Abstract
BACKGROUND:
Bronchopulmonary dysplasia (BPD) is chronic lung disease of prematurity and pulmonary hypertension (PH) is a major contributor to morbidity and mortality in BPD patients. Nitric oxide (NO) is a vasodilator and apoptotic mediator made by NO synthase (NOS). NOS is inhibited by asymmetric dimethylarginine (ADMA), and dimethylarginine dimethylaminohydrolase (DDAH) hydrolyzes ADMA. Previously, in a BPD patient cohort, we identified single nucleotide polymorphism (SNP) DDAH1 rs480414 (G > A) that was protective against developing PH. This study aims to determine functional consequences of the DDAH1 SNP in lymphoblastoid cell lines (LCLs) derived from neonatal cord blood. We tested the hypothesis that DDAH1 SNP (AA) results in DDAH1 gain of function, leading to greater NO-mediated apoptosis compared to DDAH1 wild-type (GG) in LCLs.
METHODS:
LCLs were analyzed by Western blot (DDAH1, cleaved and total caspase-3 and -8, and β-actin), and RT-PCR (DDAH1, iNOS). Cell media assayed for nitrites with chemiluminescence NO analyzer, and conversion of ADMA to L-citrulline was measured by spectrophotometry.
RESULTS:
LCLs with DDAH1 SNP had similar levels of DDAH1 protein and mRNA expression, as well as DDAH activity, compared to DDAH1 WT LCLs. There were also no changes in cleaved caspase-3 and -8 protein levels. LCLs with DDAH1 SNP had similar iNOS mRNA expression. Nitrite levels in media were lower for DDAH1 SNP LCLs compared to DDAH1 WT LCLs (p < 0.05).
CONCLUSION:
Contrary to our hypothesis, we found that NO production was lower in DDAH1 SNP LCLs, indicative of a loss of function phenotype.
Background
Bronchopulmonary Dysplasia (BPD), the chronic lung disease of prematurity, is defined as an oxygen need at 36 weeks postmenstrual age and is characterized by impaired alveolarization and compromised vasculogenesis [1, 2]. In the United States alone BPD affects an estimated 10,000 infants annually [2]. Preterm infants with BPD have hypoplasia of the microvasculature and disruption of lung development [3]. When coupled with prolonged hypoxia, hypertension, and/or inflammation, this can cause changes in vascular function and structure including pulmonary vascular smooth muscle thickening as a result of dysregulated cellular proliferation. This leads to elevated pulmonary vascular resistance and pulmonary hypertension (PH) [4, 5]. In a cohort of patients with BPD requiring prolonged positive-pressure ventilation (PPV), infants who developed PH were four times more likely to die than infants that did not develop PH [6].
Inhaled nitric oxide (NO) is the first line therapy for PH in infants. NO is a potent vasodilator and regulator of vascular tone as well as an important apoptotic mediator. The enzyme nitric oxide synthase (NOS) produces NO in the vascular endothelium through the conversion of L-arginine to L-citrulline. NO then stimulates soluble guanylate cyclase activity in vascular smooth muscle cells. This prompts the production of cyclic guanosine monophosphate (cGMP), which then relaxes vascular smooth muscle cells allowing for pulmonary vasodilation [4].
Asymmetric dimethylarginine (ADMA) is an endogenous inhibitor of NOS [7, 8]. ADMA is formed through methylation of arginine residues by protein-arginine methyl transferase (PRMT) [9]. ADMA is actively broken down by the enzyme dimethylarginine dimethylaminohydrolase (DDAH). DDAH has two isoforms, DDAH1 and DDAH2 [10, 11]. It has been estimated that 70–80% of ADMA is metabolized by DDAH, primarily the DDAH1 isoform [9, 12]. In adults, ADMA is elevated in diseases related to endothelial dysfunction including hypertension, coronary artery disease, atherosclerosis, diabetes, and renal dysfunction [13–16]. ADMA is a significant predictor of mortality in patients with cardiovascular disease, and increased ADMA levels may be a result of decreased DDAH1 expression or function [14]. Ding et al. found that a novel loss of function polymorphism in the DDAH1 gene was associated with an increased risk of stroke and coronary heart disease.
Previously, our group analyzed plasma samples from a cohort of BPD patients and found that plasma ADMA levels were two-fold higher in patients with PH compared to patients without PH [15]. Recently, we studied 36 single nucleotide polymorphisms (SNPs) in the DDAH1 and DDAH2 genes in a cohort of BPD infants with and without PH and identified a SNP, the DDAH1 rs480414A variant, which is associated with a lower incidence of PH in BPD patients. Therefore, we speculate that the DDAH1 rs480414A variant may be protective against the development of PH as improved NO availability could lead to improved apoptosis and decreased smooth muscle cell proliferation [17]. In the current study, we aim to determine if the DDAH1 SNP rs480414 influences DDAH1 function in cell culture. Given the size limitations of neonates it can be difficult to isolate cells. Fortunately, we were able to obtain neonatal cord blood samples from the Perinatal Research Repository (PRR) at Nationwide Children’s Hospital to generate lymphoblastoid cell lines (LCLs). We tested the hypothesis that in LCLs, the DDAH1 SNP rs480414A variant results in a gain of function mutation in DDAH1, which would lead to greater NO-mediated apoptosis than DDAH1 WT LCLs.
Methods
Human LCL culture
We obtained neonatal cord blood samples from the Perinatal Research Repository (PRR) at Nationwide Children’s Hospital, under Institutional Review Board approval. Density centrifugation of the neonatal cord blood using the Ficoll-Paque technique and isolation of LCL’s by infection with Epstein-Barr virus (EBV) was performed [18, 19]. LCLs were then studied in vitro. RNA and protein were isolated from LCL’s as previously described [19].
Genotyping
LCLs were classified as either homozygous DDAH1 rs480414 SNP (AA) or homozygous DDAH1 rs480414 (GG) wild-type using a Taqman SNP genotyping assay kit (Thermo Fisher Scientific, Grand Island, New York) [19]. (DDAH1: OMIM: 604743; NCBI Reference Sequence: NC_000001.11:g.85461780G<A).
Western blot analysis
Cell lysates were assayed for DDAH1, cleaved caspase-3, cleaved caspase-8, total caspase-3, total caspase-8, and β-actin proteins by Western blot analysis as previously described [19–21]. Samples of LCL lysates containing equal amounts of protein were diluted with SDS sample buffer and reducing agent, heated to 95°C for 5 minutes, and then centrifuged at 10,000 g at room temperature for 2 minutes. Proteins were transferred to polyvinylidene difluoride (PVDF) membranes and blocked for 1 hour in Tris-buffered saline with Tween-20 and 5% nonfat dried milk. The membranes were then incubated with the primary antibody: DDAH1 (1:1000) (Thermo Fisher), cleaved caspase-3, or cleaved caspase-8 antibody (1:1000) (Cell Signaling Inc., Danvers, MA) overnight at 4°C. The following day, the membranes were washed with PBS-T three times and then incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (Bio-Rad) or HRP-conjugated goat anti-mouse IgG (Bio-Rad) for 1 hour. After again washing the membranes three times with PBS-T, we were able to visualize the protein bands using enhanced chemiluminescence (Luminata Classico or Forte Western HRP substrate, Millipore Corporation, Billerica, CA). Protein was then quantified using densitometry (VisionWorksLS Analysis Software; UVP LLC, Upland, CA). We controlled for protein loading by stripping the blots with a Western Re-Probe buffer (G-Biosciences, St. Louis, MO), and then re-probed the blots for β-actin (1:10,000) (Sigma-Aldrich, St. Louis, MO), total caspase-3, or total caspase-8 (1:1,000) (Cell Signaling Inc, Danvers, MA).
RT-PCR
RNA (2μg) was treated with DNase first and then reverse transcribed with 0.5μg random primer, 8 units dNTP, in 1x buffer (Promega, Madison, WI), and RNase-free water, for a total volume of 20μl. Samples were incubated in a Thermal Cycler (Bio-Rad) following the manufacturer’s protocol and stored at –20°C. Multiplex PCR for the expression of DDAH1, and iNOS were standardized through comparison to 18S ribosomal RNA expression in the same reactions. PCR reactions (total volume of 20μl) contained 1μl of RT product, PowerUp SYBR Green master mix, and 0.5μM forward and reverse primers for each gene (Thermo Fisher). DDAH1 was amplified using the forward primer: 5' GCAACTTTAGATGGCGGAGA 3' and the reverse primer: 5' CCAGTTCAGACATGCTCACG 3'. iNOS was amplified using the forward primer: 5' GCGTTACTCCACCAACAATGGCAA 3' and the reverse primer: 5' ATAGCGGATGAGCTGAGCATTCCA 3'. We utilized negative controls for each reaction that contained reaction mixture and primers without cDNA to ensure we did not have contamination. The real-time PCR reaction was performed following the manufacturer’s protocol using Mastercycler RealPlex 4 (Eppendorf, Hauppauge, NY). We used 18S as the control gene. This was amplified using the forward primer (5' CCAGAGCGAAA GCATTTGCCAAGA 3') and the reverse primer (5' TCGGCATCGTTTATGGTCGGAACT 3'). The relative mRNA expression levels were calculated using ΔΔCt method [19].
Nitrite assay
Cell media was collected from LCL 75 cm² flasks. This was then assayed for concentrations of nitrite (NO2) using a chemiluminescence NO analyzer (Sievers, Boulder, CO) [7, 20]. As described previously, 100μl of media was placed in a reaction chamber containing a mixture of NaI in glacial acetic acid to reduce NO2− to NO. NO gas was transferred into the NO analyzer through a constant flow of helium gas. The analyzer was normalized via a NaNO2 standard curve.
DDAH activity assay
DDAH activity (μmols/min) was determined by measuring the conversion of ADMA to L-citrulline [22]. Briefly, the cell lysate (5μL) was incubated with 1mmol/L ADMA (Sigma-Aldrich, St. Louis, MO) and 0.1mol/L phosphate buffer (pH 6.5) at 37°C for 120 minutes. This first reaction was stopped by the addition of equal volume 10% trichloroacetic acid (G-Biosciences, St. Louis, MO). The second step required addition of 0.8% diacetyl monoxime (Thermo Fisher) and 0.5% antipyrine (Thermo Fisher). This mixture was then incubated at 60°C for 110 minutes. 200μL of the supernatant was then transferred into a plate and analyzed by a spectrophotometer at 466nm. An L-citrulline standard curve was created using varying concentrations of L-citrulline (Sigma-Aldrich, St. Louis, MO) DDAH activity (V) was then calculated using the following equation:
Statistical analysis
Values are shown as mean±standard error. An unpaired t-test was used to compare data between genotypes (SigmaPlot, Systat Software, San Jose, CA). Differences were considered significant at p < 0.05.
Results
DDAH1 expression was similar between genotypes
LCLs isolated from neonatal cord blood were genotyped as either DDAH1 rs480414 SNP (AA) or wild-type (GG) were stimulated with IL-4, IL-13, and PMA for 48 hours. The cells were then harvested for either protein or mRNA. There were no differences in the levels of DDAH1 protein levels between genotypes as determined by Western blot (Fig. 1A), DDAH1 mRNA was determined by qPCR, and no difference was found in DDAH1 mRNA between the AA and the GG genotypes (Fig. 1B).

DDAH1 mRNA and protein expression in LCLs by DDAH1 rs480414 genotype. A. LCLs with the DDAH1 rs480414 SNP (AA) (n = 8) had similar levels of DDAH1 protein expression compared to DDAH1 rs480414 WT (GG) LCLs (n = 9, p = 0.81). Representative Western blot and protein densitometry shown of DDAH1 SNP (AA) normalized to β-actin and presented as fold change from DDAH1 WT (GG). B. LCLs with the DDAH1 rs480414 SNP (AA) (n = 7) had similar levels by RT-PCR compared to DDAH1 rs480414 WT (GG) LCLs (n = 8, p = 0.54). DDAH1 mRNA expression shown after normalization to 18S ribosomal RNA expression.
LCLs with either the AA or GG genotype were stimulated with IL-4, IL-13, and PMA for 48 hours and protein was harvested. Protein was incubated with ADMA, followed by incubation with a colormix containing diacetyl monoxime and antipyrine. Spectrophotometry was then used to measure the conversion of ADMA to L-citrulline. LCLs with the DDAH1 SNP had similar DDAH activity when compared to DDAH1 WT LCLs (Fig. 2).

DDAH activity in LCLs by DDAH1 rs480414 genotype. Protein was incubated with ADMA, followed by incubation with a colormix containing diacetyl monoxime and antipyrine. Spectrophotometry was then used to measure the conversion of ADMA to L-citrulline. Specific activity (μmols/mg/min) is shown after normalization to protein (in mg). LCLs with the DDAH1 rs480414 SNP (AA) (n = 11) had similar DDAH1 specific activity compared to DDAH1 rs480414 WT (GG) LCLs (n = 12, p = 0.8).
LCLs with either the AA genotype or the GG genotype were stimulated with IL-4, IL-13, and PMA for 48 hours and protein was harvested. Western blot analysis for markers of apoptosis, cleaved caspase-3 and cleaved caspase-8, was subsequently performed. DDAH1 SNP (AA) and WT (GG) LCLs had similar levels of cleaved caspase-3 protein (Fig. 3A), and similar cleaved caspase-8 protein levels (Fig. 3B).

Cleaved caspase-3 and -8 protein expression in LCLs by DDAH1 rs480414 genotype. A. LCLs with the DDAH1 rs480414 SNP (AA) (n = 8) had similar levels of cleaved caspase-3 protein expression compared to DDAH1 rs480414 WT (GG) LCLs (n = 9, p = 0.22). Representative Western blot and protein densitometry shown normalized to total caspase-3 and presented as fold change from DDAH1 WT (GG). B. LCLs with the DDAH1 rs480414 SNP (AA) (n = 7) had similar levels of cleaved caspase-8 protein expression compared to DDAH1 rs480414 WT (GG) LCLs (n = 8, p = 0.5). Representative Western blot and protein densitometry shown normalized to total caspase-8 and presented as fold change from DDAH1 WT (GG).
LCLs with either AA or GG genotype were stimulated with IL-4, IL-13, and PMA for 48 hours. The cells were then harvested for mRNA. LCLs with the DDAH1 SNP had similar iNOS mRNA expression compared to DDAH1 WT LCLs (Fig. 4A).

iNOS mRNA expression in LCLs and media nitrite levels by DDAH1 rs480414 genotype. LCLs with the DDAH1 rs480414 SNP (AA) (n = 7) had similar levels of iNOS mRNA expression compared to DDAH1 rs480414 WT (GG) LCLs (n = 8, 0.98). Cell media was assayed for concentrations of nitrite (NO_2 -) using a chemiluminescence NO analyzer. Nitrites were normalized to protein (in mg). LCLs with the DDAH1 rs480414 SNP (AA) (n = 3) had lower nitrite levels compared to DDAH1 rs480414 WT (GG) LCLs (n = 3, p < 0.05).
Cell media from LCLs was collected and then assayed for concentrations of nitrite (NO2-) using a chemiluminescence NO analyzer. We found that nitrite levels were significantly lower in the DDAH1 SNP LCLs than in the DDAH1 WT LCLs (p < 0.05) (Fig. 4B).
Conclusions
The primary objective of this study was to determine if the DDAH1 SNP rs480414 affects cell function. The main findings of this study were that LCLs with the DDAH1 SNP rs480414 (AA) compared to DDAH1 WT (GG) LCLs had: 1) no change in DDAH1 protein expression, mRNA expression, or DDAH activity; 2) no change in cleaved caspase-3 or cleaved caspase-8 protein levels; 3) similar iNOS mRNA expression; and 4) lower nitric oxide production.
BPD-PH and NO metabolism
BPD-associated PH causes significant morbidity and mortality among preterm infants [3]. BPD-PH is characterized by vascular remodeling secondary to increased smooth muscle cell proliferation and overall decreased vascular surface area [1]. NO, a potent vasodilator and apoptotic mediator, is produced by NOS. ADMA, a competitive inhibitor of NOS, is associated with diseases of endothelial dysfunction [13, 16]. In a study by Pullamsetti et al. of adults with idiopathic pulmonary hypertension, plasma ADMA concentrations were increased compared to healthy controls [24]. This is consistent with a recent study from our group where patients with PH had higher levels of ADMA when compared with controls without PH, in a cohort of BPD patients [15].
DDAH/ADMA/NOS axis and endothelial dysfunction
DDAH1 hydrolyzes ADMA to L-citrulline and dimethylamine. A study by Wang et al. of DDAH1 deficient rats found significant lung vessel muscularization, vascular remodeling, and fibrosis after monocrotaline-induced pulmonary artery hypertension [25]. DDAH1 deficient rats had significantly lower lung endothelial-NOS (eNOS) and greater lung ADMA. A study by Leiper et al. using DDAH1 knockout mice observed decreased NO and increase in ADMA resulting in endothelial dysfunction of both the pulmonary and systemic vasculature [26]. A study by Hu et al. using endothelial-specific DDAH1 knockout mice found significantly reduced DDAH1 protein expression, increased plasma ADMA, and increased systemic blood pressure in the knockout mice when compared to wild-type mice [8]. Taken together, these data highlight the critical regulatory role DDAH1 plays in modulating vascular pressure via its effect on NO production.
Apoptosis is protective against the pulmonary vascular remodeling seen in BPD-PH
Apoptosis is the vital process of programmed cell death, a fundamental cellular process [27]. Cellular proliferation is a key finding in pulmonary vascular remodeling, which characterizes BPD-PH, and thus apoptosis is needed to reverse this process. Caspases are important mediators of apoptosis. Caspase-3 is required for cleavage of essential cellular proteins while caspase-8 aids in dissemination of the apoptotic signal [27, 28]. All caspases are initially found in an inactive form which is then activated after cleavage. Our group recently used DDAH1 knockdown by siRNA in human fetal pulmonary microvascular endothelial cells (hfPMVECs) to determine the effect of DDAH1 expression on NO bioavailability. We found that DDAH1 knockdown led to decreased NO production, as well as decreased cleaved caspase-3 and cleaved caspase-8 protein levels, as well as increased viable cell numbers (a measure of cellular proliferation). Treatment with an NO donor reversed these findings [21]. These data support a role for DDAH1 as a key regulator of NO-mediated apoptosis.
In the present study, we hypothesized that in LCLs, the DDAH1 SNP rs480414A variant would result in a gain of function mutation in DDAH1, which would lead to greater NO-mediated apoptosis than DDAH1 WT LCLs, and ultimately have a protective effect against BPD-PH, supported by a clinical study that this DDAH1 SNP was less common in BPD patients with PH than without PH [17]. Although we observed no statistically significant differences between the two genotypes in this study there was a trend towards increased DDAH1 mRNA in the LCLs with the DDAH1 SNP and there was also trend toward increased cleaved caspase-3 in the LCLs with the SNP. These trends taken together suggest that the SNP may be associated with increased DDAH activity leading to increased apoptosis. This is the first study to provide evidence regarding the potential effect of the DDAH1 SNP rs480414A variant on DDAH1 function in cell culture.
DDAH activity
We determined that DDAH activity was similar between the genotypes. These findings may be limited by the small LCL sample size or by the DDAH activity assay that was used. The colorimetric method used in this study has been described in several previous studies [22, 29]. However, other studies have used a radiochemical assay to measure DDAH activity [26]. One study used a radioisotope DDAH activity assay and found that DDAH activity decreased with pH and was significantly inhibited by the lipid oxidation product 4-HNE, a marker of oxidative stress [30]. It is possible that through improvements in technique, we may be able to detect differences in DDAH activity between the two genotypes.
Gene polymorphism and clinical correlation
DDAH SNPs have been shown to affect gene function. Ding et al. discovered a novel loss-of-function variant in DDAH1 was associated with decreased DDAH activity, decreased DDAH1 mRNA, increased ADMA levels, as well as increased risk for thrombotic stroke or coronary heart disease compared to controls [11]. DDAH genetic variation has also been shown to be protective against disease. Lamden et al. found that septic shock patients with the DDAH2 rs805305 SNP had decreased mortality compared to patients without the SNP [31]. Thaha et al. also studied the DDAH2 rs805305 SNP and found that healthy controls were more likely to have the minor allele (SNP) than patients requiring hemodialysis [32].
We found that NO production is significantly lower in LCLs with DDAH1 SNP compared to DDAH1 WT, which is not consistent with our hypothesis. The effects of NO are complex, since it is known to interact with reactive oxygen species, metal ions, and proteins. Perhaps more importantly, the effects of NO can be dose-dependent and are known to be cell-type specific [33]. Therefore, these contradictory results do not exclude the possibility that DDAH1 SNP rs480414 is protective against PH in BPD patients. Further study is needed to determine if DDAH1 SNP rs480414 affects DDAH activity and NO production in hPMVECs.
It is important to note that the DDAH1 rs480414 SNP is located within the intron of the DDAH1 gene. Introns are important regulatory regions that can affect transcription through alternative splicing, or modulating promoters and/or terminators [34]. We speculate that the location of the DDAH1 rs480414 SNP within the intron of the DDAH1 gene may allow for changes in transcription which, depending on cell type and environmental factors, could alter DDAH1 mRNA levels and DDAH activity.
In conclusion, previous studies have shown that DDAH1 plays a key role in NO production and these data provide the first evidence that DDAH1 rs480414 SNP lowers nitric oxide production in cell culture. We speculate that DDAH1 function is critical to maintain a healthy pulmonary vascular endothelium and to prevent and/or ameliorate pulmonary vascular remodeling that occurs in BPD-PH.
Footnotes
Acknowledgments
The authors would like to thank Dr. Kim L. McBride, Dr. Leif D. Nelin, and the fellowship scholarly oversight committee of Dr. Avante D. Milton for their support and contributions to this research project. We thank the families who consented to this research. Biospecimens used for this project were provided by Ohio Perinatal Research Network Perinatal Research Repository institutional specimen repositories.
Financial support
This work was funded by an intramural grant from the Center for Clinical and Translational Research at The Research Institute, Nationwide Children’s Hospital (CTSA grant UL1TR001070) and NHLBI (K08 HL129080, PI: Trittmann).
Human research
This research was conducted in accordance with the ethical standards of all applicable national and institutional committees and the World Medical Association’s Helsinki Declaration. This research was approved by the Institutional Review Board at Nationwide Children’s Hospital, Columbus, Ohio, USA.
Disclosures
The authors have nothing to disclose.
