related HMG (high-mobility group)-box gene family, codes the transcription factors that play a role in regulating cell rejuvenation, differentiation, embryo development and apoptosis [9]. This gene is associated with regulating the expressions of some target genes in human embryo cells with Oct4 and Nanog (pluripotent elements). For the activation of SOX2 on a transcriptional level, it needs to bond to the DNA along with Oct4 and Nanog. As a result of irregularities in SOX2 gene expression, tumors may be formed in different tissues by negative effects on various signal pathways. Therefore, it was determined that it is a transcription factor that may be associated with the formation, progression and finally prognosis of a tumor [11]. It is generally over-expressed in human tumors including those in the nervous system [12], respiratory system [13], reproductive system [14], and digestive system [15]. An experimental study on mice demonstrated that the level of SOX2 as a transcription factor increased in epithelial tumor cancer stem cells and it played a role in carcinogenesis [16]. Likewise, SOX2 gene expression in humans was associated with the increase in cancer stem cell markers such as ALDH1, ESA and CD44 [17]. Moreover, it may be influential by stimulating intercellular transition (for example: epithelial-mesenchymal) and affecting some cell signal systems in the metastasis of prostate cancer [18]. A study conducted on radical prostatectomy tissue samples reported that SOX2 had a significant correlation with lymphovascular invasion [19]. On the other hand, reduction in SOX2 expression decreases prostate cancer cell proliferation and increases the rate of apoptosis. Taken altogether, increased SOX2 expression has recently been suggested to be a biomarker in progression of prostate cancer and it may be a target molecule in treatment of this cancer. Accordingly, the present findings that a high-level increase in SOX2 gene expression occurs in co-culture application can be taken into account in prostate cancer metastasis with considerable but limited certainty.

Another gene which showed a significant change in our study was IL-6. Concerning IL-6,the expressions of this gene increased 4.16- and 2.67-fold in the DU145/PNT1A and PC3/PNT1A co-culture models, respectively. The IL-6 is a member of cytokines which play an important role in inflammatory response and cancer pathogenesis and it mainly uses the Janus kinase-signal transmission and transcription activators (JAK-STAT) [20]. Termination of IL-6 may increase the progression of diseases with a course of inflammation and may lead carcinogenesis acceleration. It is mostly released by fibroblasts, vascular endothelial cells, mononuclear phagocytes, T lymphocytes and cervix tumors [21]. The permanent STAT-3 activation that is observed in cancer patients is directly associated with invasion, angiogenesis, prognosis, and therefore, survival. The effects of IL-6 on cancer development could be explained by the IL-6/JAK receptor-signal system. High serum levels of IL-6 were closely associated with prostate, bladder, colon, and breast cancer [22].

IL-6 has a highly significant role in the regulation of growth/development and differentiation in renal carcinomas, prostate cancers and malign tumors that consist of different cell types. The expression of IL-6 and its receptor is influential not only on prostate cell lines, but also and much more importantly, on tissues obtained from prostate carcinomas, as well as benign prostate hyperplasia [23]. Moreover, IL-6 levels increase in metastatic prostate carcinomas [24]. It is important to note that, this cytokine may be helpful in projecting the aggressiveness and progression of prostate cancer cases. By adding cytokines such as TGF-β1 and IL-6 on the nomograms that were used to determine relapse after radical prostatectomy, the predictive accuracy rate of the standard nomograms increased from 75% to 84% [25].

In this study, altered patterns of CASPASE 9 gene expression in response to co-culture set up were observed. The expression of this gene increased 2.06-fold in the PNT1A and DU145/PNT1A co-culture model. Although there was an increase in CASPASE 9 gene expression (1.64-fold) in the PNT1A and PC3/PNT1A set up, this was not considered as a significant up-regulation (<2). Expression of oncogenes that deregulate the cell cycle can induce apoptosis or sensitize cells to pro-apoptotic stimuli [26]. A family of cysteine proteases called caspases has been suggested to be the main constituent of the apoptotic regulation mechanism. Moreover, gene knock-out studies have shown that CASPASE 9 and its cofactor Apaf1 are essential downstream components of p53 in Myc-induced apoptosis [27]. Therefore, it is conceivable that changes in CASPASE 9 gene expressions may retain the important features of metastasis formation with respect to p53-dependent apoptosis pathway.

One possible explanation for the interaction between normal and cancerous cells may be through extracellular vesicles that regulate intercellular communication. These are apoptosomes that form as a result of apoptosis, microvesicles that are directly released from the cell membrane to the outside, retrovirus-like vesicles and exosomes that are released from the cell membrane indirectly [28]. These elements of TME play highly important roles in transferring epigenetic characteristics among cells with the help of nucleic acids and proteins they carry. In this study, obvious changes in the corresponding gene expressions may indicate a possible influence of cancerous cells on prostate epithelial cells. However, the subject of extracellular vesicle characterisation needs further detailed analyses.

As mentioned above, results of the recent studies emphasize the importance of the SOX2 and IL-6 genes in prostate cancer. According to the results of our study, SOX2 (16.12- and 4.13-fold) and IL-6 (4.16- and 2.67-fold) over-expression was determined in the cancer cell lines and co-culture prostate epithelium cells. Significant increase in the expressions of these genes in the prostate tissue in an experimental setup without direct cellular contact was accepted as a possibility that cells provide other cells with new characteristics by transmitting information to others. It is worth noting that the SOX2 gene is accepted as a marker of prostate cancer stem cells in the metastasis of prostate cancer, cell multiplication and avoidance of apoptosis by cancer cells. In addition, IL-6 is directly associated with development of clonogenic abilities, cell proliferation and cancer relapse through the IL-6/STAT3 signal pathway in prostate cancers. Thus, the increases in the expression of these genes should be carefully considered in cancer development. Consequently, the present study may provide novel aspects to intercellular communication. However, it will provide much more satisfactory and clearer results to investigate this possibility by further analyses and in vivo experiments.

Ethical policy

This article does not contain any studies with human participants or animals performed by any of the authors.

Authors’ contribution

H Samli, M Samli, and DT Samli: Hypothesis and protocol development. H Samli, B Vatansever, and S Ardicli: Laboratory studies. H Samli, M Samli, DT Samli, B Vatansever, and S Ardicli: Data analysis and interpreting results. H Samli and S Ardicli: Manuscript writing/editing.

Conflict of interest

All authors declare no competing interests.

References

Leitzmann

, Rohrmann

. Risk factors for the onset of prostatic cancer: age, location, and behavioral correlates. J Clin Epidemiol. 2012;4:1–11.

Lorusso

, Rüegg C:

The tumor microenvironment and its contribution to tumor evolution toward metastasis

. Histochem. Cell Biol. 2008;130:1091–1103.

Gehmert

, Lehoczky

, Loibl

, Jung

, Prantl

, Gehmert

. Interaction between extracellular cancer matrix and stromal breast cells. Clin Hemorheol Microcirc. 2019; DOI: 10.3233/CH-199234.

Akers

, Gonda

, Kim

, Carter

, Chen

. Biogenesis of extracellular vesicles (EV): exosomes, microvesicles, retrovirus-like vesicles, and apoptotic bodies. J Neurooncol. 2013;113:1–11.

Azmi

, Bao

, Sarkar

. Exosomes in cancer development, metastasis, and drug resistance: A comprehensive review. Cancer Metastasis Rev. 2013;32:623–642.

Van der Pol

, Böing

, Harrison

, Sturk

, Nieuwland

. Classification, functions, and clinical relevance of extracellular vesicles. Pharmacol Rev. 2012;64:676–705.

Webber

, Spary L

, Sanders

, Chowdhury

, Jiang

, Steadman

, et al. Differentiation of tumour-promoting stromal myofibroblasts by cancer exosomes. Oncogene. 2015;34:290–302.

Rustamova

, Rudolfa

, Yagublu

, Kuhn

H-M

, Vitacolonna

, Hafner

. Long-term 3D culture of the SCC4 cell line using three different culture methods and initial seeding densities. Journal of Cellular Biotechnology. 2017;3:41–50.

Schnitzler

, Simmons

, Pang

, Martindale

, Baxevanis

. Expression of multiple Sox genes through embryonic development in the ctenophore Mnemiopsis leidyi is spatially restricted to zones of cell proliferation. Evo Devo. 2014;5:15–31.

10.

Schepers

, Teasdale

, Koopman

. Twenty pairs of sox: extent, homology, and nomenclature of the mouse and human sox transcription factor gene families. Dev Cell. 2002;3:167–170.

11.

DeHaan

, Wolters

, Keller

, Ignatoski

KMW

. EGFR ligand switch in late stage prostate cancer contributes to changes in cell signaling and bone remodeling. Prostate. 2009;69:528–537.

12.

Gangemi

RMR

, Griffero

, Marubbi

, Perera

, Capra

, Malatesta

, et al. SOX2 silencing in glioblastoma tumor-initiating cells causes stop of proliferation and loss of tumorigenicity. Stem Cells. 2009;27:40–48.

13.

Hussenet

, Dali

, Exinger

, Monga

, Jost

, Dembelé

, et al. SOX2 is an oncogene activated by recurrent 3q26.3 amplifications in human lung squamous cell carcinomas. PloS One. 2010;5(1):e8960.

14.

, Li

, Hu

, Zhou

, Hu

, Chen

. Expression of Sox2 in human ovarian epithelial carcinoma. J Cancer Res Clin Oncol. 2011;137:131–137.

15.

Saigusa

, Tanaka

, Toiyama

, Yokoe

, Okugawa

, Ioue

, et al. Correlation of CD133, OCT4, and SOX2 in rectal cancer and their association with distant recurrence after chemoradiotherapy. Ann Surg Oncol. 2009;16:3488–3498.

16.

Boumahdi

, Driessens

, Lapouge

, Rorive

, Nassar

, Le Mercier

, et al. SOX2 controls tumour initiation and cancer stem-cell functions in squamous-cell carcinoma. Nature. 2014;511:246–250.

17.

Herreros-Villanueva

, Zhang

, Koenig

, Abel

, Smyrk

, Bamlet

, et al. SOX2 promotes dedifferentiation and imparts stem cell-like features to pancreatic cancer cells. Oncogenesis. 2013;2(8):e61.

18.

, Xu

, Chen

, Jia

, Sun

, et al. SOX2 promotes tumor metastasis by stimulating epithelial-to-mesenchymal transition via regulation of WNT/β-catenin signal network. Cancer Lett. 2013;336:379–389.

19.

Matsika

, Srinivasan

, Day

, Mader

, Kiernan

, Broomfield

, et al. Cancer stem cell markers in prostate cancer: an immunohistochemical study of ALDH1, SOX2 and EZH2. Pathology-Journal of the RCPA. 2015;47:622–628.

20.

Schindler

, Darnell

Jr . Transcriptional responses to polypeptide ligands: the JAK-STAT pathway. Annu Rev Biochem. 1995;64:621–652.

21.

Landskron

, De la Fuente

, Thuwajit

, Hermoso

. Chronic inflammation and cytokines in the tumor microenvironment. J Immunol Res. 2014;149185.

22.

Neurath

, Finotto

. IL-6 signaling in autoimmunity, chronic inflammation and inflammation-associated cancer. Cytokine Growth Factor Rev. 2011;22:83–89.

23.

Lou

, Ni

, Dyer

, Tweardy

, Gao

. Interleukin-6 induces prostate cancer cell growth accompanied by activation of Stat3 signaling pathway. Prostate. 2000;42:239–242.

24.

Adler

, McCurdy

, Kattan

, Timme

, Scardino

, Thompson

. Elevated levels of circulating interleukin-6 and transforming growth factor-beta 1 in patients with metastatic prostatic carcinoma. J Urol. 1999;161:182–187.

25.

Kattan

, Shariat

, Andrews

, Zhu

, Canto

, Matsumoto

, et al. The addition of interleukin-6 soluble receptor and transforming growth factor beta1 improves a preoperative nomogram for predicting biochemical progression in patients with clinically localized prostate cancer. J Clin Oncol. 2003;21:3573–3579.

26.

Fearnhead

, Rodriguez

, Govek

E-E

, Guo

, Kobayashi

, Hannon

, Lazebnik

. Oncogene-dependent apoptosis is mediated by caspase-9. Proc. Natl. Acad. Sci. USA. 1998;95:13664–13669.

27.

, Ding

. Caspase 9 is required for p53-dependent apoptosis and chemosensitivity in a human ovarian cancer cell line. Oncogene. 2002;21:1–8.

28.

György

, Szabó

, Pásztói

, Pál

, Misják

, Aradi

, László

, Pállinger

, Pap

, Kittel

. Membrane vesicles, current state-of-the-art: emerging role of extracellular vesicles. Cell Mol Life Sci. 2011;68:2667–2688.

Evaluation of intercellular communication between normal human prostate epithelial cells and prostate cancer cell lines in co-culture model

Abstract

BACKGROUND:

OBJECTIVE:

METHODS:

RESULTS:

CONCLUSIONS:

Keywords

Abbreviations

1 Introduction

2 Materials and methods

2.1 Cell culture

Table 2 Expression levels (expressed in fold change) of the selected genes in co-culture model Gene PNT1A and DU 145/PNT1A co-culture PNT1A and PC3/PNT1A co-culture EGFR 1.47 1.67 SOX2 16.12 4.13 CD133 1.87 1.46 CD44 1.60 0.00 CASPASE 3 1.14 0.86 CASPASE 9 2.06 1.64 IL-6 4.16 2.67

Ethical policy

Authors’ contribution

Conflict of interest

References

Table 2
Expression levels (expressed in fold change) of the selected genes in co-culture model

Gene PNT1A and DU 145/PNT1A co-culture PNT1A and PC3/PNT1A co-culture

EGFR 1.47 1.67

SOX2 16.12 4.13

CD133 1.87 1.46

CD44 1.60 0.00

CASPASE 3 1.14 0.86

CASPASE 9 2.06 1.64

IL-6 4.16 2.67