A simple blood preparation method for nucleic acid amplification tests using membranes

Abstract

BACKGROUND:

To detect most of bloodborne pathogens, serum must be separated from whole blood for efficient nucleic acid amplification. Centrifugation is the most commonly used preparation step for whole blood, but it is not easy to use a centrifuge in rural areas where electricity is not accessible.

OBJECTIVE:

This study aimed to develop a simple method for obtaining serum suitable for nucleic acid amplification without the use of any instruments.

METHODS:

Whole blood spiked with Escherichia coli (E. coli) was separated into serum and cellular fraction using 2 closely attached membranes with different characteristics. After brief heating, bacterial DNA in the serum was used for polymerase chain reaction (PCR).

RESULTS:

Serum was successfully separated from cellular fraction after filtration of one membrane sheet. Membrane sheet containing serum was heated and bacterial DNA in the serum was used for PCR. The quality and concentration of DNA in the heated serum was sufficient for PCR and amplified E. coli gene products were observed.

CONCLUSIONS:

Separation of bacteria-containing serum was feasible using two membrane sheets and the DNA isolated from serum can be used for PCR after brief heating.

Keywords

Membrane centrifugation blood nucleic acid amplification

1. Introduction

Nucleic acid amplification assays (NAAs), such as polymerase chain reaction (PCR) or loop-mediated isothermal amplification (LAMP), are commonly used in disease diagnosis [1, 2, 3, 4]. Most NAAs utilize pure nucleic acids isolated from samples as amplification templates because the purity enhances NAA performance. Therefore, pretreatment methods for clinical specimens are essential for NAAs.

Many bloodborne pathogens, including bacteria, viruses, and parasites, can be detected in serum or plasma. Since blood cells and other particulate components in the blood can interfere with many in vitro diagnostic assays and especially NAAs, the liquid fraction of blood (i.e., serum or plasma) is commonly used as a primary source for detecting pathogens after pretreatment of whole blood, such as via centrifugation. In the past, NAAs were only used in well-equipped laboratories, but the need for NAAs to be performed at infection sites has been recently increasing due to the many advantages of NAAs over rapid immune tests. NAAs can identify the presence and type of specific pathogens and even detect the presence of antibiotic resistance. As NAA convenience improves and usability of miniaturized devices increases [5, 6], the possibility of employing NAAs in point-of-care testing has become more feasible.

Although centrifugation is the best method for separating the liquid fraction from whole blood, electricity is essential for running the instrument. In many local areas, electricity is not accessible or stably supplied; therefore, it is necessary to have an alternative method that does not rely on electricity to separate the liquid fraction for NAAs. In addition to liquid phase pretreatment, nucleic acid isolation is required before initiating NAAs. In this study, we aimed to develop a method for separating the liquid phase from whole blood using two sheets of membranes followed by brief heating to facilitate the use of isolated DNA for NAAs.

2. Materials and methods

2.1 Materials

To prepare total DNA from blood samples, the QIAamp DNA Mini Kit (#51304) from Qiagen (Hilden, Germany) was used. PCR reactions were performed using 2X TOPsimple DyeMIX (aliquot)-nTaq (#P561T) from Enzynomics (Daejeon, Korea). All reagents were purchased from Sigma-Aldrich (St. Louis, MO, USA) unless otherwise specified.

2.2 Blood sample collection and DNA preparation

Fresh whole blood samples were collected from our hospital. Peripheral blood from six healthy individuals, three females and three males, was collected in ethylenediaminetetraacetic acid (EDTA)-treated bottles. Blood samples were used for the experiments as long as 48 hours after collection and discarded thereafter. All participants provided written informed consent before participating in the study. The Ethics Committee and Institutional Review Board of our hospital approved all experimental procedures, and all experiments were performed in accordance with the relevant guidelines and regulations.

For spike testing, 30 $\mu$ L of whole blood was mixed with 10 $\mu$ L (10 ${}^{5}$ ) Escherichia coli. The bacterial concentration was measured at an optical density of 600 nm using a spectrophotometer before spiking.

To separate the liquid fraction from whole blood using the centrifugation method, whole blood was transferred from an EDTA bottle to a small centrifuge tube and spun for 5 min at 3000 $\times$ g. The supernatant (liquid fraction) was transferred to a new clean tube, and DNA isolation was performed following the QIAamp DNA Mini Kit protocol. To separate the liquid fraction from whole blood using the new method devised in this study, 40 $\mu$ L of whole blood with or without spiked E. coli was transferred onto the surface of the first membrane sheet, referred to as the separation membrane. The separation membrane allows the liquid fraction to diffuse away from blood cells. After 60 s of separation, the liquid fraction on the other side of separation membrane was transferred to the second membrane sheet called the sample membrane. During the transfer process, pressure applied onto the separation membrane increases the volume of transferred liquid fraction from the separation membrane to the sample membrane.

The sample membrane sheet was then cut into small pieces, and some were placed in a 1.5-mL tube and soaked in 200 $\mu$ L of the lysis buffer provided with the QIAamp DNA Mini Kit. After 5 min of vortexing, the membrane pieces were removed and the remaining solution in the tube was used for DNA isolation. The other membrane pieces were placed in a 1.5-mL tube and soaked with 200 $\mu$ L distilled water. DNA isolation was performed following the QIAamp DNA Mini Kit protocol, or the 1.5-mL tube containing the isolated liquid fraction was incubated at 60 ${}^{\circ}$ C for 10 min using a thermal cycler from Bio-Rad Laboratories (Hercules, CA, USA), after which 5 $\mu$ L of the diluted solution was used for PCR. The heating method was modified based on our previous study [7].

2.3 Membranes used for blood sample preparation

In this study, we used two different membrane sheets. The separation membrane was designed to separate the liquid fraction from blood cells and particulate components. The sample membrane was designed to contain the liquid fraction transferred from the separation membrane and to provide a space for the DNA isolation procedure. The two membrane sheets were very closely positioned without adhering to each other. Each sheet was 2 $\times$ 5 cm in dimension and with suitable features specific for its purpose. The separation membrane was made of natural wood fibers with a pore size between 1–10 $\mu$ m, thickness of 200–1200 $\mu$ m, 60–300 gram/m ${}^{2}$ in weight, and a micron rating of 2–4 $\mu$ m. The optimal conditions were 10- $\mu$ m pore size, 1000- $\mu$ m thickness, 250 gram/m ${}^{2}$ in weight, and a 3 $\mu$ m micron rating. The sample membrane was made of nitrocellulose with pore sizes of 0.01–1 $\mu$ m and a thickness of 100–800 $\mu$ m. The optimal conditions were a pore size of 0.1 $\mu$ m and a thickness of 400 $\mu$ m.

2.4 Measurement of DNA quality

The quality of isolated DNA was measured using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) that measured absorbance at 260 and 280 nm. The 260/280 absorbance ratio was then used to evaluate DNA quality.

2.5 PCR

PCR was performed using a PCR kit, and DNA samples were prepared via different methods as described above. The PCR cycling conditions were as follows: initial denaturation at 95 ${}^{\circ}$ C for 5 min, amplification for 35 cycles (denaturation at 95 ${}^{\circ}$ C for 30 sec, annealing at 55 ${}^{\circ}$ C for 30 s, and extension at 72 ${}^{\circ}$ C for 30 s), and a final elongation step at 72 ${}^{\circ}$ C for 5 min. Primers targeting the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene were used to identify the presence of human cells, while primers targeting the E. coli ligB gene were used to identify bacterial cells in the serum. Primer sets are listed in Table 1. PCR product sizes were 197 bp (E. coli ligB) and 208 bp (GAPDH). PCR was performed at least in triplicate.

Table 1
Primer sets used for PCR

Primer	Sequence (5’-3’)
Human GAPDH forward	GGAGCGAGATCCCTCCAAAAT
Human GAPDH reverse	GGCTGTTGTCATACTTCTCATGG
E. coli ligB forward	CGATTTACCGCAGCCAGA
E. coli ligB reverse	AAGCCATCTCCTGATGAC

3. Results

3.1 Separation of liquid fraction from whole blood using the membranes

To investigate whether separation and transfer of the liquid fraction using two membranes is feasible, separation membranes and sample membranes were observed with the naked eye after applying 40 $\mu$ L of whole blood to the upper surface of the separation membrane. This upper surface showed a strong blood stain with a slightly visible stain on the bottom surface of the separation membrane. There was only a slight trace of blood cells on the upper surface of the sample membrane (Fig. 1). As is shown in Fig. 1, after applying 40 $\mu$ L of whole blood on one surface of the separation membrane and waiting 1 min for separation, the liquid fraction was successfully transferred to the sample membrane, while most of the blood cells remained on the separation membrane.

Figure 1.

Photographic images of the separation and sample membranes after applying 40 $\mu$ L of whole blood to the upper surface of the separation membrane. The upper surface of the separation membrane shows a mass of blood cells with a slightly visible amount of blood on its bottom surface. Only a small trace of blood cells on the upper surface of the sample membrane is visible.

3.2 DNA isolation

Although we observed that the liquid fraction can be transferred to the sample membrane (Fig. 1), we still had to evaluate whether bacteria in whole blood can be transferred with the liquid fraction. In addition, the efficiency of bacterial transfer had to be verified in comparison with the centrifugation method. In this study, we isolated DNA using three different methods; for the first method, whole blood was centrifuged, and the liquid fraction was collected for DNA isolation using the QIAamp DNA Mini Kit. For the second, we performed the new membrane transfer technique and then the sample membrane was used for DNA isolation using the same QIAmp kit. Finally, membrane transfer was performed and then the sample membrane was used for DNA isolation using our heating method. Using 40 $\mu$ L of whole blood spiked with 10 ${}^{5}$ bacteria cells, the centrifugation method provided the highest DNA concentration. Moreover, DNA quality was similar between the methods that utilized the kit and was slightly lower with the heating method (Table 2).

Table 2
Concentration and purity of DNA isolated via three different methods

Method	Concentration (ng/ $\mu$ L)	260/280
Centrifugation $+$ Qiagen kit	1.7	1.85
Membrane separation $+$ Qiagen kit	1.5	1.91
Membrane separation $+$ heating	1.4	1.76

To evaluate if the membrane separation and heating method produces consistent results, we repeated the process several times and found minimal differences between the tests. Furthermore, after spiking whole blood with different concentrations of bacteria, we measured the isolated DNA concentration. With increased bacterial number, DNA concentration was also higher; however, there was no linear correlation between the number of bacteria and concentration of DNA (Table 3). This finding indicates that usage of our separation method is restricted to qualitative assays and is not feasible for quantitative analysis.

Table 3

Concentration of isolated DNA after spiking whole blood with different bacterial concentrations, followed by membrane separation and heating

Number of bacteria in 10 $\mu$ L	Concentration of DNA (ng/ $\mu$ L)
10 ${}^{6}$	7.8
10 ${}^{5}$	1.4
10 ${}^{4}$	1.1

Figure 2.

Gel electrophoresis image of the PCR products after using primers targeting the E. coli gene for comparison of the centrifugation and membrane separation with heating methods. Lanes 1–5: whole blood mixed with bacteria and then centrifuged. DNA was isolated from serum; lane 6: centrifuged whole blood (not mixed with bacteria). DNA was isolated from serum; lanes 7–12: whole blood mixed with bacteria and then separated using membranes. DNA was isolated from the membrane after heating; lane 13: negative control: lane 14: positive control.

3.3 PCR following DNA isolation

Even though serum transfer with the membranes was feasible as shown in Fig. 1, it remained unclear whether bacterial transfer accompanied the liquid fraction and if DNA isolated from the membrane is appropriate for PCR. Therefore, we evaluated the quality of isolated DNA via PCR targeting the human GAPDH gene and E. coli ligB gene; the PCR products of primers targeting the E. coli ligB gene are shown in Fig. 2. We compared the centrifugation and membrane separation with heating methods and found that both methods resulted in amplification of the E. coli gene, indicating that the membrane separation method produces similar results as the centrifugation method. In Fig. 3, the PCR products of primers targeting the human GAPDH gene are shown. We found that both methods did not always result in amplified PCR products of the human GAPDH gene. This finding indicates that both the centrifugation and membrane separation methods cannot completely exclude blood cells from all samples and that both methods yielded similar results. To confirm primer specificity for E. coli and human genes, we evaluated the PCR products using DNA isolated from pure bacteria and human whole blood (Fig. 4).

Figure 3.

Gel electrophoresis image of the PCR products after using primers targeting the human GAPDH gene for comparison of the centrifugation and membrane separation with heating methods. Lanes 1–5: whole blood mixed with bacteria and then centrifuged. DNA was isolated from serum; lane 6: centrifuged whole blood (not mixed with bacteria). DNA was isolated from serum; lanes 7–12: whole blood mixed with bacteria and then separated using membranes. DNA was isolated from the membrane after heating; lane 13: negative control.

Figure 4.

Gel electrophoresis image of the PCR products after using primers targeting the human GAPDH gene. Lanes 1–5: DNA isolated from pure bacteria; lanes 6–11: DNA isolated from human whole blood.

4. Discussion

Molecular diagnostic assays are one of the most advanced tools for detecting microorganisms. However, efficient nucleic acid amplification requires the isolation of pure nucleic acids from clinical samples. Blood is one of the most common clinical samples, and separation of the liquid fraction from whole blood is required as an initial step. Centrifugation is the most widely used preparation method of whole blood for obtaining liquid fractions, but it is not feasible to use a centrifuge when electricity is not accessible or stably supplied. Thus, we designed and investigated a relatively simple method for separating the liquid fraction and isolating nucleic acids without the need for an instrument. The findings in this study demonstrated that separation of the liquid fraction was feasible using two membrane sheets and that the isolated DNA from the liquid fraction after brief heating was of sufficient quantity and quality for performing PCR.

The method demonstrated in this paper is simple but not superior to centrifugation in many aspects. Loss of liquid fraction is greater than that with centrifugation because a large portion of the liquid is absorbed in the membrane itself once the blood penetrates the full depth of the membrane. Contamination with blood cells in the liquid fraction was similar to the centrifugation method; however, we used a low centrifugation speed. A high-speed centrifugation will produce a cleaner liquid fraction than our method. Even though our method is not superior to centrifugation, it can still provide sufficient quality of isolated DNA for use in NAAs without utilizing a centrifuge. The acceptable level for nucleic acid purity may vary with downstream applications, such as next-generation sequencing, PCR, LAMP, and microarrays, but nucleic acids with 260/280 absorbance ratios of approximately 1.8 are generally considered to be free of significant contamination in the case of DNA [8]. The 260/280 ratio of DNA isolated using our method was 1.76, which is close to the generally acceptable purity level for DNA. The reason why the DNA purity achieved with our method was lower than other commercial methods is that our protocol skips the purification step to simplify the process. Furthermore, although we used heating, the procedure can be performed without heating using a PCR instrument or heating block.

5. Conclusion

Separation of the liquid fraction from whole blood using two membrane sheets and the subsequent heating of the isolated liquid can be useful in areas where centrifugation is not possible and can provide isolated DNA with sufficient quality and quantity suitable for NAAs.

Footnotes

Acknowledgments

This research was supported by a grant of the Korea Health Technology R&D Project through the Korea Health Industry Development Institute (KHIDI), funded by the Ministry of Health and Welfare, Republic of Korea (grant number: 1465025739) and Kyungpook National University.

Conflict of interest

There is no conflict of interest to disclose.

Supplement 1. QIAamp DNA Mini Kit (#51304) Protocol

Isolation of bacterial DNA from biological fluids

Pellet bacteria by centrifugation for 10 min at 5000 $\times$ g (7500 rpm)

Resuspend bacterial pellet in 180 $\mu$ l Buffer ATL (supplied in the QIAamp DNA Mini Kit).

Add 20 $\mu$ l proteinase K, mix by vortexing, and incubate at 56 ${}^{\circ}$ C until the tissue is completely lysed. Vortex occasionally during incubation to disperse the sample, or place in a shaking water bath or on a rocking platform.

Briefly centrifuge the 1.5 ml microcentrifuge tube to remove drops from the inside of the lid.

Add 200 $\mu$ l Buffer AL to the sample, mix by pulse-vortexing for 15 s, and incubate at 70 ${}^{\circ}$ C for 10 min. Briefly centrifuge the 1.5 ml microcentrifuge tube to remove drops from inside the lid.

Add 200 $\mu$ l ethanol (96–100%) to the sample, and mix by pulse-vortexing for 15 s. After mixing, briefly centrifuge the 1.5 ml microcentrifuge tube to remove drops from inside the lid.

Carefully apply the mixture from step 6 (including the precipitate) to the QIAamp Mini spin column (in a 2 ml collection tube) without wetting the rim. Close the cap, and centrifuge at 6000 $\times$ g (8000 rpm) for 1 min. Place the QIAamp Mini spin column in a clean 2 ml collection tube (provided), and discard the tube containing the filtrate.

Carefully open the QIAamp Mini spin column and add 500 $\mu$ l Buffer AW1 without wetting the rim. Close the cap, and centrifuge at 6000 $\times$ g (8000 rpm) for 1 min. Place the QIAamp Mini spin column in a clean 2 ml collection tube (provided), and discard the collection tube containing the filtrate.

Carefully open the QIAamp Mini spin column and add 500 $\mu$ l Buffer AW2 without wetting the rim. Close the cap and centrifuge at full speed (20,000 $\times$ g; 14,000 rpm) for 3 min.

10.

Recommended: Place the QIAamp Mini spin column in a new 2 ml collection tube (not provided) and discard the old collection tube with the filtrate. Centrifuge at full speed for 1 min.

11.

Place the QIAamp Mini spin column in a clean 1.5 ml microcentrifuge tube (not provided), and discard the collection tube containing the filtrate. Carefully open the QIAamp Mini spin column and add 200 $\mu$ l Buffer AE or distilled water. Incubate at room temperature for 1 min, and then centrifuge at 6000 $\times$ g for 1 min.

Supplement 2. Modified heating method protocol

Isolation of bacterial DNA from serum in the membrane

The sample membrane sheet blotted with serum was cut into small pieces

The pieces were placed in a 1.5 mL tube.

After adding 200 $\mu$ L of distilled water onto the membrane pieces, 1.5-mL tube was boiled at 60 ${}^{\circ}$ C for 10 min using a thermal cycler or heating block.

The 1.5 mL tube with boiled serum sample was centrifuged at 6000 $\times$ g for 10 min.

After centrifugation, 5 $\mu$ L of the solution was used as a template for PCR.

References

Saiki

Scharf

Faloona

Mullis

Horn

Erlich

, et al. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science. 1985; 230: 1350-4.

Notomi

Okayama

Masubuchi

Yonekawa

Watanabe

Amino

, et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000; 28: E63.

Johnson

Ayers

McClure

Richardson

Tellier

. Detection and identification of Bartonella species pathogenic for humans by PCR amplification targeting the Riboflavin Synthase Gene (ribC). J Clin Microbiol. 2003; 41: 1069-72.

Parida

Sannarangaiah

Dash

Rao

Morita

. Loop mediated isothermal amplification (LAMP): a new generation of innovative gene amplification technique; perspectives in clinical diagnosis of infectious diseases. Rev Med Virol. 2008; 18: 407-21.

Mauk

Song

Bau

Gross

Bushman

Collman

, et al. Miniaturized devices for point of care molecular detection of HIV. Lab Chip. 2017; 17: 382-394.

Kopp

Mello

Manz

. Chemical amplification: continuous-flow PCR on a chip. Science. 1998; 280: 1046-8.

Lee

Han

Choe

Yun

, et al. Comparison of different methods of RNA preparation from peripheral blood for nucleic acid amplification assay. Indian J Med Microbiol. 2018; 36: 77-80.

Manchester

. Value of A260/A280 ratios for measurement of purity of nucleic acids. Biotechniques. 1995; 19: 208-10.