Huntingtin Overexpression Does Not Alter Overall Survival in Murine Cancer Models

Abstract

A reduced incidence of various forms of cancer has been reported in Huntington’s disease patients and may be due to pro-apoptotic effects of mutant huntingtin. We tested this hypothesis by assessing the effects of huntingtin protein overexpression on survival in two murine cancer models. We generated YAC HD mice containing human huntingtin transgenes with various CAG tract lengths (YAC18, YAC72, YAC128) on either an Msh2 or p53 null background which have increased cancer incidence. In both mouse models of cancer, the overexpression of either mutant or wild-type huntingtin had no significant effect on overall survival. These results do not support the hypothesis that mutant huntingtin expression is protective against cancer.

Keywords

Huntington’s disease cancer tumorigenesis mouse models huntingtin apoptosis

INTRODUCTION

Huntington’s disease (HD) is an autosomal dominant neurodegenerative disorder clinically characterized by progressive motor impairments, cognitive decline, and neuropsychiatric features [1, 2]. HD is caused by CAG trinucleotide repeat mutations in the HTT gene that result in an expanded polyglutamine tract in the N-terminus of the huntingtin protein [3, 4]. Huntingtin protein is critical to neurodevelopment and normally plays a role in a variety of cellular functions including transcriptional regulation, BDNF production, axonal transport, endosomal trafficking, and vesicular recycling [5]. Huntingtin may also have a pro-survival role in the adult CNS and the levels of wild-type huntingtin have been shown to influence the toxicity of mutant huntingtin [6, 7].

Mutant huntingtin (mHTT) acts primarily through a toxic gain of function to disrupt a variety of cellular processes [8], and it is expressed ubiquitously throughout the body [9] and causes neurodegeneration and neuronal loss through apoptosis [10]. Additionally, mHTT has been associated with apoptosis mechanisms caused by DNA instability [11], with DNA instability being a very common characteristic of many cancers [12]. It has been hypothesized that mHTT expression might be protective against cancer by inducing or increasing the rate of apoptosis in preneoplastic cells, and thereby halting or preventing the development or progression of malignant tumors [13].

Epidemiologic studies identified a decreased incidence of various forms of cancer in the HD population [14 –16]. First described by Sorensen & Fenger (1992), a 5% rate of death from cancer in HD patients were recorded in comparison to the 31% of death in first degree relatives in a Danish population [14]. Ji et al. (2012) went on to report similar findings in a Swedish population, finding a decreased risk of cancer in HD and other polyglutamine (polyQ) diseases [15]. This association was replicated in a French population by a different study group in 2017 [16]. The expanded polyglutamine tract in mutant huntingtin may possibly be acting as a tumor suppressor, inducing apoptosis in cells where the genome is unstable, and potentially mirroring the mechanism of neuronal cell death in HD.

The proposed relationship between the mutation in HD and tumorigenesis seems may not be the case for all cancer types. Looking at common breast cancer mutations produced conflicting results dependent on the mutation type [17]. Certain cancers, like of the skin and digestive tract [14, 18], are not included in the decreased incidence, while prostate and colorectal cancers were calculated in the HD REGISTRY to have some of the lowest incidence rates [18]. The environment of signaling pathways and tissue context within different cancer subtypes appears to influence the interplay between mHTT and growth of cells. For example, a mouse study investigating polyomavirus middle T antigen (PyVT) oncogene with a HD mouse model, Hdh^Q111/Q111, found that mice homozygous for the CAG expanded mouse huntingtin gene had accelerated disease in two breast cancer models and lung metastasis [19]. Utilizing a variety of mouse models will further our intersectional and individual knowledge of cancer and HD pathways.

Inactivation of the Msh2 gene in mice results in a predisposition to cancer through mismatch repair deficiency [20]. Homozygous (Msh2-/-) mice develop lymphoid tumors from genetic instabilities starting at two months old, making it a reliable model to be study lymphoma [21]. Previous studies of Msh2 deletion in various HD mouse model have been published. Crosses between Msh2-/- and R6/1 HD exon 1 transgenic mice suggested that Msh2 is required for CAG somatic instability [22] and Msh2-/-;Hdh^Q111 mice had delayed striatal degeneration [23]. To our knowledge, no previous studies of Msh2 deficiency in HD models have examined survival outcomes from cancer.

p53 is another tumor suppressor gene that has causes cancer when deleted in mouse models. A p53 “knock-out” (p53-/-) mouse will develop many types of tumors by the average age of 4.5 months, commonly lymphoma [24, 25]. N171-82Q HD transgenic mice on a p53 null background had decreased behavioral abnormalities [26] and another HD mouse model, Hdh^Q140 mice, crossed with p53-/- mice exhibited decreased mHTT expression in some organs [27] and increased lifespan in those mice with the mHTT transgene [28]. This survival data from the Hdh^Q140; p53-/- model has yet to be repeated using another HD mouse line.

Yeast artificial chromosome (YAC) transgenic mice express human HTT transgenes with different CAG repeat expansions that express huntingtin with differing polyglutamine lengths [29, 30]. YAC18 mice express human wild-type huntingtin in addition to mouse huntingtin and do not develop any HD phenotypes, in fact these mice are protected from various forms of neuronal injury [7, 31]. The CAG expanded YAC72 line presents with selective striatal neurodegeneration similar to the neurodegeneration in HD [29]. Further CAG expansion in the YAC128 mice results in robust motor abnormalities, cognitive dysfunction, and progressive neuropathology that resembles human HD [30, 32]. The diversity of CAG repeat lengths in the YAC HTT transgene of this well-established mouse model allows investigation into the effects of mutant and wild-type huntingtin expression on cancer survival.

This study investigated the role of huntingtin overexpression on cancer survival by crossing YAC HD mice with two different cancer models (Msh2 and p53 “knockout” mice). Specifically, we examined the lifespan of these mice lines using Kaplan-Meier survival curves. We had hypothesized that mutant huntingtin is protective in cancer by causing apoptosis and/or inhibiting the growth of cancer cells. However, here we demonstrate that mouse models containing the YAC HD transgene and deletions in two separate tumor suppressors genes did not differ in overall survival.

MATERIALS AND METHODS

Mouse crosses and survival

YAC transgenic mice (YAC18 line B60, YAC72 line 2511, YAC128 line 53), Msh2-/- and YAC HD; p53-/- mice, expressing wild-type (YAC18) and mutant (YAC 72, 128) human huntingtin and inactivation of tumor suppressing genes (Msh2, p53) were generated through a series of genetic crosses. (Fig. 1A, B). Littermates that did not contain the YAC HD transgene were used as controls. Mouse strains were maintained on a pure FVB/N (Fig. 1A) or F2 hybrid C57BL/6 (Fig. 1B) background. Survival data on mice were obtained from our own colony. Lifespan of an animal is defined as the number of days between birth and when the animal requires humane sacrifice (Supplementary Table 1), becomes moribund, or dies of natural causes. The colony was maintained in a 12-h light/dark cycle with ambient temperature and humidity. All animal experiments were conducted in accordance with the ethical guidelines described in the Guide for the Care and Use of Laboratory Animals by the National Research Council, and review and approved by the Animal Care and Use Committee of the University of British Columbia.

Fig. 1

A) Breeding scheme diagram for Msh2-/- mice with YAC HD mice (18, 72, 128) on a pure FVB/N background. B) Breeding scheme diagram for p53-/- mice with YAC128 mice generating a F2 hybrid FVB/N x C57BL/6 background. C) Normal liver histology of a wild-type Msh2 +/+ mouse. D) Liver histology of Msh2 -/- mouse exhibiting lymphoblastic tumor consistent with lymphoma. Figure created with BioRender.com.

Genotyping

Tail clippings were collected, genomic DNA prepared, and PCR amplification was carried out. The following primers were used to detect genotype: LYA1=5^′CCTGCTCGCTTCGCTACTTGGAGC 3^′,LYA2=5^′GTCTTGCGCCTTAAACCAACTTGG 3^′,RYA1=5^′CTTGAGATCGGGCGTTCGACTCGC3^′,RYA2=5^′CCGCACCTGTGGCGCCGGTGATGC3^′.

Statistical analysis

Survival curves were generated then analyzed with a log rank, conducted in GraphPad Prism 9.0.1 for Windows, GraphPad Software, San Diego, CA, USA.

RESULTS

We crossed Msh2-/- mice to YAC transgenic mice (YAC18, YAC72, YAC128) and interbred them to obtain YAC HD+;Msh2-/- mice containing the human HTT gene with 18, 72, or 128 CAG repeats and YAC HD-;Msh2-/- controls (Fig. 1A). Control mice lacked the human HTT transgene but were Msh2 deficient (YAC HD-;Msh2-/-). Mice with Msh2 deficiency developed lymphoblastic tumors that infiltrated various organs such as the liver (Fig. 1D). The gross pathology in the liver was confirmed to be consistent with lymphoma on histological sections by an experienced lymphoma pathologist.

Mice expressing a wild-type YAC HTT transgene (YAC 18;Msh2-/-) mice had shorter median survival compared to control mice, but this was not significant (Fig. 1A). A log rank test performed on the survival curve of YAC18+;Msh2-/- (n = 14) with control Msh2-/- littermates (n = 10) mice were not statistically different (p = 0.43) (Fig. 2A). The median age of death was 129 days for mice containing the wildtype HTT transgene and 207 days for control mice with only the Msh2-/- mutation.

Fig. 2

Kaplan-Meier survival curves of YAC HD mouse crosses using log rank test. Human HTT with varying CAG repeats expressing Msh2 knockout mice, compared against control YAC HD-;Msh2-/- littermates: A) YAC18; Msh2-/-; B) YAC72; Msh2-/-; and C) YAC128; Msh2-/-. D) Human mHTT expressing p53 knockout mice, compared against control YAC HD-;p53-/- littermates: YAC128; p53-/-. Graphs were generated using GraphPad Prism 9.0.1 for Windows, GraphPad Software, San Diego, CA, USA.

YAC HD mice expressing mutant huntingtin (YAC72 and YAC128) on the Msh2-/- background compared to YAC HD-;Msh2-/- mice also did not yield significant differences on survival in the following log rank tests. YAC72;Msh2-/- (n = 11) had a median survival of 127 days compared to YAC HD-;Msh2-/- mice (n = 16), with a slightly lower 113 days (p = 0.92) (Fig. 2B). Mice containing the YAC128 transgene with the longest CAG repeats YAC 128;Msh2-/- (n = 23) had a similar result as the other YAC HD models, with a median survival of 138 days that was not statistically significant (p = 0.49) from the YAC HD-;Msh2-/- mice (n = 27) median survival of 127 days (Fig. 2C). Survival curves between YAC HD+;Msh2-/- mice and control mice showed no significant differences in survival which indicates that overexpression of mutant huntingtin does not alter survival in Msh2-/- mice.

We also crossed YAC128 mice to p53-/- cancer line mice (Fig. 1B). Mice were genotyped and then overall survival assessed. A log rank comparison of survival curves of the YAC128;p53-/- (n = 30) with YAC HD-;p53-/- mice (n = 29) found they were not statistically significant (p = 0.72) (Fig. 2D). Median age of death for YAC128;p53-/- was 115 days, correspondingly the control mice were 112 days. This data suggests no survival benefit of mutant huntingtin expression in p53-/- mice.

DISCUSSION

The overall survival of Msh2-/- and p53-/- mice was not significantly altered by the presence of different YAC transgenes. There was no clear effect of different CAG repeat lengths for YAC18 mice expressing human wild-type huntingtin, nor for YAC72 and 128 mice expressing mutant huntingtin.

The potentially decreased median lifespan that was observed in Msh2-/- crossed with YAC18 mice compared to the Msh2-/- littermate controls (129 days versus 207) while not significant is suggestive that increased wild-type huntingtin may accelerate oncogenesis and may help to explain some of the discrepant results in the literature [33]. Additional studies of the role of wild-type huntingtin in cancer are warranted.

There was no clear effect of mutant huntingtin overexpression on survival in these models. The interpretation of this mouse data is limited to the effects of overexpression of human mutant huntingtin. This implies that the presence of mHTT and CAG expansions do not have a significant impact on lifespan in mouse models of cancer, with the caveat that the results we have obtained may not apply to conditions in which the mutation gene occurs in the endogenous HTT gene. Loss or altered function in the mouse endogenous gene crossed with cancer lines could potentially influence survival to better reflect the previous epidemiological studies [15 –17]. To our knowledge, this is the first study crossing different mHTT CAG repeat size mice models with tumor suppressor knockout mouse models. Our study conflicts the survival results from the Hdh ^Q140/Q140;p53-/- model that report a median lifespan improving from 145 days to 171 days [28]. However, the maximum 128 CAG length in our models may not be sufficient to see an effect on lifespan in comparison to the 140-length model used in that study. Other limitations of our study include only dealing with cancers caused by mutations in Msh2 or p53, thus restricting our study conclusions to forms of cancer associated with these genes. Additionally, with our limited survival endpoint we did not assess tumor growth or size that could have potentially been significant.

Correlation between lymphoma and HD is not well established, and mutant huntingtin may not have impact apoptosis pathways in lymphoid tumorigenesis, possibly due to tissues specific factors [33]. Future research should assess the effects of huntingtin levels (both wild-type and mutant) on lifespan and tumorigenesis in different cancer models. Metastasis has been investigated in breast cancer with evidence of HTT expression influencing cancer progression [17 , 33]. Therefore, breast cancer mouse models may be good candidates for additional future studies. Investigating the shared apoptosis pathways between HD and cancer increases knowledge and comprehension of the molecular mechanisms by which both wild-type and mutant huntingtin may influence human health and disease.

CONFLICT OF INTEREST

The authors have no conflict of interest to report.

Footnotes

ACKNOWLEDGMENTS

We would like to thank all past and current members of the Leavitt Lab and Hayden Lab that contributed to this work. This research was supported by the University of British Columbia Faculty of Medicine Centre for Molecular Medicine and Therapeutics Transgenic facility and the Department of Medical Genetics.

The supplementary material is available in the electronic version of this article: .

References

Ross

, Tabrizi

. Huntington’s disease: from molecular pathogenesis to clinical treatment. Lancet Neurol. 2011;10(1):83–98. doi: 10.1016/S1474-4422(10)70245-3.

Beighton

, Hayden

. Huntington’s chorea. S Afr Med J. 1981;59(8):250.

Kremer

, Goldberg

, Andrew

, Theilmann

, Telenius

, Zeisler

, et al. A worldwide study of the Huntington’s disease mutation. The sensitivity and specificity of measuring CAG repeats. N Engl J Med. 1994;330(20):1401–6. doi:10.1056/NEJM199405193302001.

Lee

, Ramos

, Lee

, Gillis

, Mysore

, Hayden

, et al. CAG repeat expansion in Huntington disease determines age at onset in a fully dominant fashion. Neurology. 2012;78(10):690–95. doi:10.1212/WNL.0b013e318249f683.

Saudou

, Humbert

. The biology of huntingtin. Neuron. 2016;89(5):910–26. doi:10.1016/j.neuron.2016.02.003.

, Brown

, Maxwell

, Wyttenbach

, Rubinsztein

. Wild type huntingtin reduces the cellular toxicity of mutant huntingtin in mammalian cell models of Huntington’s disease. J Med Genet. 2001;38(7):450–2. doi:10.1136/jmg.38.7.450.

Leavitt

, Guttman

, Hodgson

, Kimel

, Singaraja

, Vogl

, et al. Wild-type huntingtin reduces the cellular toxicity of mutant huntingtin in vivo. Am J Hum Genet. 2001;68(2):313–24. doi:10.1086/318207.

Barnat

, Capizzi

, Aparicio

, Boluda

, Wennagel

, Kacher

, et al. Huntington’s disease alters human neurodevelopment. Science.2020;369(6505):787–93. doi:10.1126/science.aax3338.

Marques Sousa

, Humbert

. Huntingt: here, there, everywhere!. J Huntingtons Dis. 2013;2(4):395–403. doi: 10.3233/JHD-130082.

10.

Sawa

, Tomoda

, Bae

. Mechanisms of neuronal cell death in Huntington’s disease. Cytogenet Genome Res. 2003;100(1-4):287–95. doi: 10.1159/000072864.

11.

A novel gene containing a trinucleotide repeat that is expanded andunstable on Huntington’s disease chromosomes. The Huntington’sDisease Collaborative Research Group. Cell.. 1993;72(6):971–83. doi: 10.1016/0092-8674(93)90585-e.

12.

Yao

, Dai

. Genomic instability and cancer. J Carcinog Mutagen. 2014;5:1000165. doi: 10.4172/2157-2518.1000165.

13.

Sørensen

, Fenger

, Olsen

. Significantly lower incidence of cancer among patients with Huntington disease: An apoptotic effect of an expanded polyglutamine tract? Cancer. 1999;86(7):1342–6.

14.

Sørensen

, Fenger

. Causes of death in patients with Huntington’s disease and in unaffected first degree relatives. J Med Genet. 1992;29(12):911–4. doi: 10.1136/jmg.29.12.911.

15.

, Sundquist

. Cancer incidence in patients with polyglutamine diseases: a population-basedstudy in Sweden. Lancet Oncol. 2012;13(6):642–8. doi:10.1016/S1470-2045(12)70132-8.

16.

Thion

, Tézenas du Montcel

, Golmard

, Vacher

, Barjhoux

, Sornin

, et al. CAG repeat size in Huntingtin alleles isassociated with cancer prognosis. Eur J Hum Genet. 2016; 24(9):1310–5. doi:10.1038/ejhg.2016.13.

17.

Moreira Sousa

, McGuire

, Thion

, Gentien

, de la Grange

, Tezenas du Montcel

, et al. The Huntington disease protein accelerates breast tumour development and metastasis through ErbB2/HER2 signalling. EMBO Mol Med. 2013;5(2):309–25. doi: 10.1002/emmm.201201546.

18.

McNulty

, Pilcher

, Ramesh

, Necuiniate

, Hughes

, Farewell

, et al. Reduced cancer incidence in Huntington’s disease: analysis in the registry study. J Huntingtons Dis. 2018;7(3):209–22. doi: 10.3233/JHD-170263.

19.

Thion

, McGuire

, Sousa

, Fuhrmann

, Fitamant

, Leboucher

, et al. Unraveling the role of huntingtin in breast cancer metastasis. J Natl Cancer Inst. 2015;107(10):djv208. Published 2015 Aug 20. doi: 10.1093/jnci/djv208.

20.

de Wind

, Dekker

, Berns

, Radman

, te Riele

. Inactivation of the mouse Msh2 gene results in mismatch repair deficiency, methylation tolerance, hyperrecombination, and predisposition to cancer. Cell. 1995;82(2):321–30. doi: 10.1016/0092-8674(95)90319-4.

21.

Reitmair

, Schmits

, Ewel

, Bapat

, Redston

, Mitri

, et al. MSH2 deficient mice are viable and susceptible to lymphoid tumours. Nat Genet. 1995;11(1):64–70. doi: 10.1038/ng0995-64.

22.

Manley

, Shirley

, Flaherty

, Messer

. Msh2 deficiency prevents in vivo somatic instability of the CAG repeat in Huntington disease transgenic mice. Nat Genet. 1999;23(4):471–3. doi: 10.1038/70598.

23.

Wheeler

, Lebel

, Vrbanac

, Teed

, te Riele

, MacDonald

. Mismatch repair gene Msh2 modifies the timing of early disease in Hdh(Q111) striatum. Hum Mol Genet. 2003;12(3):273–81. doi: 10.1093/hmg/ddg056.

24.

Donehower

, Harvey

, Slagle

, McArthur

, Montgomery

Jr , Butel

, et al. Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature. 1992;365(6366):215–21. doi: 10.1038/356215a0.

25.

Donehower

. The p53-deficient mouse: a model for basic and applied cancer studies. Semin Cancer Biol. 1996;7(5):269–78. doi: 10.1006/scbi.1996.0035.

26.

Bae

, Xu

, Igarashi

, Fujimuro

, Agrawal

, Taya

, et al. p53 mediates cellular dysfunction and behavioral abnormalities in Huntington’s disease. Neuron. 2005;47(1):29–41. doi:10.1016/j.neuron.2005.06.005.

27.

Ryan

, Zeitlin

, Scrable

. Genetic interaction between expanded murine Hdh alleles and p53 reveal deleterious effects of p53 on Huntington’s disease pathogenesis. Neurobiol Dis. 2006;24(2):419–27. doi:10.1016/j.nbd.2006.08.002.

28.

Ryan

, Scrable

. Mutant alleles of HD improve the life span of p53(-/-) mice. Mech Ageing Dev. 2008;129(4):238–41. doi: 10.1016/j.mad.2007.12.003.

29.

Hodgson

, Agopyan

, Gutekunst

, Leavitt

, LePiane

, Singaraja

, et al. A YAC mouse model for Huntington’s disease with full-length mutant huntingtin, cytoplasmic toxicity, and selective striatal neurodegeneration. Neuron. 1999;23(1):181–92. doi: 10.1016/s0896-6273(00)80764-3.

30.

Van Raamsdonk

, Pearson

, Murphy

, Hayden

, Leavitt

. Wild-type huntingtin ameliorates striatal neuronal atrophy but does not prevent other abnormalities in the YAC128 mouse model of Huntington disease. BMC Neurosci. 2006;7:80. Published 2006 Dec 5. doi 10.1186/1471-2202-7-80.

31.

Slow

, van Raamsdonk

, Rogers

, Coleman

, Graham

, Deng

, et al. Selective striatal neuronal loss in a YAC128 mouse model of Huntington disease. Hum Mol Genet. 2003;12(13):1555–67. doi: 10.1093/hmg/ddg169.

32.

Van Raamsdonk

, Pearson

, Slow

, Hossain

, Leavitt

, Hayden

. Cognitive dysfunction precedesneuropathology and motor abnormalities in the YAC128 mouse model ofHuntington’s disease. J Neurosci. 2005;25(16):4169–80. doi: 10.1523/JNEUROSCI.0590-05.2005.

33.

Thion

, Humbert

. Cancer: From wild-type to mutant huntingtin. J Huntingtons Dis. 2018;7(3):201–8. doi: 10.3233/JHD-180290.