Origanum vulgare extract induces apoptosis in Molt-4 leukemic cell line

Abstract

OBJECTIVE:

The purpose of this paper is to investigate the effect of Origanum vulgare extract as a plant with high anti-oxidant components on the induction of cell death in the Molt-4 cell line.

BACKGROUND:

Acute lymphocytic leukemia is characterized by the accumulation of a large number of lymphoblastic cells with high oxidant levels.

METHODS:

MTT assay was performed to determine the effect of O.vulgare extract on Molt-4 cells viability and the amount of 50% inhibitory concentration (IC50) was calculated. Changes in the expression of BAX and BCL-2 genes as involved in apoptosis and Nrf2 gene as a transcription factor of anti-oxidant genes in O.vulgare extract-treated Molt-4 cells were measured with Real-Time PCR. Treated Molt-4 cells were used to determine the stages of early and late apoptosis, and necrosis using acridine orange/ethidium bromide double staining.

RESULTS:

The results suggest survival inhibition and induction of apoptosis in Molt-4 cells treated with O.vulgare extract. Against Bax and Nrf2 genes expression, the expression of Bcl-2 gene has been reduced in Molt-4 cells following1/5 IC50 concentration of O. vulgare extract treatment.

CONCLUSION:

Given the oxidant drugs used in ALL treatment, and increased levels of oxidative stress in leukemic cells, induction of apoptosis by an anti-oxidant plant extract seems to be a promising way in leukemia treatment.

Keywords

Apoptosis induction BAX Bcl-2 Molt-4 cell line

1 Introduction

Acute lymphoblastic leukemia (ALL) is defined by the accumulation of lymphoblastic cells in the bone marrow and blood. High relapse rate and resistance to chemotherapy are two major problems in ALL therapy [1]. T-cell acute lymphoblastic leukemia (T-ALL), a type of acute leukemia, is recognized by rapid progression and invasion which accounts for about 20% of ALL cases and frequently occurs in children [2]. Radiation therapy, chemotherapy, and stem cell transplantation are the main strategies in the ALL treatment [3].

The internal and external pathways of apoptosis appear to slow down in ALL, which is significantly resulted in an increase in the survival rate of malignant cells [4]. Resistance to chemotherapy, known as a major problem in the treatment of T-ALL, is often due to doing battle with the apoptosis process because of reduced expression of the genes encoding cysteine protease enzymes and promoting apoptosis such as Bax, as well as increased expression of anti-apoptotic genes including Bcl-2 [5, 6]. Overall, one of the most important strategies for the treatment of relapsed T-ALL is to induce the expression of apoptosis promoting genes and/or to reduce the expression of anti-apoptotic genes [7, 8].

Herbal extracts have been attracted more attention in recent cancer therapy studies because of their ingredients. Plants have compounds with anti-tumor and anti-oxidant properties such as resveratrol, curcumin, parthenolide, catechins, and anthocyanins. For example, cyanidin-3-rutinoside induces peroxide accumulation and apoptosis induction in leukemic cells besides its anti-oxidant activities. It seems that some of the herbal constituents have paradoxical effects in the same condition. In this regard, Rentian Feng et al. revealed that cyanidin-3-rutinoside down-regulated pro-apoptotic Bim and Bax genes and up-regulated anti-apoptotic Bcl-2 and Bcl-xL genes in HL-60 leukemic cell line. On the other hand, studies showed that the plant extracts exert some of their anti-oxidant defense through Nrf2 pathway activation. Nrf2 is a transcription factor located at the cytoplasm under Keap1 sequestration. Following stress conditions, Nrf2 is released and translocated to the nucleus where transcript anti-oxidant genes such as HO-1, Nqo1, and GST are present [9]. Finally, conventional chemotherapeutic agents have toxic side effects that limit their dosage in therapeutic applications. Therefore, using extracts along with chemotherapeutic agents can reduce the need for high doses of toxic drugs, toxicity, and side effects [10, 11].

Among the most important treatment tools, using medicinal plants is a promising strategy for effective cancer treatment with minimal side effects. The international researchers’ attention to the use of medicinal plants is growing, while the beneficial effects of these plants have always been attractive to the discovery of new drugs [12]. Origanum vulgare is a perennial plant that is native to the Mediterranean areas. This herb has been widely used in traditional medicine, and its anti-oxidant, anti-inflammatory, anti-fungal, anti-mutation, anti-parasitic and anti-hyperglycemic properties have also been reported [13]. Due to the presence of compounds such as monoterpene hydrocarbons and sesquiterpene, unoids, tannins, glycosides, sterols, vitamins, as well as thymol and carvacrol [14]. By reducing the damage to DNA and other macromolecules, anti-oxidants can play an important role in preventing and treating cancer [15]. Our aim in this study was to evaluate the effect of aqueous extract on the expression of apoptosis pathway genes in the Molt-4 cell line. Our finding revealed, O.vulgare aqueous extract reduced the survival of Molt-4 cells in a time and dose-dependent manner.

2 Material and methods

2.1 Preparation of O. vulgare extract

O. vulgare leaf powder was purchased from the National Center for Biological and Genetic Resources of Iran (IBRC). To prepare the plant extract, 8 g of O. vulgare powder was dissolved in 200 ml of distilled water and boiled for 3 hours at 100 °C in the darkroom. The extract was then purified by Whatman paper no.1 and lyophilized by Martin Christ ALPHA 2-4LSC (Germany) apparatus.

2.2 Cell culture

Molt-4 (T-cell acute lymphocytic leukemia) cell line was prepared from the Pasteur Institute of Iran (Tehran, Iran). it was cultured in RPMI 1640 (Biowest) medium with 10% of fetal bovine serum (FBS, Gibco) and 5% penicillin-streptomycin antibiotic with a density of 300,000 cells/ml in a T-25 flask and incubated at 37°C with 5% CO2 till to be passaged every three days.

2.3 Cell survival assay

To investigate the survival of the Molt-4 cell line, 40,000 cells were cultured in each well of a 96-well plate and exposed to O.vulgare extract at concentrations ranging from 20 to 1000μg/ml. Then, the cells were incubated at 37° C and 5% CO2 for 48 and 72 hours. At the end of the experiment, MTT solution (5 mg/ml) was added to cells for 4 h and the resulted formazan crystals were dissolved in 200μl/well DMSO while cells were being shaken and finally the absorbance of cells in each well was measured with a microplate reader (Biotek, USA) at a wavelength of 570 nm [16, 17]. For subsequent assays, inhibitory concentration 50% (IC50) of O.vulgare extract on the Molt-4 cell line was calculated and used.

2.4 Real-time PCR

To investigate the expression of genes involved in apoptosis, the Molt-4 cell line was treated with 1/5 IC50 of O.vulgare extract for 72 hours. Then, total RNA was extracted with RNAX-plus (Sina Clone) and cDNA was synthesized by using the Vivantis kit (Vivantis). Real-time PCR was performed with the ROCH device using Syber Blue dye (Sina Syber Blue) (Tab. 1). The GAPDH gene was also considered as an internal control. Forward and reverse primer sequences for each gene were presented in Table 1.

Table 1
Sequences of forward and reverse primers used for real-time PCR

Gene Forward primer Reverse primer

GAPDH GTCGGAGTCAACGGATT AAGCTTCCCGTTCTCAG

Bax CAGTTGAAGTTGCCGTCAGA CAGTTGAAGTTGCCGTCAGA

Bcl-2 CATGTGTGTGGAGAGCGTCAA GCCGGTTCAGGTACTCAGTCA

Nrf2 GCGACGGAAAGAGTATGAGCTGG GTTGGCAGATCCACTGGTTTCTG

Gene	Forward primer	Reverse primer
GAPDH	GTCGGAGTCAACGGATT	AAGCTTCCCGTTCTCAG
Bax	CAGTTGAAGTTGCCGTCAGA	CAGTTGAAGTTGCCGTCAGA
Bcl-2	CATGTGTGTGGAGAGCGTCAA	GCCGGTTCAGGTACTCAGTCA
Nrf2	GCGACGGAAAGAGTATGAGCTGG	GTTGGCAGATCCACTGGTTTCTG

2.5 Acridine orange/ethidium bromide double staining

To distinguish dead cells from living cells, the Molt-4 cell line was treated with 1/5 IC50 of O. vulgare extract for 72 hours and then centrifuged and washed with PBS - The treated cells were incubated with acridine orange/ ethidium bromide (1:1) for 3 minutes and photographed with epifluorescence microscopy. Based on the color and morphology of the nucleus, cells with early apoptosis, late apoptosis, necrosis, and/or viable cells were determined.

2.6 Statistical analysis

Independent student t test and analysis of variance (ANOVA) was used for statistical analysis. p values, less than 0.05 was considered statistically significant. To determine the IC50 value, ED50 V10 software was used. Data analysis was performed by using SPSS V 16 software and graph pad prism v7 was used to plot the graphs.

3 Results

3.1 Effect of O. vulgare extract on Molt-4 cell line viability

Molt-4 cell line after treatment with O. vulgare extract at different concentrations (1000-800-600-400-200-100-80-60-40-20μg/ml) for 48 and 72 hours were photographed with a contrast phase microscope (Fig. 1). Results indicated that the O.vulgare extract reduces Molt-4 cell viability in a time and dose-dependent manner. MTT assay showed that O. vulgare extract eliminates half of the Molt-4 cells at 457 ± 87μg/ml after 72 hours (Fig. 2).

Fig. 1

Morphology of Molt-4 cells in treatment with 600μg/ml O. vulgare extract. A) Control cells, B) After 48 h treatment, C) After 72 h treatment.

Fig. 2

Time and dose-dependent effect of O. vulgare extract on the survival of Molt-4 cells. Molt-4 cells were treated for 48 and 72 hours at different concentrations of O. vulgare extract and the cell survival was determined using MTT cell cytotoxic assay. IC50 dose was measured to be 713±139μg/ml on 48 hours and 457±87μg/ml on 72 hours (n = 3).

Expression of apoptotic pathway genes following treatment with O. vulgare extract Following treatment of Molt-4 cells with 1/5 of IC50 of O.vulgare extract for 72 hours, the expression of Bax and Bcl-2 genes was evaluated. O.vulgare extract induced the expression of the apoptotic Bax gene, while the expression of the anti-apoptotic Bcl-2 gene was decreased. Moreover, the expression of the Nrf2 gene has been enhanced by O.vulgare extract. The real-time PCR analysis of fold changes relative to the GAPDH as a control gene was presented in Table 2.

Table 2

Fold-changes in the expression of apoptotic genes. In contrast to Bcl-2 gene expression, the expression of Bax and Nrf2 genes has been elevated in Molt-4 cells following treatment with 1/5 IC50 of O. vulgare extract (n = 3)

Genes	Mean fold change	Mean-1sd	Mean + 1sd
Bax	9.57	22.23	4.12
Bcl-2	0.12	0.28	0.05
Nrf2	5.75	56.88	0.57

3.2 Determination of apoptosis in molt-4 cells using acridine orange/ethidium bromide staining

Molt-4 cell line was treated with 1/5 IC50 of O. vulgare extract and double-stained with acridine orange/ethidium bromide. Cells with homogenous green stained and healthy nuclei appeared to be normal cells. Green stained cells with fragmented nuclei are considered as early apoptotic, red-stained cells with healthy nuclei are necrotic, and red-stained cells with fragmented nuclei represented late apoptotic cells. Also, based on results, O.vulgare extract not only induced early or late apoptosis but also developed necrosis in Molt-4 cells (Fig. 3).

Fig. 3

Acridine orange/ethidium bromide double staining for Molt-4 cells following treatment with O. vulgare extract. Green-stained cells with healthy nuclei are normal cells. Green-stained cells with fragmented nuclei are considered as early apoptotic (yellow arrow), while red-stained cells with healthy nuclei are necrotic (red arrow) and red-stained cells with fragmented nucleus represent late apoptotic cells (white arrow). A) Control, B) ½ IC50, C) IC50 (n = 3).

4 Discussion

Due to human use of plants for several thousand years, it seems that there is a positive correlation between humans and medicinal plants. Complications reported because of the use of these plants, reminds us, we need to optimize the use of these compounds. Considering the effectiveness of medicinal plants, the use of these plants in disease treatments has increased extensively [18, 19]. O. vulgare extract induces cytotoxicity in several cell lines, including the acute monocyte leukemia cell line (THP-1), hepatic carcinoma (HEPG2), and colon adenocarcinoma (A549) [20 –22]. There is some report indicating anti-tumor properties of O.vulgare may be reflected in compounds such as Carvacrol, urosolic acid, 4-terpenol, and beta-4-acid. Likewise, Thymoquinone, as an anti-inflammatory, anti-oxidant molecule, can be responsible for cytotoxicity in cancer cells [23 –25]. O.vulgare extract also increased the expression of caspase8, PARP, and Apaf-1 genes in the colon cancer cell line (A549 cells) and promoted apoptosis [26].

Recently Yongfeng Chen et al. revealed that the natural anti-oxidants extracted from the plants have a role as apoptotic inducer factors which affect mitochondrial function, ROS production, and caspase activation [10]. For example, Rentian Feng et al. showed that Anthocyanins, compounds which widely available in fruits and vegetables, with anti-oxidant activity, paradoxically, not only induced the accumulation of peroxides but also triggered the reactive oxygen species (ROS)-dependent activation of p38 MAPK and JNK, contributing to cell death through activating the mitochondrial pathway mediated by Bim [11]. Altogether, some plant extracts seem that have compounds with contradictory effects. While some give them anti-oxidant properties, others award their apoptosis-induction effect. Therefore, they have paradoxical effects together. Besides, leukemic cells have a higher ROS level than normal hematopoietic cells that give them different reactions in contrast to the plant extracts.

Apoptosis defects can be a cause of metastasis of the tumor cells and resistance to anti-cancer drugs. Generally, disruption of apoptosis in the cancer cells occurs through a loss of balance between pro- and anti-apoptotic protein levels either by decreasing caspases activity or through impaired cell signaling pathways. Furthermore, the high expression of anti-apoptotic proteins, such as Bcl-2, Mcl-1, BF-1, and other BCL families, and/or reduction of the expression of pro-apoptotic proteins including Bax, Puma, BID, and Noxa, also, defects or mutates P53, and defect of the apoptosis receptor ligand in the external pathway, are the molecular mechanisms promoting apoptosis in cancer cells [27 –29]. Induction of expression of the internal or external pathways of apoptosis and inhibition of expression of the anti-apoptotic genes can be a promising strategy for inducing apoptosis in cancer cells. In contrast to differentiation arrest or high proliferation in leukemic cells, apoptosis seems to play a major role in the cancerous growth of these cells [30]. Alike various drugs such as ATRA (all-trans-retinoic acid) and ATO (arsenic trioxide), which are the first line of treatment in AML-M3, it has been shown that stimulation of apoptosis can usually be accompanied with slight differentiation of leukemic cells [31, 32]. Nowadays, the destructive effects of chemotherapy drugs on DNA, mutation, and the formation of DNA adduct have been proven in those undergoing treatment [33]. Lack of specificity of chemotherapy drugs causes diverse side-effects especially infection susceptibility, hemorrhagic abnormalities, immune deficiency, liver damage, and neurological disorders [34]. Corticoids, as a routine ALL treatment, increase the levels of oxidative stress in the platelets. Also, these drugs can increase the amount of ROS in epithelial tissues. On the other hand, ROS toxicity can also damage other cells [35, 36]. Therefore, the induction of apoptosis by anti-oxidant compounds in the Molt-4 leukemic cell line can provide hope for inducing cell death without increasing ROS or even decreasing it in cells.

This study showed that incubation of Molt-4 cells with O.vulgare extract decreases cell survival in a time- and dose-dependent manner, so that the cells lost their health morphology and the metabolic activity of the cells was disrupted. O.vulgare extract increased the apoptotic and necrotic process in treated Molt-4 cells suggesting its potential to induce apoptosis in leukemic cells. represented by Bax overexpression and downregulation of Bcl-2. Following apoptosis-inducing signaling, Cytoplasmic Bax protein is localized in the outer membrane of mitochondria to promote the apoptosis process. In contrast, Bcl-2 is normally localized in the mitochondrial membrane to inhibit the Bax function. Therefore, raising of Bax to Bcl-2 ratio, as the apoptosis-induction index, confirms an apoptotic promoting role for O.vulgare extract. Regarding the role of the Nrf2 transcription factor that is responsible for the transcription of anti-oxidant proteins, the up-regulation of Nrf2 in treated Molt-4 cells with O.vulgare extract was anticipated. In conclusion, both upregulation of Nrf2 expression and increasing the Bax to Bcl-2 ratio explain both anti-oxidant and anti-cancer properties of O. vulgare. Further studies are necessary to elucidate the effects of O.vulgare extract in the cell signaling and functional analysis to discriminate anti-oxidant and anti-cancer properties with more detail.

Conflict of interest

The authors declare that there is no conflict of interest.

Footnotes

Acknowledgments

This work was supported by the grant from the student research committee of Ardabil university of medical sciences (Ethic number: IR.ARUMS.REC.1396.247). The authors have special thanks to Research Laboratory for Embryology and Stem Cells staff for their technical help.

References

Terwilliger

, Abdul-Hay

. Acute lymphoblastic leukemia: a comprehensive review and update. Blood Cancer Journal. 2017;7(6):e577–e.

Bloomfield

, Lindquist

, Arthur

, McKenna

, LeBien

, Peterson

, et al. Chromosomal abnormalities in acute lymphoblastic leukemia. Cancer Research. 1981;41(11 Part 2):4838–43.

Marks

, Rowntree

. Management of adults with T-cell lymphoblastic leukemia. Blood, The Journal of the American Society of Hematology. 2017;129(9):1134–42.

Favaloro

, Allocati

, Graziano

, Di Ilio

, De Laurenzi

. Role of apoptosis in disease. Aging (Albany NY). 2012;4(5):330.

Kaparou

, Choumerianou

, Perdikogianni

, Martimianaki

, Kalmanti

, Stiakaki

. Enhanced levels of the apoptotic BAX/BCL-2 ratio in children with acute lymphoblastic leukemia and high-risk features. Genetics and Molecular Biology. 2013;36(1):7–11.

Khanzadeh

, Hagh

, Talebi

, Yousefi

, Azimi

, Baradaran

. Investigation of BAX and BCL2 expression and apoptosis in a resveratrol-and prednisolone-treated human T-ALL cell line, CCRF-CEM. Blood Research. 2018;53(1):53–60.

Leibowitz

, Yu

. Mitochondrial signaling in cell death via the Bcl-2 family. Cancer Biology & Therapy.. 2010;9(6):417–22.

Pistritto

, Trisciuoglio

, Ceci

, Garufi

, D’Orazi

. Apoptosis as anticancer mechanism: function and dysfunction of its modulators and targeted therapeutic strategies. Aging (Albany NY). 2016;8(4):603.

. Role of nrf2 in oxidative stress and toxicity. Annual Review of Pharmacology and Toxicology. 2013;53:401–26.

10.

Chen

, Liang

, Luo

, Hu

. Oxidative resistance of leukemic stem cells and oxidative damage to hematopoietic stem cells under pro-oxidative therapy. Cell Death & Disease. 2020;11(4):1–12.

11.

Feng

, Ni

H-M

, Wang

, Tourkova

, Shurin

, Harada

, et al. Cyanidin-3-rutinoside, a natural polyphenol antioxidant, selectively kills leukemic cells by induction of oxidative stress. Journal of Biological Chemistry. 2007;282(18):13468–76.

12.

Greenwell

, Rahman

. Medicinal plants: their use in anticancer treatment. International Journal of Pharmaceutical Sciences and Research. 2015;6(10):4103.

13.

Singletary

. Oregano: overview of the literature on health benefits. Nutrition Today. 2010;45(3):129–38.

14.

Teixeira

, Marques

, Ramos

, Serrano

, Matos

, Neng

, et al. Chemical composition and bioactivity of different oregano (Origanum vulgare) extracts and essential oil. Journal of the Science of Food and Agriculture. 2013;93(11):2707–14.

15.

Bennett

, Rojas

, Seefeldt

. Role of antioxidants in the prevention of cancer. Journal of Experimental & Clinical Medicine. 2012;4(4):215–22.

16.

Khoshlahni

, Sagha

, Mirzapour

, Zarif

, Mohammadzadeh-Vardin

. Iron depletion with deferoxamine protects bone marrow-derived mesenchymal stem cells against oxidative stress-induced apoptosis. Cell Stress and Chaperones. 2020;25(6):1059–69.

17.

Hosseinzadeh Anvar

, Hosseini-Asl

, Mohammadzadeh-Vardin

, Sagha

. The Telomerase Activity of Selenium-Induced Human Umbilical Cord Mesenchymal Stem Cells Is Associated with Different Levels of c-Myc and p53 Expression. DNA Cell Biol. 2017;36(1):34–41.

18.

Ekor

. The growing use of herbal medicines: issues relating to adverse reactions and challenges in monitoring safety. Frontiers in Pharmacology. 2014;4:177.

19.

Sofowora

, Ogunbodede

, Onayade

. The role and place of medicinal plants in the strategies for disease prevention. African Journal of Traditional, Complementary and Alternative Medicines. 2013;10(5):210–29.

20.

Chuang

L-T

, Tsai

T-H

, Lien

T-J

, Huang

W-C

, Liu

J-J

, Chang

, et al. Ethanolic extract of origanum vulgare suppresses propionibacterium acnes-induced inflammatory responses in human monocyte and mouse ear edema models. Molecules. 2018;23(8):1987.

21.

Elshafie

, Armentano

, Carmosino

, Bufo

, De

Feo V

, Camele

. Cytotoxic activity of Origanum vulgare L. on hepatocellular carcinoma cell line HepG2 and evaluation of its biological activity. Molecules. 2017;22(9):1435.

22.

Coccimiglio

, Alipour

, Jiang

Z-H

, Gottardo

, Suntres

. Antioxidant, antibacterial, and cytotoxic activities of the ethanolic Origanum vulgare extract and its major constituents. Oxidative Medicine and Cellular Longevity. 2016;2016.

23.

Sharifi-Rad

, Varoni

, Iriti

, Martorell

, Setzer

, del Mar Contreras

, et al. Carvacrol and human health: A comprehensive review. Phytotherapy Research. 2018;32(9):1675–87.

24.

Agliassa

, Maffei

. Origanum vulgare terpenoids induce oxidative stress and reduce the feeding activity of Spodoptera littoralis. International Journal of Molecular Sciences. 2018;19(9):2805.

25.

Lukas

, Schmiderer

, Franz

, Novak

. Composition of essential oil compounds from different Syrian populations of Origanum syriacum L. (Lamiaceae). Journal of Agricultural and Food Chemistry. 2009;57(4):1362–5.

26.

Savini

, Arnone

, Catani

, Avigliano

. Origanum vulgare induces apoptosis in human colon cancer caco2 cells. Nutrition and Cancer. 2009;61(3):381–9.

27.

Johnstone

, Ruefli

, Lowe

. Apoptosis: a link between cancer genetics and chemotherapy. Cell.. 2002;108(2):153–64.

28.

Portt

, Norman

, Clapp

, Greenwood

. Anti-apoptosis and cell survival: a review. Biochimica et Biophysica Acta (BBA)-Molecular Cell Research. 2011;1813(1):238–59.

29.

Cappello

, Bellafiore

, Palma

, Bucchieri

. Defective apoptosis and tumorigenesis: role of p53 mutation and Fas/FasL system dysregulation. European Journal of Histochemistry. 2002:199-208.

30.

Baig

, Seevasant

, Mohamad

, Mukheem

, Huri

, Kamarul

. Potential of apoptotic pathway-targeted cancer therapeutic research: Where do we stand? Cell Death & Disease. 2016;7(1):e2058–e.

31.

Cicconi

, Lo-Coco

. Current management of newly diagnosed acute promyelocytic leukemia. Annals of Oncology. 2016;27(8):1474.

32.

Ardjmand

, Alimoghaddam

, Zaker

, Ghavamzadeh

, Jahani

. Arsenic trioxide selectively induces apoptosis within the leukemic cells of APL patients with t (15; 17) translocation possibly through the Fas pathway. International Journal of Hematology-Oncology and Stem Cell Research. 2004;1(2):20–4.

33.

Cheung-Ong

, Giaever

, Nislow

. DNA-damaging agents in cancer chemotherapy: serendipity and chemical biology. Chemistry & Biology. 2013;20(5):648–59.

34.

Ramirez

, Huestis

, Yap

, Zyzanski

, Drotar

, Kodish

. Potential chemotherapy side effects: what do oncologists tell parents? Pediatric Blood & Cancer. 2009;52(4):497–502.

35.

Sanner

, Meder

, Zidek

, Tepel

. Effects of glucocorticoids on generation of reactive oxygen species in platelets. Steroids. 2002;67(8):715–9.

36.

Gruver-Yates

, Cidlowski

. Tissue-specific actions of glucocorticoids on apoptosis: a double-edged sword. Cells. 2013;2(2):202–23.