Associations of variants of folate cycle genes with features of the clinical course of severe intraventricular hemorrhages in premature infants

Abstract

BACKGROUND:

Summary data indicate that it has increased attention to the study of the role of the folate cycle and the genes encoding its key components in the complicated course of the neonatal period in premature infants. Therefore, the aim of our study was to investigate the relationship of folate cycle gene variants with the features of the neonatal course in premature infants with severe intraventricular hemorrhages (IVH).

METHODS:

The study included 24 preterm infants with with IVHs of 3^d and 4^th degree that received standard clinical, laboratory and instrumental examination.

RESULTS:

Apgar scores at 1 and 5 minutes were significantly lower in patients with AA genotype according to variant A1298C of the MTHFR gene. The concentration of total protein on 6^th day after birth was negatively correlated with the A66G variant of the MTRR gene. The mean concentration of ionized calcium in the first day after birth was higher in the subgroup of patients with the AA genotype (according to variant A1298C of the MTHFR gene). In the subgroup of patients requiring mechanical ventilation, the frequency of AA genotype according to variant A2756G of the MTR gene was significantly increased. The presence of respiratory disorders and oxygen dependence was negatively correlated with variant A1298C MTHFR. The day of surfactant administration was positively correlated with variant A1298C of the MTHFR gene.

CONCLUSION:

The results of this study indicate that gene variants MTHFR (C677T, A1298C), MTRR (A66G), MTR (A2756G), RFC1 (G80A) may affect the neonatal course in premature infants with severe IVH.

Keywords

Folate cycle gene intraventricular hemorrhage preterm infants

Abbreviations

ALV

artificial lung ventilation

IVH

intraventricular hemorrhage

nCPAP

nasal continuous positive airway pressure

not significant

odds ratio

statistical power

PCR

polymerase chain reaction

1 Introduction

Intraventricular hemorrhage (IVH) in premature infants is a pressing medical and social problem. They occupy the first place in the structure of neonatal morbidity. The incidence of IVH varies widely according to different data, as it depends on the organization of obstetric and neonatal care. The overall reported incidence of IVH in preterm infants ranges from 7 to 72%. Among them –from 5 to 52% account for IVH of 3–4 degrees (2022 ICD-10-CM diagnosis code –P52.2) [1]. This group of newborns has a high mortality rate or the development of severe long-term consequences in survived children. The follow-up confirms that 3–4 grade IVHs lead to long-term neurological and neuropsychiatric disabilities, including convulsions, cognitive and executive impairment, and cerebral palsy [2, 3]. That is why the study of risk factors, pathogenesis and consequences of severe IVH is important both when choosing tactics for managing a pregnant woman at risk of premature birth, and when managing a newborn from the risk group for developing IVH from the first minutes of life to follow-up.

Summary data indicate that IVH in preterm infants is a complex developmental disorder in which both the environment and the baby’s genome contribute [4]. Recently, attention has increased to the study of the role of the folate cycle and the genes encoding its key components. The explanation for this is the important role of folic acid in fetal formation and metabolic processes during the period of adaptation to extrauterine conditions. In particular, folic acid deficiency is associated with miscarriage, congenital malformations of the nervous system in the fetus, macrocytic anemia, malnutrition in children, delayed psychomotor development, etc [5]. At the same time, almost all studies on folate cycle disorders in newborns with perinatal pathology, in particular with IVH, focus only on variants of the MTFR gene [6], although the variants of other genes are no less important in the pathogenetic aspect –RFC1, MTRR, MTR [7 –9]. Therefore, the aim of our study was to investigate the relationship of folate cycle gene variants with the features of the neonatal course in premature infants with severe IVHs.

2 Materials and methods

2.1 Study population

The study involved 24 premature infants with IVHs of 3d and 4th degree with gestational age from 24 to 32 weeks, birth weight from 620 to 2400 g, who were provided with medical care in neonatal intensive care units of Poltava region. Exclusion criteria were: the presence of birth defects and developmental abnormalities, confirmed TORCH infection.

The study was conducted in accordance with the Declaration of Helsinki. The study was approved by the Ethics Committee of Poltava State Medical University (No. 170 from November 24, 2021). Parents of eligible newborns were briefed regarding the procedure and purpose of the study and a written consent was obtained from the parent of each study participant.

The diagnosis of IVH was made by neurosonography in newborns. The examination took place at least three times during the hospital stay. Stages of IVH were exposed according to the Papile classification [10]. Premature babies received standard clinical, laboratory and instrumental examinations. Clinical and demographic data of children included in the study are presented in the Table 1.

Table 1
Demographic and clinical characteristics of newborns included in the study

Indicators Study group (n = 24)

Gestational age, weeks 28.2±2.4

Body weight at birth, g 1190.2±432.2

Height at birth, sm 36.2±4.2

Sex

female, n (%) 13 (54.2%)

male, n (%) 11 (45.8%)

Apgar score for 1 min, scores 5 [3;6]

Apgar score of 5 minutes, scores 5 [5;7]

Respiratory disorders 15 (62.5%)

Artificial lung ventilation 19 (79.2%)

nCPAP and non-invasive lung ventilation 16 (66.7%)

Surfactant-replacement 19 (79.2%)

Mortality 6 (25.0%)

Indicators	Study group (n = 24)
Gestational age, weeks	28.2±2.4
Body weight at birth, g	1190.2±432.2
Height at birth, sm	36.2±4.2
Sex
female, n (%)	13 (54.2%)
male, n (%)	11 (45.8%)
Apgar score for 1 min, scores	5 [3;6]
Apgar score of 5 minutes, scores	5 [5;7]
Respiratory disorders	15 (62.5%)
Artificial lung ventilation	19 (79.2%)
nCPAP and non-invasive lung ventilation	16 (66.7%)
Surfactant-replacement	19 (79.2%)
Mortality	6 (25.0%)

nCPAP –nasal continuous positive airway pressure.

2.2 Genotype determinations

Molecular genetic studies of MTHFR (C677T, rs1801133; A1298C, rs1801131), MTRR (A66G, rs1801394), MTR1 (A2756G, rs1805087) and RFC1 (G80A, rs1051266) gene variants were carried out using polymerase chain reaction (PCR) with restriction fragments length polymorphisms or allele specific PCR [11]. A brief protocol of molecular genetic research is shown in Table 2.

Table 2
Summary of PCR-RFLP analysis or allele specific PCR

Gene variant Primer sequence Restriction enzyme Size of amplicon and restriction fragments (bp)

MTHFR F: CTTGAACAGGTGGAGGCCAGC HinfI Amplicon:301

C677T R: AGGACGGTGCGGTGAGAGTG C allele: 301

rs1801133 T allele: 125 + 176

MTHFR F₁: GAGGAGCTGACCAGTGAAAA - Amplicon: 82^*

A1298C F₂: GGAGCTGACCAGTGAAAC

rs1801131 R: CTTTGTGACCATTCCGGTTT

MTRR F: CAGGCAAAGGCCATCGCAGAAGACAT NdeI Amplicon: 151

A66G R: CACTTCCCAACCAAAATTCTTCAAAG A allele:25 + 126

rs1801394 G allele:151

MTR F: GTTGGTGAAGGGAGAAGAAATG BsuRI Amplicon: 583

A2756G R: CTGAAGAATGGGGGTCTGTG A allele: 583

rs1805087 G allele: 202 + 381

RFC1 F: CTCCCGCGTGAAGTTCTT HhaI Amplicon: 231

G80A R: AGTGTCACCTTCGTCCCCTC G allele: 37 + 71 + 123

rs1051266 A allele: 71 + 160

Gene variant	Primer sequence	Restriction enzyme	Size of amplicon and restriction fragments (bp)
MTHFR	F: CTTGAACAGGTGGAGGCCAGC	HinfI	Amplicon:301
C677T	R: AGGACGGTGCGGTGAGAGTG	C allele: 301
rs1801133	T allele: 125 + 176
MTHFR	F₁: GAGGAGCTGACCAGTGAAAA	-	Amplicon: 82^*
A1298C	F₂: GGAGCTGACCAGTGAAAC
rs1801131	R: CTTTGTGACCATTCCGGTTT
MTRR	F: CAGGCAAAGGCCATCGCAGAAGACAT	NdeI	Amplicon: 151
A66G	R: CACTTCCCAACCAAAATTCTTCAAAG	A allele:25 + 126
rs1801394	G allele:151
MTR	F: GTTGGTGAAGGGAGAAGAAATG	BsuRI	Amplicon: 583
A2756G	R: CTGAAGAATGGGGGTCTGTG	A allele: 583
rs1805087	G allele: 202 + 381
RFC1	F: CTCCCGCGTGAAGTTCTT	HhaI	Amplicon: 231
G80A	R: AGTGTCACCTTCGTCCCCTC	G allele: 37 + 71 + 123
rs1051266	A allele: 71 + 160

^* –allele specific PCR in 2 tubes.

2.3 Statistical analysis

Statistical analysis was performed using Microsoft Excel Pro Plus 2016 and SPSS v.27 software packages. In the analysis of the basic clinical characteristics, the mean value±standard deviation was calculated. Apgar scores are presented as the median [25%; 75%]. Correlation analysis was performed between the studied indicators using the nonparametric Spearman test. Statistical power indices (sp) were calculated for the detected significant correlations. The probability of differences in quantitative results was determined using the Mann-Whitney U-test. Descriptive statistics and calculation of Pearson’s χ2 criteria with Yates correction were used to compare the distribution of genotype frequencies in groups and subgroups of the study. The association of variants of the studied genes with clinical course factors was investigated using the odds ratio (OR) within 95% of the confidence interval (CI). Differences were considered significant for all types of analysis at a level of p less than 0.05.

3 Results

During the molecular genetic analysis in the study group, the rates of genotypes were determined by variants of folate cycle genes (Table 3). There are no data from full-scale studies of population frequencies of gene variants for Ukraine. Therefore, the rates presented in the works of other research groups were used as a comparison group 1 and 2 [12, 13]. These rates were obtained for unrelated healthy individuals who live on the territory of Ukraine and belong to the same ethnic group (Ukrainian Caucasians).

Table 3
Rates of investigated genes variants in the study groups

Genetic variant Main study group Comparison group 1 [11] Comparison group 2 [12] Statistical differences

n = 24 n = 70 n = 200

MTHFR CC 13 (54.2%) 37 (52.9%) 104 (52.3%) NS

C677T CT 9 (37.5%) 28 (40.0%) 81 (40.7%) NS

rs1801133 TT 2 (8.3%) 5 (7.1%) 14 (7.0%) NS

MTHFR AA 17 (70.8%) 38 (54.3%) 104 (52.0%) NS

A1298C AC 6 (25.0%) 29 (41.4%) 79 (39.5%) NS

rs1801131 CC 1 (4.2%) 3 (4.3%) 17 (8.5%) NS

MTRR AA 5 (20.8%) 25 (35.7%) 43 (21.5%) NS

A66G AG 15 (62.5%) 26 (37.1%) 86 (43.0%) NS

rs1801394 GG 4 (16.7%) 19 (27.1%) 71 (35.5%) NS

MTR AA 17 (70.8%) 51 (72.9%) – NS

A2756G AG 3 (12.5%) 14 (20.0%) – NS

rs1805087 GG 4 (16.7%) 5 (7.1%) – NS

RFC1 GG 8 (33.3%) 34 (48.6%) – NS

G80A GA 9 (37.5%) 23 (32.9%) – NS

rs1051266 AA 7 (29.2%) 13 (18.6%) – NS

Genetic variant	Main study group	Comparison group 1 [11]	Comparison group 2 [12]	Statistical differences
MTHFR	CC	13 (54.2%)	37 (52.9%)	104 (52.3%)	NS
C677T	CT	9 (37.5%)	28 (40.0%)	81 (40.7%)	NS
rs1801133	TT	2 (8.3%)	5 (7.1%)	14 (7.0%)	NS
MTHFR	AA	17 (70.8%)	38 (54.3%)	104 (52.0%)	NS
A1298C	AC	6 (25.0%)	29 (41.4%)	79 (39.5%)	NS
rs1801131	CC	1 (4.2%)	3 (4.3%)	17 (8.5%)	NS
MTRR	AA	5 (20.8%)	25 (35.7%)	43 (21.5%)	NS
A66G	AG	15 (62.5%)	26 (37.1%)	86 (43.0%)	NS
rs1801394	GG	4 (16.7%)	19 (27.1%)	71 (35.5%)	NS
MTR	AA	17 (70.8%)	51 (72.9%)	–	NS
A2756G	AG	3 (12.5%)	14 (20.0%)	–	NS
rs1805087	GG	4 (16.7%)	5 (7.1%)	–	NS
RFC1	GG	8 (33.3%)	34 (48.6%)	–	NS
G80A	GA	9 (37.5%)	23 (32.9%)	–	NS
rs1051266	AA	7 (29.2%)	13 (18.6%)	–	NS

NS –not significant.

After the analysis of variants distribution of the investigated genes in patients with IVH and in the comparison groups, we did not reveal significant differences.

Correlation analysis was performed to establish the relationship between clinical and laboratory parameters and the results of instrumental studies with variants of the studied genes. Significant differences found in the calculations are shown in Table 4.

Table 4

Significant indicators of correlation analysis between variants of the studied genes and clinical parameters

Clinical and laboratory indicators	MTHFR	MTHFR	MTRR	MTR	RFC1
	C677T	A1298C	A66G	A2756G	G80A
	rs1801133	rs1801131	rs1801394	rs1805087	rs1051266
Hematocrit, 6^th day after birth	r_S = 0.503	NS	NS	r_S = 0.518	NS
	p = 0.024			p = 0.019
	sp = 65%			sp = 68%
Apgar scale on 1 min, scores	NS	r_S = 0.616	NS	NS	NS
		p = 0.003
		sp = 90%
Apgar scale on 5 min, scores	NS	r_S = 0.749	NS	NS	NS
		p = 0.001
		sp = 100%
WBC,×10⁹/l, 1^st day after birth	NS	r_S = –0.535	NS	NS	NS
		p = 0.012
		sp = 74%
Lymphocytes, %
6^th day after birth	NS	NS	NS	r_S = 0.558	NS
				p = 0.009
				sp = 79%
Total protein/albumin, g/l, 6^th day after birth	NS	NS	r_S = –0.678	NS	NS
			p = 0.008
			sp = 83%
Calcium serum concentration, mmol/l, 1^st day after birth	NS	r_S = –0.850	NS	NS	r_S = 0.773
		p = 0.007			p = 0.024
		sp = 91%			sp = 70%
Arterial hypertension	NS	NS	NS	NS	r_S = 0.494
					p = 0.020
					sp = 68%
nCPAP and non-invasive lung ventilation	NS	NS	NS	NS	r_S = 0.490
					p = 0.024
					sp = 64%
Oxygen therapy	NS	NS	NS	NS	r_S = 0.627
					p = 0.012
					sp = 77%
Maximum oxygen concentration, %	NS	NS	NS	NS	r_S = 0.697
					p = 0.037
					sp = 60%
Antibacterial therapy	NS	r_S = –0.476	NS	NS	NS
		p = 0.040
		sp = 56%
Artificial lung ventilation	NS	r_S = –0.538	NS	r_S = –0.597	NS
		p = 0.010		p = 0.003
		sp = 77%		sp = 89%
Oxygen dependence	NS	r_S = –0.638	NS	r_S = –0.452	NS
		p = 0.001		p = 0.035
		sp = 94%		sp = 58%
Respiratory disorders	NS	r_S = –0.595	NS	NS	NS
		p = 0.004
		sp = 88%
The day of surfactant administration	NS	r_S = –0.636	NS	NS	NS
		p = 0.008
		sp = 82%

nCPAP –nasal continuous positive airway pressure; WBC –leukocytes; r_S –Spearman’s rank correlation coefficient; p –p-value; sp –statistical power; NS –not significant.

At the next stage of statistical analysis, the obtained significant correlations were further analyzed, the statistical power (sp) of which was greater than 80%.

Apgar scores at 1 and 5 minutes were significantly lower in patients with AA genotype according to variant A1298C of the MTHFR gene: AA vs AC –3[2; 5.25] vs 5 [4.75; 5.25] and 6 [5; 6.5] vs 7 [7; 7.25], respectively. That is, infants with the AC genotype had better Apgar scores at 1 and 5 minutes.

The concentration of total protein on 6^th day after birth was negatively correlated with the A66G variant of the MTRR gene. The average concentration of total protein in the subgroups of patients was as follows: AA –53.0±6.3 g/l, AG –44.3±4.6 g/l and GG –40.3±4.4 g/l. It is known that the protein promotes the transfer of bilirubin to the liver where it is neutralized. Therefore, lower concentrations of total protein may indirectly indicate a violation of detoxification processes in the liver.

The mean concentration of ionized calcium in the first day after birth in the subgroup of patients with the AA genotype (according to variant A1298C of the MTHFR gene) was 2.05±0.07 mmol/l, and in the subgroup of patients with the AC genotype –1.08±1.17 mmol/l. Previous studies have shown that higher calcium levels in preterm infants are associated with severe condition and respiratory failure [13].

In the subgroup of patients requiring mechanical ventilation, the frequency of AA genotype according to variant A2756G of the MTR gene was significantly increased (78.9% vs 0.0%, χ² = 4.25, p = 0.039).

The presence of respiratory disorders and oxygen dependence was negatively correlated with variant A1298C MTHFR. Patients with respiratory disorders and in need of oxygen support had a significantly increased frequency of AA genotype (83.3% vs 0.0%, χ² = 6.99, p = 0.008 and 86.7% vs 28.6%, χ² = 4.99, p = 0.026).

The day of surfactant administration was negatively correlated with variant A1298C of the MTHFR gene. Thus, in patients with AA genotypes, the average day of surfactant administration was 1.0±0.0 (for carriers of AC genotype –2.5±1.3), because probably it means earlier development of severe respiratory distress.

4 Discussion

Premature babies have a high risk of developing IVH due to the presence of the so-called germinal (embryonic) matrix, which should gradually disappear as the fetal brain and vascular system mature. That is why the probability of IVH (including grade 3 and 4) increases with decreasing gestational age of the newborn [15]. Conducted studies indicate the multifactorial nature of this disease and have already identified a number of candidate genes covering the coagulation, inflammation and vascular pathways [4]. One of the leading candidates is variants of the MTHFR gene [4, 6]. In this study, we “expanded” the panel of the studied folate cycle genes and investigated their influence on the course of the neonatal course in premature infants with severe IVH.

Our results indicate that for variants C677T and G80A of the MTHFR and RFC1 genes, respectively, there are statistically significant correlations with clinical and laboratory parameters in premature infants with IVH. But found correlations were of low statistical power.

The most significant correlations, the statistical power of which exceeds 80%, were determined for variant A1298C of the MTHFR gene. Analyzing the obtained data, we can say that the presence of the AA genotype is associated with unfavorable clinical and laboratory parameters in premature infants with IVH. We can explain this effect by the fact that the vast majority of alleles A in variant A1298C of the MTHFR gene are associated with the allele T in variant C677T of the MTHFR gene [16, 17]. It was found the effect of variant C677T of the MTHFR gene on the development of perinatal pathology in newborns and critical conditions, as well as reduction of gestation and increase in the frequency of premature birth for carriers of genotypes TT and CT [18]. This study was performed in 2011, since, the order on preconceptive folic acid consumption came into force. And conducting research, we observe no increase in the proportion of people with these variants of the MTHFR gene among the examined premature infants. Instead, a leading value related to the neonatal course was found for another variant of the gene –A1298C, in variants of which the activity of the enzyme is reduced less clearly. The revealed feature can be explained both by the growing consequence of the carried out folioprophylaxis and by features of inheritance of allelic variants of a gene.

We’d like to remind, that MTHFR encodes methy-lenetetrahydrofolate reductase, an intracellular en-zyme that catalyzes the reduction of 5,10-methylene-trahydrofolate to 5-methyltetrahydrofolate, which is necessary for the conversion of homocysteine to methionine. It is the presence of the T allele and the TT genotype according to the C677T variant of the MTHFR gene that is associated with a significant decrease in enzyme activity and, as a consequence, the development of hyperhomocysteine-mia. Which, in turn, leads to endothelial damage, causing coagulation changes, including strokes, thrombosis, vascular disorders, etc [4]. Previous studies have shown that infants with severe perinatal asphyxia had significantly higher homocysteine levels compared to healthy infants (5.24±0.52μmol/l vs 2.8±0.01μmol/l) [18]. Variants of the MTHFR gene are associated with brain damage in the neonatal period, which the researchers explain by the effect of elevated homocysteine levels [4 , 19].

In contrast, Garrido-Barbero M. et al. found no associations between the C677T variant of the MTHFR gene and the risk of developing cerebral synovial thrombosis in neonates [20]. The first explanation for this discrepancy is population differences in the distribution of folate cycle gene variants. The second possible explanation is the not fully studied influence of the potential interaction between the studied variants of maternal and fetal genotypes. Thus, Molloy AM et al. showed that there is a strong linear association between fetal and maternal homocysteine levels [21]. In confirmation –Refsum H. et al. in their study demonstrated that the level of homocysteine in newborns primarily depends on the level of vitamin B12 (which, in turn, depends on the level of vitamin B12 of the mother) and does not depend on variants of C677T gene MTHFR. These results suggest that maternal homocysteine levels, indicators we did not analyze in this study, may be another predictor of the development of IVH in preterm infants.

5 Conclusions

The results of this study indicate that gene variants MTHFR (C677T, A1298C), MTRR (A66G), MTR (A2756G), RFC1 (G80A) may affect the neonatal course in premature infants with severe IVH. In particular, for the AA genotype according to the A1298C variant of the MTHFR gene, a strong correlation was found with unfavorable clinical and laboratory parameters in premature infants with grade 3 and 4 IVHs.

Declaration of competing interest

The authors declared no potential, perceived, or real conflict of interest.

Funding

There is no funding source.

References

Siffel

, Kistler

, Sarda

. Global incidence of intraventricular hemorrhage among extremely preterm infants: A systematic literature review. J Perinat Med. 2021;10:1017–26.

Radic

, Vincer

, McNeely

. Outcomes of intraventricular hemorrhage and posthemorrhagic hydrocephalus in a population-based cohort of very preterm infants born to residents of Nova Scotia from 1993 to 2010. J Neurosurg Pediatr. 2015;15:580–8.

Han

, McKinnon

, CreveCoeur

, Baksh

, Mathur

, Smyser

, et al. Predictors of mortality for preterm infants with intraventricular hemorrhage: A population-based study. Childs Nerv Syst. 2018;34:2203–13.

Ment

, Adén

, Lin

, Kwon

, Choi

, Hallman

, et al. Gene-environment interactions in severe intraventricular hemorrhage of preterm neonates. Pediatr Res. 2014;75:241–50.

, Fadeeva

TYu

, Vasilyeva

, Shishatskaya

. The frequency of genetic markers of the folate cycle in newborns with intrauterine growth retardation. Ross vestn perinatol pediatr. 2015;60:63–6. Russian.

Wang

, Xu

, Jiao

, Wang

, Jing

. Associations between MTHFR gene polymorphisms and the risk of intracranial hemorrhage: Evidence from a meta-analysis. Brain Behav. 2021;11:e01840.

Padmanabhan

, Jia

, Geary-Joo

, Wu

, Ferguson-Smith

, Fung

, et al. Mutation in folate metabolism causes epigenetic instability and transgenerational effects on development. Cell. 2013;155:81–93.

Blom

, Smulders

. Overview of homocysteine and folate metabolism. With special references to cardiovascular disease and neural tube defects. J Inherit Metab Dis. 2011;34:75–81.

Rossokha

, Fishchuk

, Pokhylko

, Cherniavska

, Gorovenko

. Relationship between RFC gene variants (rs1051266) and clinical features of severe intraventricular hemorrhage in preterm infants. Actual Probl Mod Med. 2021;21:30–4. Ukrainian.

10.

Papile

, Burstein

, Koffler

. Incidence and evolution of subependymal and intraventricular hemorrhage: a study of infants with birth weights less than 1,500 gm. J Pediatr. 1978;92(4):529–534.

11.

Rossokha

, Fishchuk

, Sheyko

, Medvedieva

, Gorovenko

. Positive effect of betaine-arginine supplement on improved hyperhomocysteinemia treatment in married couples with reproductive disorders. Georgian Med News. 2020;309:22–8.

12.

Rossokha

, Medvedieva

, Vershyhora

, Gorovenko

. The role of folate exchange genes and intergenic interactions in the development of early reproductive losses and infertility in married couples. Actual Probl Mod Med. 2019;19:29–33. Ukrainian.

13.

Grechanina

. Study of the influence of mtDNA and polymorphic polymorphisms of C677T MTHFR, A66G MTRR genetic variants on clinical manifestations of mitochondrial dysfunctions. MSD thesis, Odessa National Medical University, Odessa. 2012. Ukrainian.

14.

Fishchuk

, Rossokha

, Pokhylko

, Cherniavska

, Gorovenko

. Clinical and Prognostic Value of Calcium and Phosphorus Levels as Possible Markers of Endothelial Dysfunction in Preterm Infants. J Neonatol. 2021;35:108–12.

15.

Szpecht

, Szymankiewicz

, Nowak

, Gadzinowski

. Intraventricular hemorrhage in neonates born before 32 weeks of gestation-retrospective analysis of risk factors. Childs Nerv Syst. 2016;32:1399–404.

16.

Ogino

, Wilson

. Genotype and haplotype distributions of MTHFR677C > T and A > C single nucleotide polymorphisms: a meta-analysis. J Hum Genet. 2003;48:1–7.

17.

Fan

, Yang

, Zhi

, Wang

, Zheng

, Sun

. Combined genotype and haplotype distributions of MTHFR C677T and AC polymorphisms: A cross-sectional descriptive study of 13,473 Chinese adult women. Medicine. 2016;95:e5355.

18.

Rossokha

, Gorovenko

, Pokhilko

, Kyriachenko

, Olkhovych

. Genetically specified disorders of folate metabolism in neonates with critical conditions. Neonatol Surg Perinatal Med. 2015;17:94–9. Ukrainin.

19.

Harteman

, Groenendaal

, Benders

, Huisman

, Blom

, de Vries

. Role of thrombophilic factors in full-term infants with neonatal encephalopathy. Pediatr Res. 2013;73:80–6.

20.

Garrido-Barbero

, Arnaez

, Loureiro

, Arca

, Agut

, Garcia-Alix

. The Role of Factor V Leiden, Prothrombin G0A, and MTHFR C677T Mutations in Neonatal Cerebral Sinovenous Thrombosis. Clin Appl Thromb Hemost. 2019;25:1076029619834352.

21.

Molloy

, Mills

, McPartlin

, Kirke

, Scott

, Daly

. Maternal and fetal plasma homocysteine concentrations at birth: the influence of folate, vitamin B12, and the 5,10-methylenetetrahydrofolate reductase 677C-> T variant. Am J Obstet Gynecol. 2002;186:499–503.

22.

Refsum

, Grindflek

, Ueland

, Fredriksen

, Meyer

, Ulvik

, et al. Screening for serum total homocysteine in newborn children. Clin Chem. 2004;50:1769–84.