Evaluation of the butyrylcholinesterase expression and activity in CHO,HEK-293 and vero cell lines transformed by dual promoter expression vector

Abstract

BACKGROUND:

Butyrylcholineesterase (BChE) is a therapeutic drug and its producing as a recombinant protein is an essential issue in biotechnology. One of the highlights in this regard is choosing the best host cells and plasmids.

OBJECTIVES:

The aim of this study is to evaluate the production of butyrylcholinesterase in Vero, HEK-293, and CHO cell lines using a dual promoter vector.

MATERIAL AND METHODS:

The dual-promoter construction (pBudCE dual BChE) was transfected into cell lines categorized in three experimental groups (pBudCE dual BChE, pCMV and negative control). BChE gene expression and enzyme activity was evaluated at different times.

RESULTS:

All three cell lines showed higher gene expression level in pBudCE dual BChE group. BChE enzyme activity level of this group in CHO cells decreased in sixth day and increased in ninth day. In HEK-293 cells it has a downward trend from sixth to ninth day and in Vero cells its level in the ninth day was the highest.

CONCLUSION:

The difference of pBudCE dual BChE and pCMV groups was more pronounced in the HEK-293 cell and the BChE gene expression level of this cells was higher than the others while, CHO cells showed higher level of BChE enzyme activity.

Keywords

Butyrylcholinesterase organophosphorus poisoning dual-promoter vector HEK-293 CHO Vero

1 Introduction

Recombinant proteins have an important role as therapeutics and the demand for them is significantly increasing. These proteins are produced using expression systems and developing novel approaches in order to improve these systems is very important. Producing recombinant proteins is an essential issue in biotechnology and allow the production of many vital molecules such as drugs, hormones, vaccines, and so on [1]. Today many researchers are working on the best expression system and biopharmaceutical companies are considering the efficacy of their system selections [2]. Human butyrylcholinesterase is a glycoprotein having 4 subunits. 574 amino acids and 9 carbohydrate chains are exist in each [3]. Butyrylcholineesterase (BChE) is used to treat poisoning with many organophosphorus compounds such as VX and VR gases, soman, sarin, as well as some pesticides. BChE is also introduced as a drug candidate in several therapeutic fields [4]. Producing such useful protein by recombinant methods is an important issue in biotechnology. Therefore, many studies are trying to find the optimized methods [5, 6]. The basic process of recombinant protein production is transfecting the recombinant DNA, culturing the host cell following which is the transcription and translation of the transfected DNA. The host cells can be chosen from different species like human, mammals, insect cells, bacteria and yeast [7]. Type of protein and its activity are the key points in choosing the best host. Mammalian cells can produce proteins similar to those produced in the human body based on their biochemical structure and properties; therefor they are the preferred expression systems [8]. These cell lines also have the machinery for recombinant protein expression and secretion. Mammalian cell lines have different origins and characteristics. Although murine cells have safe and efficient recombinant protein expression, these cells do not simply possess the required “machinery” for glycosylation of human-type proteins: glycosyltransferases, specific glycosidases, and donors for specific sugar are also absent. In addition, glycosylation pattern is of profound importance in biosynthesis of human recombinant glycoproteins and changes in this pattern may be rapidly introduced to the immune system and clear the protein from circulation [9]. Only few cell lines have been used for the production of recombinant proteins in commercial scale until now. However, the human cells have shown much efficiency for the production of laboratory scale of recombinant proteins and pharmaceutical industry [10].

One of the widely used cell lines in the recombinant proteins production are Chinese hamster ovary cells (CHO) [11]. Glycosidase [12], anti-hemophilia factor [13], coagulation factor [14], and interferon beta [15] are some of the drugs that have been produced in these cells and approved by the FDA for the past 25 years. Researchers had recombined 2-3 mg non-glycosylated butyryl cholinesterase per liter of culture medium in CHO cells in 2002 [16].

About 35 years ago human embryonic kidney cells (HEK-293 cell line) was established which are transformed with adenovirus type 5 DNA [17].

However, these cells have been used in the recombinant proteins production by viral vectors in recent years. In the expression of research grade recombinant proteins HEK-293 is probably the most used cell line, however, the activated protein C which is the only licensed therapeutic protein has been produced in this host cell [18]. Production of many viral vectors such as adenovirus, lentivirus, retrovirus and adeno-associated virus has been done in HEK-293 cells [19]. These cells are growing easily and their transient transfection procedure is also easy and fast therefor they are suited for facilities of high-throughput recombinant gene expression [20].

The other cell line that is considered to be suitable for production of viral vaccines over 30 years is Vero cells. Vero cells have many advantages over primary and diploid cell substrates [11, 13]. In bioreactors also these cells can be used in both micro carrier and suspension cultures. Moreover, the virus titer achieved by using these cells is higher than the other types of cell substrates [21]. Additionally, several studies indicated that Vero cells do not have any oncogenic property and can’t be a threat to human health as a substrate for biological production [22]. One of the promising approaches for increasing the production of recombinant proteins is designing and using double promoter expression systems. Two promoters are being combined in the structure of such vectors in order to control the transcription of the same gene. The important point in the designing of these systems is balancing the requirements of the promoters for obtaining the optimum function. It is well understood that using double- or multiple promoter systems could be useful in increasing the gene expression although the regulatory mechanism of these promoters needs to be investigated in more detail [23]. For these reasons a dual promoter vector was designed in our previous study. To produce BChE enzyme, the newly constructed dual promoter vector worked appropriately in HEK-293 cells [24].

1.1 Objectives

As getting a cell line that can produce the protein in high-level and steady for 2-3 months is so important, in the present study the function of this vector was examined in CHO and Vero cell lines and then the BChE gene expression and activity were compared in CHO, Vero and HEK-293 cell lines. Whether the natural origin of the cells which cholinesterase activity is high [25, 26], could affect the enzyme production in vitro, is a challenging issue [27] which this paper try to address it.

2 Materials and methods

2.1 Materials

The ethical committee of Kerman University of Medical Sciences approved the study with the Ethic Approval Code: IR.KMU.REC.1398.294. The following materials were purchased from suppliers: T4 DNA ligase, restriction enzymes, Taq DNA polymerase master Mix RED and GeneJET Plasmid Miniprep® kit (#K0502, #K0503) from Ampliqon^® (Denmark) and Thermo Scientific (Germany) respectively; plasmids pCMV3-BChE (Cat No., HG12010-CH) from Sino Biological (China) (https://www.bio-connect.nl/dna-rna-vectors/human-bche-gene-cdna-clone-full-length-orf-clone expression-ready-c-his-tagged/hg12010-ch/sfid/5579753) and pBudCE4.1 (Cat No., V532-20) from Invitrogen (USA); Parstous cDNA synthesis kit (Cat No., A101161) from Parstous Biotechnology company (Mashhad, Iran); RiboEx™ (Cat No., 301-001) from GeneAll (Portugal); 5,5^′-Dithiobis(2-nitrobenzoic acid) DNTB (Cat No., D218200); Sina SYBR Blue HS-qPCRMix, 2x (Cat No., MM2171) from Sinaclone (Tehran, Iran); Dulbecco’s modified Eagle’s medium (DMEM) from Gibco (Grand Island, USA); Butyrylthiocholine iodide (Cat No., B3253) and Hyamine 1622 (Cat No., 121-54-0) and from Sigma Aldrich (Saint Louis, MO, USA); Penicillin streptomycin and Fetal Bovine Serum (FBS) and from Hangzhou Sijiqing Biological Engineering Materials Co. Ltd (Hangzhou, China) and HEK-293, CHO and Vero cell lines from Pastur Institute (Tehran, Iran).

2.2 Plasmid Construction

The pBudCE4.1 plasmid with pCMV and EF-1α promoters, and SV40 ori and Bleo^R gene was used in high copy number as the parent plasmid in order to form the dual promoter construction after ligation of one copy of the BChE gene in front of each promoter. The method of formation of the new dual promoter construction has been explained in our previous study in details [24]. Briefly, based on the parent plasmid sequence the SalI, ScaI and KpnI, XhoI restriction sites were selected. Specific sense and antisense primers for BChE gene were flanked by restriction enzyme sequences.

The mentioned primers were used for the PCR amplification of the BChE gene. In order to construct the pBudCE dual BChE vector the parent plasmid was tetra digested by SalI, ScaI, KpnI and XhoI restriction enzymes. On the other hand, the gene was double-digested by SalI, ScaI and KpnI, XhoI in separate tubes and were both added to the tetra digested plasmid. After the ligation process, the final construction of pBudCE dual BChE was formed (Fig. 1). The pCMV3-BChE plasmid was used as a single promoter vector in producing BChE as positive control group.

Fig. 1

The final cloned construction of pBudCE dual BChE vector.

2.3 Liposomal plasmid synthesis

The plasmids were purified and decorated on Lipofectamine™ 2000 according to the previous studies.[24, 28] Briefly for liposomal formation, 14μl Lipofectamine™2000 (2.5%) was added to 250μl serum-free medium then in a separate microtube 5μg of each DNA plasmid (1%) was diluted in 250μl serum-free medium to form DNA suspension. Then in the final step, the DNA suspension was gently added to the liposomal suspension to the final volume of 500μl and incubated for 5–20 min at room temperature.

2.4 Cell culture and transfection

The DMEM-F12 media supplemented with 10% FBS was used for CHO, HEK-293 and Vero cell lines growing and the cells were maintained at 37°C in a 5% CO₂ humidified incubator 2×10⁵ cells/ml (90–95% confluency) were trypsinized and re-suspended in the fresh serum-free medium (2% FBS) one day before transfection. The medium was changed after 24 h with 100μl of the liposomal plasmid in serum-free medium without antibiotics to each well with the final concentration of 0.5μg/well DNA. There were three experimental groups: 1) transfected with pBudCE dual BChE, 2) transfected with pCMV and 3) non transfected cells as negative control group. The cells were followed at day 3, 6, and 9 after inoculation according to the study design. In each time point the culture medium of each group was collected for Ellman’s method and the cells were used for RNA extraction.

2.5 Real time PCR and gene expression

1 ml of RiboEx™ reagent was used for cell lysis following the manufacturer’s instructions. Phenol/chloroform was used to remove proteins to obtain an A₂₆₀:A₂₈₀ ratio of 1.81±0.06, using a UV spectrophotometer (Thermo Scientific™ NanoDrop 2000) [29]. cDNA was synthesized using the Parstous cDNA synthesis kit according to the manufacturer’s instructions. For the synthesis of every first strand cDNA 0.1μg of total RNA was used as follow: primer annealing at 25°C for 10 min, denaturation at 47°C for 60 min and heat inactivation at 85°C for 5 min. Real-time PCR was done using the Sina SYBER blue reaction mix without low ROX (Sina Clone) in a magnetic induction cycler (mic) Real-time PCR system by adding 1.5μl of each cDNA sample, and 10 pmol of each primer. The reaction program was 95°C for 7 min, followed by 40 cycles of 95°C for 15 s, 65°C for 20 s, and 72°C for 35 s. The C_T (threshold cycle) values were analyzed using 2^-ΔΔCT methods. [30] β-actin was used as the endogenous reference gene for normalizing the fold change in gene expression. Primers sequences are showed as following (Table 1).

Table 1
β-actin and BChE genes primers sequences

Gene Primer sequence

β-actin F: GGCTGTATTCCCCTCCATCG

R: CCAGTTGGTAACAATGCCATGT

BChE F: ATTGGTACCAGGTCGACAGCCGCCACCATGCATAGCAAAG TCACAATCATATGCAT

R: CGTCTCGAGAGTACTTTAGTGATGGTGGTGATGATGGTGG

Gene	Primer sequence
β-actin	F: GGCTGTATTCCCCTCCATCG
	R: CCAGTTGGTAACAATGCCATGT
BChE	F: ATTGGTACCAGGTCGACAGCCGCCACCATGCATAGCAAAG TCACAATCATATGCAT
	R: CGTCTCGAGAGTACTTTAGTGATGGTGGTGATGATGGTGG

2.6 BChE activity assay

BChE activity was evaluated using the Ellman’s method. Briefly, 3 ml of sterile 1 X PBS was mixed with 100μl of the cell supernatant and 100μl of the resulting solution was transferred into a well of 96-well culture plate. Butyrylcholinesterase isolated from human plasma (Sigma, USA) was used as a control to build the calibration curve. Then, 100μl of DNTB (0.28 mmol) and 100μl of butyrylcholine iodide (3.2 mmol) were added into the wells containing the samples and controls and incubated at 37°C for 10 min. The measurements were carried out at a wavelength of 412 nm [31, 32].

2.7 Cell lines stability validation

For evaluating the cloning process stability, the cells transfected by pBudCE dual BChE vector were entered in the six freeze-thaw cycles consistently. The three cell lines were transfected by pBudCE dual BChE, trypsinized and divided into two parts after 24 h: one for freezing and the other for culturing. In the freezing part, the cells were centrifuged at 1000 rpm and 4°C for 3–5 min. The supernatant was discarded and 1 ml of the freezing medium (10% DMSO, and 90% FBS) was added to the cell pellet. The cryovials were kept at 4°C for 1 h, –20°C for 2 h and –80°C overnight followed by immerging in liquid N₂ for 15 min. The samples were thawed by holding in 37°C incubator and adding 0.5 ml warm tissue culture media. The thawed cells were divided into two parts as mentioned above until six passages. In the culturing group, after 24 h the media was changed and 1.5 ml fresh media was introduced to the plate and incubated for six days under standard culture condition. Finally, the collected medium of each passage was collected for the enzyme activity measurement by the Ellman’s method.

2.8 Statistical analysis

All the data were presented as mean±SD and experiments were performed in triplicate. SPSS software 16 for Windows (SPSS Inc., Chicago) was used for statistical analysis. The ANOVA was applied to determine the difference in gene expression and enzyme activity between the groups. The Tukey’s Multiple Range test was used to find the significant difference among the groups at the probability level of≤0.05. To analyze stability data the nonparametric Kruskal Wallis test was used. Microsoft Office Excel 2010 was also used as appropriate software when required.

3 Results

3.1 Cloning validation

In order to see if the gene could insert into the parent plasmid, pBudCE4.1 plasmid, the gene which were flanked by restriction sites and pBudCE4.1 plasmid were double digested by SalI, ScaI, and KpnI, XhoI enzymes, in separate tubes. The genes and plasmids which were digested by the same restriction enzymes were mixed and ligated. The resulting products were two tubes containing two cloned plasmids (4595 + 1860 bp), one with using SalI, ScaI and the other with KpnI, XhoI.

For the validation of cloning process each plasmid was digested by the related enzymes and the products were run on agarose gel. the results indicated two bands in each digested product; one for the interested gene (1860 bp) and the other one for the remained part of the plasmid (4595 bp) (specific sites: SalI, ScaI and KpnI, XhoI). Cloned plasmid had a 6455 bp band while the control plasmid had 4595 bp [24].

3.2 Real time PCR and gene expression

RiboEx™ reagent was used for cell lysis and cDNA synthesis was done using the extracted RNA. Following the PCR amplification of the gene, BChE gene expression was assessed using micPCR software (Bio Molecular Systems, Australia). Generally, CHO cells transformed by pBudCE dual BChE showed higher level of gene expression than the other groups at any incubation time, non-significantly. In addition, the gene expression level in CHO cells transformed by pCMV was increased compared to the negative control, although it was lower than the pBudCE dual BChE group.

HEK-293 cells transformed by pBudCE dual BChE and pCMV revealed higher gene expression level than the negative control group on the third day of incubation, significantly, while the gene expression level in pBudCE dual BChE was non-significantly higher than pCMV treatment group. The fold changes of the gene expression of all three groups were significantly different on sixth day of inoculation. However, results showed that the gene expression level was significantly increased in pBudCE dual BChE treatment group in comparison to the negative control group on ninth day of inoculation.

Gene expression results showed a significant increase in Vero cell line transformed by pBudCE dual BChE compared to other groups in all three days of inoculation. while, the difference between the negative control and pCMV groups was not significant. The gene expression level of pBudCE dual BChE group on the third day of inoculation, was higher than the other days. Although its level almost increased on ninth day of incubation (Table 2) (Additional figures show this in more detail [see Additional files 1–3]).

Table 2
Gene expression level (fold changes) of BChE gene in CHO, HEK-293 and Vero cell lines that were inoculated by pBudCE dual BChE, pCMV and control groups and examined on different times of inoculation

Cell line Experimental groups Incubation time (days)

3 6 9

CHO pBudCE dual BChE 0.56±0.13 1.38±0.16 1.64±0.35

pCMV 0.27±0.006 0.95±0.4 1.04±0.4

control 0.05±0.01 0.05±0.01 0.05±0.01

HEK-293 pBudCE dual BChE 2.83^±0.13 4.16^,^$±0.3 3.25^±0.15

pCMV 2.29^±0.00 2.54^±0.06 2.32±0.4

control 0.05±0.01 0.05±0.01 0.05±0.01

Vero pBudCE dual BChE 2.38^,^$±0.17 1.41^,^$±0.06 1.988^,^$±0.33

pCMV 0.33±0.07 0.22±0.05 0.32±0.07

control 0.05±0.01 0.05±0.01 0.05±0.01

Cell line	Experimental groups	Incubation time (days)
CHO	pBudCE dual BChE	0.56±0.13	1.38±0.16	1.64±0.35
	pCMV	0.27±0.006	0.95±0.4	1.04±0.4
	control	0.05±0.01	0.05±0.01	0.05±0.01
HEK-293	pBudCE dual BChE	2.83^*±0.13	4.16^*,^$±0.3	3.25^*±0.15
	pCMV	2.29^*±0.00	2.54^*±0.06	2.32±0.4
	control	0.05±0.01	0.05±0.01	0.05±0.01
Vero	pBudCE dual BChE	2.38^*,^$±0.17	1.41^*,^$±0.06	1.988^*,^$±0.33
	pCMV	0.33±0.07	0.22±0.05	0.32±0.07
	control	0.05±0.01	0.05±0.01	0.05±0.01

Data are presented as mean±SD; ^*p≤0.05. ^*significant compared to the control group; ^$significant compared to the pCMV group.

3.3 Comparing gene expression level of the three cell lines on each day of incubation

Comparing gene expression level of the three cell lines indicated that in the third day of inoculation, the BChE expression level of the CHO cells in pBudCE dual BChE was significantly lower than HEK-293 and Vero cells while in pCMV group HEK-293 cells expressed significantly higher level of BChE gene in comparison with other cells. In sixth day of inoculation using pCMV as a single promoter indicated that HEK-293 cells significantly expressed higher level of BChE gene than Vero cells. The gene expression in CHO cells was not significantly different from either of the cell lines. While, using pBudCE dual BChE system revealed that the gene expression in HEK-293 cells was significantly higher than both CHO and Vero cells. The results of gene expression in ninth day of inoculation showed that the groups have no significant difference with each other. However, HEK-293 cells had higher levels in both pCMV and pBudCE dual BChE groups (Fig. 2a, b, c).

Fig. 2

Gene expression level of CHO, HEK-293, and Vero cells on third (2a), sixth (2b) and ninth (2c) days of inoculation for different experimental groups. Data are presented as mean±SD; ^*p≤0.05.

3.4 Determination of the BChE enzyme activity by ellman’s method

In the Ellman’s method the culture medium of each group was collected. BChE enzyme activity in CHO cell line on third day of incubation was significantly different among all groups and its level in pBudCE dual BChE group was higher than the others. On the sixth day of inoculation the enzyme activity level decreased non-significantly in cells transformed by pBudCE dual BChE, while it was significantly increased again on ninth day.

The results of BChE activity in HEK-293 cells demonstrated that the cells transformed by pBudCE dual BChE had higher enzyme activity than pCMV and the control groups in all three days of inoculation. All groups had significant differenceon third and sixth day of inoculation, while on the ninth day of incubation, only pBudCE dual BChE group had a significant difference with the others. On the ninth day of inoculation the enzyme activity in pBudCE dual BChE group non-significantly decreased in comparison to the third and sixth days however, it was higher than the other groups at any time point.

The results of Vero cell line indicated that on the third and sixth day of incubation, the enzyme activity in pBudCE dual BChE and pCMV transformed groups did not increased and was significantly lower than the negative control group, however on the ninth day, the level of enzyme activity was increased in these groups. pBudCE dual BChE transformed group showed an increase in comparison to the other groups on the ninth day of incubation (Table 3) (Additional figures show this in more detail [see Additional files 4–6]).

Table 3
The BChE enzyme activity in CHO, HEK-293 and Vero cell lines that were inoculated by pBudCE dual BChE, pCMV and control groups and examined on different times of inoculation

Cell line Experimental groups Incubation time (days)

3 (U/ml) 6 (U/ml) 9 (U/ml)

CHO pBudCE dual BChE 3.81^,^$±0.06 2.6±0.28 3.2^±0.14

pCMV 2.85^±0.03 3.21^±0.14 3.03±0.14

control 1.7±0.03 2.05±0.03 2.4±0.14

HEK-293 pBudCE dual BChE 2.6^,^$±0.07 2.64^,^$±0.04 2.19^,^$±0.06

pCMV 1.49^±0.00 1.95^±0.03 1.86±0.11

control 1.82±0.05 1.72±0.02 1.77±0.12

Vero pBudCE dual BChE 1.95^±0.03 1.79^±0.14 2.46±0.18

pCMV 1.96^±0.02 1.9^*±0.07 1.98±0.05

control 2.5±0.07 2.83±0.04 2.16±0.11

Cell line	Experimental groups	Incubation time (days)
CHO	pBudCE dual BChE	3.81^*,^$±0.06	2.6±0.28	3.2^*±0.14
	pCMV	2.85^*±0.03	3.21^*±0.14	3.03±0.14
	control	1.7±0.03	2.05±0.03	2.4±0.14
HEK-293	pBudCE dual BChE	2.6^*,^$±0.07	2.64^*,^$±0.04	2.19^*,^$±0.06
	pCMV	1.49^*±0.00	1.95^*±0.03	1.86±0.11
	control	1.82±0.05	1.72±0.02	1.77±0.12
Vero	pBudCE dual BChE	1.95^*±0.03	1.79^*±0.14	2.46±0.18
	pCMV	1.96^*±0.02	1.9^*±0.07	1.98±0.05
	control	2.5±0.07	2.83±0.04	2.16±0.11

Data are presented as mean±SD with dilution factor = 100 folds; (^*p≤0.05). ^*significant compared to the control group; ^$significant compared to the pCMV group.

3.5 Comparing enzyme activity of three cell lines on each day of incubation

BChE enzyme activity level of pBudCE dual BChE group followed a different pattern in three cell lines. As in CHO cells it decreased on sixth day and increased again on ninth day. In HEK-293 cells it has a downward trend from sixth to ninth day and in Vero cells it was vice versa and on the ninth day its level was higher than the other days. In the third day of inoculation the BChE enzyme activity level of all three cell lines was significantly different in pBudCE dual BChE and pCMV groups as its level in CHO cells was higher than the other groups. The BChE activity results of the control group in Vero cells was higher than CHO and HEK-293 cells. Comparing the results of cell lines on sixth day of inoculation demonstrates that in pCMV group the result of CHO cells was significantly different with the other two cell lines, while the difference between HEK-293 and Vero cells was not significant. In the pBudCE dual BChE group there was just a significant difference between CHO and Vero cells. Generally, CHO cells showed the higher level of enzyme activity compared to the other cells in three times of inoculation (Fig. 3a, b, c).

Fig. 3

Comparing the enzyme activity of CHO, HEK-293, and Vero cells on third (3a), sixth (3b) and ninth (3c) days of inoculation. Data are presented as mean±SD with dilution factor = 100 folds; (^*p≤0.05).

3.6 Cell line stability validation

Results showed that the freeze-thaw process did not affect the enzyme activity in each cell line on sixth day of inoculation.

4 Discussion

As mammalian cells have been applied in various aspects of recombinant technology [33], we evaluated the potential of three cell lines of CHO, HEK-293 and Vero in overexpressing the BChE enzyme using a dual promoter vector (pBudCE dual BChE) compared to single promoter vector (pCMV) and the negative control group.

Our results indicated that in pBudCE dual BChE group the gene expression and enzyme activity level was higher than other groups, so that the plasmid with two promoters was the promising construction in BChE production. The most common cell lines used in protein expression are HEK-293 and CHO cells. Recombinant protein production using transient transfection and stable cell line formation are now widely done by HEK-293 cells. In addition, HEK-293 cells have high protein expression rate and transfection efficiency therefor they are usually preferred in gene expression process [34]. The results of our study indicated that HEK-293 cells transformed by pBudCE dual BChE showed higher level of gene expression than other cell lines reaching a four-fold change on sixth day of inoculation. On the other hand, the results of enzyme activity test revealed higher levels in CHO cells except in days three and six of the negative control group. The Ellman’s method results in the different control groups indicated that changing the source of the cell line would result in different enzyme activity level. As the enzyme activity of Vero cells in negative control group was higher than other groups in third and sixth days while the activity level of pBudCE dual BChE group have raised in ninth day and became more than other groups. This may bring the hypothesis in our mind that the transfection system may start its function later in Vero cells in comparison to the other cells. The other hypothesis is that transfection process in Vero cell line could not act as well as other cells because transfection of these kinds of cells are almost difficult and can be usually achieved using electroporation [35]. This may be due to the different cell function according to the cell behavior, considering normal conditions and no manipulation. Therefore, to get the best results, the researcher should make the appropriate cell line based on the end goal.

The enzyme activity in CHO cells transformed by pCMV had a steady level on the all three times of inoculation. CHO cells transformed by pBudCE dual BChE revealed a decrease on sixth day of incubation and an increase on ninth day. Therefore, there was a significant difference among pBudCE dual BChE and other groups according to the results of the Ellman’s method.

Although the results of recent studies have shown that the best time to produce recombinant protein is in the range of 4 to 6 days [36], comparing the results of gene expression and enzyme activity of the three cell lines in each day of inoculation indicated that the best cell line for BChE gene expression was HEK-293 cells while, CHO cells had higher enzyme activity level. Different results of gene expression and Ellman’s method in different cells in our results can be due to different cellular behavior in different conditions as the machinery system of some cells is more capable at the gene expression level while some others are more active in the enzyme activity or production of active proteins. These results could help researchers to select the right cell in the process of producing recombinant proteins in their researches based on their aim [37].

As expected, given that different cells have different abilities in gene expression and protein production [38], the results present study results indicated that these three cell lines follow different patterns in each day and group. This focuses on the importance of the host cell line in cloning process and expression systems.

5 Conclusion

We can conclude that the difference of pBudCE dual BChE and pCMV transformed groups was more pronounced in the HEK-293 cell and the BChE gene expression level of this cell line was higher than the other cells while, CHO cells had higher level of BChE enzyme activity. The cell machinery phenomena in the different cell types and their ability in protein production may elucidate our understanding of the differences in the results that requires further investigations.

Footnotes

Acknowledgments

Not applicable

Funding

Kerman University of Medical Sciences (KMU) was supported this work under the ethic approval code: IR.KMU.REC.1398.294. It was a part of the Ph.D. thesis.

Authors’ contributions

T.E. and V.M. performed the cloning and experimental parts, analyzed the results, drafted the manuscript, and together with S.N.N. and H.B. designed and carried out the analysis. All authors were involved in critically revising the draft versions of the manuscript; all authors read and approved the final version of the manuscript.

Conflicts of interest

The authors declare that they have no competing interests.

References

Khan

, Ullah

, Siddique

, Nabi

, Manan

, Yousaf

, et al. Role of recombinant DNA technology to improve life. International Journal of Genomics. 2016;2016.

Farokhzad

, Langer

. Impact of nanotechnology on drug delivery. ACS Nano. 2009;3(1):16–20.

Lockridge

, Bartels

, Vaughan

, Wong

, Norton

, Johnson

. Complete amino acid sequence of human serum cholinesterase. Journal of Biological Chemistry. 1987;262(2):549–57.

Ashani

. Prospective of human butyrylcholinesterase as a detoxifying antidote and potential regulator of controlled-release drugs. Drug Development Research. 2000;50(3-4):298–308.

Huang

Y-J

, Huang

, Baldassarre

, Wang

, Lazaris

, Leduc

, et al. Recombinant human butyrylcholinesterase from milk of transgenic animals to protect against organophosphate poisoning. Proceedings of the National Academy of Sciences. 2007;104(34):13603–8.

Geyer

, Kannan

, Cherni

, Woods

, Soreq

, Mor

. Transgenic plants as a source for the bioscavenging enzyme, human butyrylcholinesterase. Plant Biotechnology Journal. 2010;8(8):873–86.

Merten

O-W

, Mattanovich

, Lang

, Larsson

, Neubauer

, Porro

, et al. Recombinant Protein Production with Prokaryotic and Eukaryotic Cells. A Comparative View on Host Physiology: Selected articles from the Meeting of the EFB Section on Microbial Physiology, Semmering, Austria, 5th–8th October 2000: Springer Science & Business Media; 2013.

Zhu

. Mammalian cell protein expression for biopharmaceutical production. Biotechnology Advances. 2012;30(5):1158–70.

Brooks

. Appropriate glycosylation of recombinant proteins for human use. Molecular Biotechnology.. 2004;28(3):241–55.

10.

Swiech

, Picanço-Castro

, Covas

. Human cells: new platform for recombinant therapeutic protein production. Protein Expression and Purification. 2012;84(1):147–53.

11.

Betakova

, Svetlikova

, Gocnik

. Overview of measles and mumps vaccine: origin, present, and future of vaccine production. Acta Virol. 2013;57(2):91–6.

12.

Kishnani

, Corzo

, Nicolino

, Byrne

, Mandel

, Hwu

, et al. Recombinant human acid α-glucosidase: major clinical benefits in infantile-onset Pompe disease. Neurology. 2007;68(2):99–109.

13.

Schwartz

, Abildgaard

, Aledort

, Arkin

, Bloom

, Brackmann

, et al. Human recombinant DNA–derived antihemophilic factor (factor VIII) in the treatment of hemophilia A. New England Journal of Medicine. 1990;323(26):1800–5.

14.

White II

, Beebe

, Nielsen

. Recombinant factor IX. Thrombosis and Haemostasis. 1997;78(01):261–5.

15.

Jacobs

, Cookfair

, Rudick

, Herndon

, Richert

, Salazar

, et al. Intramuscular interferon beta-1a for disease progression in relapsing multiple sclerosis. Annals of Neurology: Official Journal of the American Neurological Association and the Child Neurology Society. 1996;39(3):285–94.

16.

Nachon

, Nicolet

, Viguié

, Masson

, Fontecilla-Camps

, Lockridge

. Engineering of a monomeric and low-glycosylated form of human butyrylcholinesterase: expression, purification, characterization and crystallization. European Journal of Biochemistry. 2002;269(2):630–7.

17.

Graham

, Smiley

, Russell

, Nairn

. Characteristics of a human cell line transformed by DNA from human adenovirus type 5. Journal of General Virology. 1977;36(1):59–72.

18.

Durocher

, Butler

. Expression systems for therapeutic glycoprotein production. Current Opinion in Biotechnology. 2009;20(6):700–7.

19.

Henry

, Jolicoeur

, Kamen

. Unraveling the metabolism of HEK-293 cells using lactate isotopomer analysis. Bioprocess and Biosystems Engineering. 2011;34(3):263–73.

20.

Chapple

, Crofts

, Shadbolt

, McCafferty

, Dyson

. Multiplexed expression and screening for recombinant protein production in mammalian cells. BMC Biotechnology. 2006;6(1):49.

21.

Kumar

AAP

, Rao

YUB

, Joseph

ALW

, Mani

, Swaminathan

. Process standardization for optimal virus recovery and removal of substrate DNA and bovine serum proteins in Vero cell-derived rabies vaccine. Journal of Bioscience and Bioengineering. 2002;94(5):375–83.

22.

Rourou

, Van Der Ark

, Van Der Velden

, Kallel

. A microcarrier cell culture process for propagating rabies virus in Vero cells grown in a stirred bioreactor under fully animal component free conditions. Vaccine. 2007;25(19):3879–89.

23.

Öztürk

, Ergün

, Çalık

. Double promoter expression systems for recombinant protein production by industrial microorganisms. Applied Microbiology and Biotechnology. 2017;101(20):7459–75.

24.

Mirzaie

, Eslaminejad

, Babaei

, Nematollahi-Mahani

. Enhancing the Butyrylcholinesterase Activity in HEK-293 Cell Line by Dual-Promoter Vector Decorated on Lipofectamine. Drug Design, Development and Therapy. 2020;14:3589.

25.

Dave

, Syal

, Katyare

. Tissue cholinesterases. A comparative study of their kinetic properties. Zeitschrift für Naturforschung C. 2000;55(1-2):100–8.

26.

Prody

, Zevin-Sonkin

, Gnatt

, Goldberg

, Soreq

. Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues. Proceedings of the National Academy of Sciences. 1987;84(11):3555–9.

27.

Chu

, Robinson

. Industrial choices for protein production by large-scale cell culture. Current Opinion in Biotechnology. 2001;12(2):180–7.

28.

Eslaminejad

, Nematollahi-Mahani

, Ansari

. Cationic β-cyclodextrin–chitosan conjugates as potential carrier for pmCherry-C1 gene delivery. Molecular Biotechnology. 2016;58(4):287–98.

29.

Toni

, Garcia

, Jeffrey

, Jiang

, Stauffer

, Miyamoto

, et al. Optimization of phenol-chloroform RNA extraction. MethodsX. 2018;5:599–608.

30.

Eslaminejad

, Noureddin Nematollahi-Mahani

, Ansari

. Glioblastoma Targeted Gene Therapy Based on pEGFP/p53-Loaded Superparamagnetic Iron Oxide Nanoparticles. Current Gene Therapy. 2017;17(1):59–69.

31.

Ellman

, Courtney

, Andres

Jr , Featherstone

. A new and rapid colorimetric determination of acetylcholinesterase activity. Biochemical Pharmacology. 1961;7(2):88–95.

32.

Ilyushin

, Haertley

, Bobik

, Shamborant

, Surina

, Knorre

, et al. Recombinant human butyrylcholinesterase as a new-age bioscavenger drug: development of the expression system. Acta Naturae. 2013;5(1 (16)).

33.

O’Flaherty

, Bergin

, Flampouri

, Mota

, Obaidi

, Quigley

,et al. Mammalian cell culture for production of recombinant proteins: A review of the critical steps in their biomanufacturing. Biotechnology Advances. 2020;107552.

34.

Fliedl

, Kaisermayer

. Transient gene expression in HEK293 and vero cells immobilised on microcarriers. Journal of Biotechnology. 2011;153(1-2):15–21.

35.

Khan

. Gene expression in mammalian cells and its applications. Advanced Pharmaceutical Bulletin. 2013;3(2):257.

36.

Lockridge

, Schopfer

, Winger

, Woods

. Large scale purification of butyrylcholinesterase from human plasma suitable for injection into monkeys; a potential new therapeutic for protection against cocaine and nerve agent toxicity. The journal of medical, chemical, biological, and radiological defense.nihms. 2005;3:5095.

37.

Parsa

, Upadhyay

, Sia

. Uncovering the behaviors of individual cells within a multicellular microvascular community. Proceedings of the National Academy of Sciences. 2011;108(12):5133–8.

38.

Cai

, Friedman

, Xie

. Stochastic protein expression in individual cells at the single molecule level. Nature. 2006;440(7082):358–62.

Evaluation of the butyrylcholinesterase expression and activity in CHO,HEK-293 and vero cell lines transformed by dual promoter expression vector

Abstract

BACKGROUND:

OBJECTIVES:

MATERIAL AND METHODS:

RESULTS:

CONCLUSION:

Keywords

1 Introduction

1.1 Objectives

2 Materials and methods

2.1 Materials

2.2 Plasmid Construction

2.4 Cell culture and transfection

2.5 Real time PCR and gene expression

Table 1 β-actin and BChE genes primers sequences Gene Primer sequence β-actin F: GGCTGTATTCCCCTCCATCG R: CCAGTTGGTAACAATGCCATGT BChE F: ATTGGTACCAGGTCGACAGCCGCCACCATGCATAGCAAAG TCACAATCATATGCAT R: CGTCTCGAGAGTACTTTAGTGATGGTGGTGATGATGGTGG

2.7 Cell lines stability validation

2.8 Statistical analysis

3 Results

3.1 Cloning validation

3.2 Real time PCR and gene expression

4 Discussion

5 Conclusion

Footnotes

Acknowledgments

Funding

Authors’ contributions

Conflicts of interest

References

Table 1
β-actin and BChE genes primers sequences

Gene Primer sequence

β-actin F: GGCTGTATTCCCCTCCATCG

R: CCAGTTGGTAACAATGCCATGT

BChE F: ATTGGTACCAGGTCGACAGCCGCCACCATGCATAGCAAAG TCACAATCATATGCAT

R: CGTCTCGAGAGTACTTTAGTGATGGTGGTGATGATGGTGG