Co-expression of soluble guanylyl cyclase subunits and PDE5A shRNA to elevate cellular cGMP level: A potential gene therapy for myocardial cell death

Abstract

BACKGROUND:

Genetic manipulation on the NO-sGC-cGMP pathway has been rarely achieved, partially due to complexity of the soluble guanylyl cyclase (sGC) enzyme.

OBJECTIVE:

We aim to develop gene therapy directly targeting the pathway to circumvent cytotoxicity and tolerance after prolonged use of NO-donors and the insufficiency of PDE inhibitors.

METHODS:

In this study, we constructed lentivirus vectors expressing GUCY1A3 and GUCY1B3 genes, which encoded the $\alpha$ 1 and $\beta$ 1 subunits of soluble guanylyl cyclase (sGC), respectively, to enhance cGMP synthesis. We also constructed lentiviral vector harboring PDE5A shRNA to alleviate phosphodiesterase activity and cGMP degradation.

RESULTS:

Transductions of human HEK293 cells with the constructs were successful, as indicated by the fluorescent signal and altered gene expression produced by each vector. Overexpression of GUCY1A3 and GUCY1B3 resulted in increased sGC enzyme activity and elevated cGMP level in the cells. Expression of PDE5A shRNA resulted in decreased PDE5A expression and elevated cGMP level. Co-transduction of the three lentiviral vectors resulted in a more significant elevation of cGMP in HEK293 cells without obvious cytotoxicity.

CONCLUSION:

To the best of our knowledge, this is the first study to show that co-expression of exogenous subunits of the soluble guanylyl cyclase could form functional enzyme and increase cellular cGMP level in mammalian cells. Simultaneous expression of PDE5A shRNA could alleviate feedback up-regulation on PDE5A caused by cGMP elevation. Further studies are required to evaluate the effects of these constructs in vivo.

Keywords

Soluble guanylyl cyclase PDE5A lentiviral vector cGMP gene therapy

1. Introduction

Ischemic and hypertensive heart disease are the leading causes of death in the world over the past decade. Over 7.4 million people die of these diseases annually and the number is still rising [1, 2]. Multiple molecular pathways have been shown to regulate the critical balance between cell death and cell survival in heart ischemia [3]. Especially the discovery of nitric oxide (NO) as an endogenous signaling molecule and as a mediator of the cardiovascular effects was acknowledged by the Nobel Prize in Physiology and Medicine in 1998 [4].

The best characterized target for NO signal transduction is the heme-containing enzyme soluble guanylyl cyclase (sGC) [5]. sGC is a heterodimer contains $\alpha$ and $\beta$ subunits. Each sGC subunit has two isoforms ( $\alpha$ 1/ $\alpha$ 2 and $\beta$ 1/ $\beta$ 2) encoded by four different genes. Only sGC heterodimers containing the $\beta$ 1 subunit exhibit catalytic activity in vivo. Both $\alpha$ subunits ( $\alpha$ 1 and $\alpha$ 2) have similar catalytic properties, but with different tissue distribution [6]. NO activates sGC by binding to its prosthetic heme group and thereby catalyzing the synthesis of cGMP from GTP. As a critical second messenger molecule, cGMP regulates many vital homeostatic mechanisms, i.e. endothelial cell permeability, vascular smooth muscle contractility and survival of cardiomyocytes via various effector proteins such as protein kinases, phosphodiesterase, and ion channels [7].

Understanding the NO-sGC-cGMP pathway has initiated significant translational interests to manage cardiovascular disease by manipulating cellular levels of cGMP both before and after the disease onset. So far, such efforts were almost exclusively embodied in the use of NO donors and phosphodiesterase (PDE) inhibitors [8, 9]. NO donors are not ideal for long-term treatment of heart diseases due to their partial patient responses, development of tolerance over time and short retention time in the patients’ plasma [9, 10]. The use of PDE inhibitors is also likely to be limited since the efficacy of such molecules depends on endogenous cGMP generation [11]. Although targeting the NO-sGC-cGMP axis with molecular medicines may help overcome these issues and lead to promising novel therapy for cardiovascular disease, it has not been studied whether co-expression of the $\alpha$ and $\beta$ subunits of sGC can produce functional enzymes and subsequently increase cGMP production in human cells.

In this study, we successfully elevated cGMP level in the HEK293 cell line by simultaneous overexpression of the $\alpha$ 1 and $\beta$ 1 subunits of sGC using lentiviral vectors. Increased level of cGMP may lead to the up-regulation of PDE5A, a phosphodiesterase that specifically degrades cGMP molecules [12, 13]. Therefore, we also constructed lentiviral vectors harboring PDE5A shRNAs to counter such potential negative feedback effects. We found that co-expression of the $\alpha$ 1 and $\beta$ 1subunits of sGC and PDE5A shRNA can lead to significant and stable elevation of cellular level of cGMP.

2. Materials and method

2.1 Cell culture

Human Embryonic Kidney 293 (HEK293) cell line was purchased from American Tissue Culture Collection (ATCC) and cultured as recommended. Briefly, the cells were maintained in DMEM supplemented with 10% heat-inactivated fetal bovine serum (FBS) in an atmosphere of 95% air and 5% CO ${}_{2}$ at 37 ${}^{\circ}$ C. Cells were treated with 10 $\mu$ mol/L sodium nitroprussiate (SNP), a NO donor, for different time periods to serve as a positive control.

2.2 Lentivirus

Lentiviral vectors carrying the $\alpha$ 1 or $\beta$ 1 subunits of sGC or shRNAs of PDE5A were constructed using the scarless golden gate assembly and TALEN technology (Cyagen Biosciences Inc., Guangzhou, China). Gene sequences of GUCY1A3 and GUCY1B3, encoding the $\alpha$ 1 and $\beta$ 1 subunits of sGC respectively were retrieved from NCBI gene database (http://www.ncbi.nlm.nih.gov/gene) and synthesized de novo. Sequences encoding the fluorescent reporters (mCherry or EGFP) were inserted after the antibiotics-resistance genes, rather than directly after the GUCY1A3 and GUCY1B3 genes, to avoid any potential functional influences on sGC. PDE5A shRNA were designed using online tools at Cyagen Biosciences. Three different designs of PDE5A shRNA were constructed. Empty vectors or vector harboring scramble shRNA was used as negative controls, respectively.

HEK293 cells were transfected with lentiviral vectors using a standard procedure. Briefly, cells were seeded to be 40% confluent at a 35 mm culture dish. 10 $\mu$ l lentiviral vector was diluted in 1 ml DMEM medium containing 10% FBS and added to the cells for 15 hours. After withdraw of the vector-DMEM complex, cells were added with 2 ml DMEM medium containing 10% FBS and incubated for 10 hours. Cells were then treated with the corresponding antibiotics (10 ug/ml blasticidin and/or 400 ug/ml neomycin) for 24 hours before analysis. Fluorescent images were captured using a Nikon TE2000-E inverted microscope.

2.3 Gene expression analysis

Total RNA was isolated from cells using Trizol reagents (Life Technology, Shanghai, China) following the manufacturer’s protocol. Degradation of RNA was examined by 28 s versus 18 s ratio on 1% agarose gels. RNA concentrations were measured using a Nanodrop Vis-UV spectrophotometer (Thermo Scientific, USA).

Reverse transcription and amplification of genes was conducted using 100 ng of total RNA and a two-step RT-PCR protocol from Life Technology according to the manufacturer’s protocol (Life Technology, Shanghai, China). Gene expression was also examined quantitatively using the SYBR green method (Life Technology, Shanghai, China) using an Applied Biosystems 7900HT system. Relative expression of each gene was calculated as Delta CT vs. the house keeping gene GAPDH (CT ${}_{\text{GENE}}$ –CT ${}_{\text{GAPDH}}$ ). Primer sequences used are listed as below. GUCY1A3 forward: TGTGGCAAGGGCAAGTTGTG, reverse: AGGCATCGCCAATGGTCTCC; GUCY1B3 forward: CTCGCTGGTTCGTCCTCATA, reverse: CAGTCCCAGTCAGTTCATCC; PDE5A forward: TCCACGGGACAGCCCAAAG, reverse: GGACAAGAGCAAGATTCGGTGTGG; GAPDH forward: CGCTGAGTACGTCGTGGAGTC, reverse: GCTGATGATCTTGAGGCTGTTGTC. Significant decrease in Delta CT commonly suggested significant increase in gene expression.

2.4 Protein extraction and enzyme-linked immunosorbent assay (ELISA)

Cells were digested by trypsin and collected in 1 ml Eppendorf tubes with 200 $\mu$ l PBS. Total protein extracts from cultured cells were obtained by repeated freezing and thawing from 80 ${}^{\circ}$ C to 37 ${}^{\circ}$ C for three times. The resulting solution was spun at 13,000 rpm for 5 min at 4 ${}^{\circ}$ C. Protein concentration was determined by BCA protein assay (Sigma Aldrich, Shanghai, China). sGC activity and cellular cGMP level were measured by commercially available Elisa Kits (BioVision, USA) according to the manufacturer’s protocol.

2.5 Statistical analysis

For gene expression analysis and ELISA, all samples were measured in triplicate. Data were presented as mean $\pm$ standard error (SE) of the mean. All experimental groups were compared with the control group separately by Student’s $t$ -test. All $P$ values were 2-sided with $P$ less than 0.05 considered statistically significant. All analyses were conducted using SAS 9.4 (SAS Institute, USA).

3. Results

3.1 HEK293 cells were responsive to SNP treatment

HEK293 cells were treated with 10 $\mu$ mol/L sodium nitroprussiate (SNP), a commonly used NO donor, for different time periods. The cellular level of cGMP increased with treatment time and peaked at 20 minutes (Suppl. Fig. 1). The results suggested that HEK293 cells were NO-responsive and suitable for the subsequent co-expression analysis.

Figure 1.

Lentivirus transduction of the $\alpha$ or $\beta$ subunit of sGC in HEK293 cells. Lentivirus vector maps of the $\alpha$ (A) or $\beta$ (B) subunits of sGC, harboring the hGUCY1A3 and hGUCY1B3 genes, respectively, were shown. HEK293 cells exhibited red (mCherry) or green (EGFP) fluorescence after transduction (C and D) as expected.

3.2 Co-expression of GUCY1A3 and GUCY1B3 elevated expression of both genes in HEK293 cells

Lentiviral vectors expressing the human GUCY1A3 or GUCY1B3 genes were constructed (Fig. 1A and B). Cherry or green fluorescence was observed as expected in HEK293 cells 24 hours after transfection with corresponding lentiviral vectors (Fig. 1C and D). A minimal transfection rate of $>$ 75% was estimated. Fluorescence remained strong after at least three passages of cell culture under the selection of blasticidin/neomycin treatment.

We then examined expression of our target genes in the transduced HEK293 cells using primers specific for GUCY1A, GUCY1B3, PDE5A and the house keeping gene GAPDH by RT-PCR and real time RT-PCR (Fig. 2A and B). Comparing to control cells that were transduced with empty vector, co-transduction of GUCY1A3 and GUCY1B3 significantly increased expression of both the $\alpha$ 1 subunit ( $P<$ 0.01) and $\beta$ 1 subunit of SGC ( $P<$ 0.01) (Fig. 2B). The expression of PDE5A did not significantly changed after transduction, indicating no feedback regulation on PDE5A in HEK293 cells (Fig. 2B).

Figure 2.

Gene expression, enzyme activities and cellular cGMP levels after lentivirus transduction of the $\alpha$ and $\beta$ subunits of sGC in HEK293 cells. Expression of the hGUCY1A3 ( $\alpha$ 1 subunit, $\alpha$ ), hGUCY1B3 ( $\beta$ 1 subunit, $\beta$ ) and PDE5A (PD) were examined by RT-PCR (A) and Real time-RT-PCR (B). The expression of GAPDH (GAP) served as internal control. Corresponding sGC activities (C) and cellular cGMP levels (D) were also examined. $\alpha+\beta$ : co-transduced with lentivirus vectors carrying $\alpha$ and $\beta$ subunits of sGC; vector: transduced with empty lentivirus vector; $-$ : negative control. ${}^{**}P<$ 0.01; ${}^{***}P$ <0.001 compared with control cells transduced with empty vector.

Figure 3.

Gene expression and cellular cGMP levels after shRNA transduction in HEK293 cells. A: Lentivirus vector map of PDE5A shRNA. B: HEK293 cells exhibited green (EGFP) fluorescence after transduction. C: After transduction with lentivirus vectors harboring scramble or PDE5A shRNA, expression of the PDE5A gene was examined by RT-PCR. The expression of GAPDH served as an internal control. D: Cellular level of cGMP was also examined. SH1-SH3: three different designs of PDE5A shRNA; P: PDE5A; G: GAPDH. ${}^{*}P<$ 0.05; ${}^{**}P<$ 0.01 compared with control cell transduced with constructs carrying scramble shRNA.

Figure 4.

Cellular cGMP level after co-transduction of sGC subunits and PDE5A shRNA. ${}^{**}P<$ 0.01; ${}^{***}P<$ 0.001 compared with control cells transduced with empty vector.

3.3 Co-expression of GUCY1A3 and GUCY1B3 in HEK293 cells resulted in increased sGC activity and cellular cGMP level

To investigate whether the co-expressed $\alpha$ 1 and $\beta$ 1 subunits of sGC are functional, we further examined sGC activity and cGMP level in the transduced cells. SGC enzyme activity was significantly higher in cells co-transduced with GUCY1A3 and GUCY1B3 comparing to control cells ( $P<$ 0.01) (Fig. 2C). The increased sGC activity also correlated with a significant increase in the cellular level of cGMP ( $P<$ 0.001) (Fig. 2D). These results together suggested that the co-expressed $\alpha$ 1 and $\beta$ 1 subunits sGC formed functional enzyme in the cells.

3.4 PDE5A shRNA decreased PDE5A expression and cellular cGMP level

Elevated level of cGMP may lead to the feedback up-regulation of PDE5A, a phosphodiesterase that specifically degrades cGMP in cardiomyocytes. To counter such potential feedback regulation on PDE5A, we designed PDE5A shRNA and investigated their effects in HEK293 cells (Fig. 3A). Transfections were successful for all constructs as indicated by the EGFP fluorescence observed in HEK293 cells 24 hours after transfection (Fig. 3B). As shown by the results of RT-PCR, the control cells exhibited strong expression of PDE5A, which were efficiently suppressed after transduction by any of the three shRNA constructs (Fig. 3C). Moreover, comparing to the control cells, down-regulation of PDE5A expression had led to an up to 53% significant increases in the cellular level of cGMP ( $P<$ 0.01) (Fig. 3D).

3.5 Co-Expression of GUCY1A3, GUCY1B3 and PDE5A shRNA in HEK293 cells increased cellular cGMP level collectively

We further investigated the synergetic effect of constructs. When co-expressed with GUCY1A3, GUCY1B3 and PDE5A shRNA, the cellular level of cGMP in HEK293 cells was slightly higher than cells transduced with GUCY1A3 and GUCY1B3 alone, but significantly higher than the control cells transduced with empty vector ( $P<$ 0.001) (Fig. 4). The result indicated a potential synergetic effect between sGC and PDE5A shRNA.

4. Discussion

NO-sGC-cGMP signaling and its cross talk with a variety of signal transduction molecules are important in many vital physiology processes. Numerous studies suggest that activation or enhancement of the pathway inhibits hypertrophy, decreases fibrosis, and protects against cardiac ischemia-reperfusion (I/R) injury [14, 15]. Although with great translational interests, treatments targeting the pathway have been limited to NO donors and PDE inhibitors that are not ideal. Stimulators or activators directly acting on the sGC are currently under development to avoid cytotoxicity, insufficiency or others negative side-effects of prolonged use of such agents [6]. Here, we report a genetic method that can moderately and stably elevate cGMP level in human cells, which underlies a potential gene therapy applicable to a range of cardiovascular diseases.

NO mediates its functions through its primary receptor sGC. Activated sGC converts GTP to cGMP and pyrophosphate (PPi). It has been well known now that cGMP acts as a ubiquitous second messenger in intracellular signaling cascades, which serves to regulate the activity of a number of downstream proteins [14, 16]. As a key player of the pathway, diminished expression and function of sGC has been shown to contribute to the pathogenesis of several cardiovascular disorders [17, 18]. Moreover, the chromosomal region harboring GUCY1A3 and GUCY1B3, which encodes the $\alpha$ 1 and $\beta$ 1 subunits of sGC, has been associated with risk of coronary artery disease and myocardial infarction in genome-wide studies [19, 20, 21]. These findings supported sGC as an important therapeutic target of the NO-sGC-cGMP signaling pathway.

The expression of sGC subunits is modulated at different levels, i.e. mRNA abundance, stability of mRNA and protein degradation [22, 23, 24, 25, 26]. Several studies reported that the regulation of steady-state sGC mRNA or function levels occurs in response to environmental stimuli such as oxidative stress and electric stimulation [6, 27]. Due to the clinical importance of targeting sGC activity, great efforts have been made on the development of haem-dependent sGC stimulators and haem-independent sGC activators [6]. On the other hand, no study has attempted to increase sGC level genetically in mammalian cells despite of the theoretical feasibility. We therefore co-expressed the $\alpha$ 1 and $\beta$ 1 subunits of human sGC in similar ratio in the human HEK293 cells through a lentiviral system. We showed that co-transduction of the two subunits of the enzyme produced functional sGC, as indicated by the elevated sGC activity and cGMP level in the transduced cells comparing with control cells. We did not observe any obvious feedback influences on sGC activity by the elevated cellular level of cGMP. It has been reported that cGMP is a poor inhibitor of sGC and measurable inhibition was observed only at millimolar concentrations of cGMP [28].

We constructed lentiviral vector harboring PDE5A shRNA to alleviate phosphodiesterase activity and cGMP degradation. Feedback upregulation of PDE5A expression by cGMP has been reported previously [11], but not observed in the current study. It is possible that the constructs we used only increase cGMP levels moderately (1.5–1.7 times) that was not sufficient to upregulate PDE5A. Nevertheless, expression of PDE5A shRNA in HEK293 cells resulted in decreased PDE5A expression and elevated cGMP level. HEK293 cells transduced with lentiviral vectors harboring PDE5A shRNA in combination with GUCY1A3 and GUCY1B3 exhibited the highest level of cGMP.

As a prototype of future molecular therapeutics, we have used lentiviral vectors that can infect diverse types of non-dividing cells with high efficiency. Use of lentiviral vectors to modulate gene expression has become standard practice in many areas of biomedical science [29]. Although the safety of lentiviral vectors has been largely improved, endogenous gene disruption is still a concern. Such off-target effects could be controlled by designing targeted insertion or by limiting the amount of transducing units used. To improve the safety of our construct, hypoxia responsive element (HRE) could be added to the promoter regions to allow conditional expression of the constructs only under conditions such as heart ischemia that lack of oxygen [30]. Evidence is emerging that the subcellular location of sGC and cGMP may be critical for their functions, although the underlying mechanisms are yet to be clarified [14, 16]. Such critical information should also be incorporated in our design of the constructs in the future.

5. Conclusion

Interventions targeting the NO-sGC-cGMP pathway are promising treatments for cardiovascular diseases such as heart ischemia. Genetic manipulation on the pathway has been rarely achieved, partly due to the complexity of the soluble guanylyl cyclase enzyme. We constructed lentiviral vectors harboring GUCY1A3 and GUCY1B3 that encode the $\alpha$ 1 and $\beta$ 1 subunits of sGC, respectively, which successfully produced the functional enzyme and enhanced cellular cGMP synthesis. Moreover, lentiviral vector harboring PDE5A shRNA were constructed to alleviate cGMP degradation. The constructs provided a prototype for genetic manipulation of the NO-sGC-cGMP cascade, which warrants further validation and improvement as a potential molecular medicine,

Footnotes

Conflict of interest

None to report.

Funding

This work was supported by grant 16JCYBJC42900 from the Natural Science Foundation of Tianjin City. The funding agency did not have a financial interest in the subject matter discussed in this manuscript.

Supplementary data

Supplementary Fig. 1.

Cellular cGMP levels after treatment of 10 umol/L sodium nitroprussiate. ${}^{*}P<$ 0.05; ${}^{**}P<$ 0.01 compared with control cells transduced with empty vector.

References

Amini

Zayeri

Salehi

. Trend analysis of cardiovascular disease mortality, incidence, and mortality-to-incidence ratio: Results from global burden of disease study 2017. BMC Public Health. 2021; 21(1): 401.

Ziaeian

Fonarow

. Epidemiology and aetiology of heart failure. Nature Reviews Cardiology. 2016; 13(6): 368-78.

Buja

. Myocardial ischemia and reperfusion injury. Cardiovascular Pathology: The Official Journal of the Society for Cardiovascular Pathology. 2005; 14(4): 170-5.

DeMartino

Kim-Shapiro

Patel

Gladwin

. Nitrite and nitrate chemical biology and signalling. British Journal of Pharmacology. 2019; 176(2): 228-45.

Triposkiadis

Xanthopoulos

Skoularigis

Starling

. Therapeutic augmentation of NO-sGC-cGMP signalling: Lessons learned from pulmonary arterial hypertension and heart failure. Heart Failure Reviews. 2022; 27(6): 1991-2003.

Sandner

Follmann

Becker-Pelster

Hahn

Meier

Freitas

, et al. Soluble GC stimulators and activators: Past, present and future. British Journal of Pharmacology. 2021.

Blanton

. cGMP signaling and modulation in heart failure. Journal of Cardiovascular Pharmacology. 2020; 75(5): 385-98.

Kukreja

Salloum

Das

. Cyclic guanosine monophosphate signaling and phosphodiesterase-5 inhibitors in cardioprotection. Journal of the American College of Cardiology. 2012; 59(22): 1921-7.

Papapetropoulos

Hobbs

Topouzis

. Extending the translational potential of targeting NO/cGMP-regulated pathways in the CVS. Br J Pharmacol. 2015; 172(6): 1397-414.

10.

Tsai

Kass

. Cyclic GMP signaling in cardiovascular pathophysiology and therapeutics. Pharmacology & Therapeutics. 2009; 122(3): 216-38.

11.

Dunkerly-Eyring

Kass

. Myocardial phosphodiesterases and their role in cGMP regulation. Journal of Cardiovascular Pharmacology. 2020; 75(6): 483-93.

12.

Kass

Champion

Beavo

. Phosphodiesterase type 5: Expanding roles in cardiovascular regulation. Circulation Research. 2007; 101(11): 1084-95.

13.

Zhang

Kass

. Phosphodiesterases and cardiac cGMP: Evolving roles and controversies. Trends in Pharmacological Sciences. 2011; 32(6): 360-5.

14.

Burley

Ferdinandy

Baxter

. Cyclic GMP and protein kinase-G in myocardial ischaemia-reperfusion: Opportunities and obstacles for survival signaling. British Journal of Pharmacology. 2007; 152(6): 855-69.

15.

Ignarro

. Nitric oxide is not just blowing in the wind. British Journal of Pharmacology. 2019; 176(2): 131-4.

16.

Lukowski

Krieg

Rybalkin

Beavo

Hofmann

. Turning on cGMP-dependent pathways to treat cardiac dysfunctions: Boom, bust, and beyond. Trends in Pharmacological Sciences. 2014; 35(8): 404-13.

17.

Rippe

Albinsson

Guron

Nilsson

Sward

. Targeting transcriptional control of soluble guanylyl cyclase via NOTCH for prevention of cardiovascular disease. Acta Physiologica. 2019; 225(1): e13094.

18.

Satoh

Wang

Espinosa-Diez

Wang

Hahn

Noda

, et al. Metabolic Syndrome Mediates ROS-miR-193b-NFYA-Dependent Downregulation of Soluble Guanylate Cyclase and Contributes to Exercise-Induced Pulmonary Hypertension in Heart Failure With Preserved Ejection Fraction. Circulation. 2021; 144(8): 615-37.

19.

Schunkert

Konig

Kathiresan

Reilly

Assimes

Holm

, et al. Large-scale association analysis identifies 13 new susceptibility loci for coronary artery disease. Nature Genetics. 2011; 43(4): 333-8.

20.

Consortium

CAD

Deloukas

Kanoni

Willenborg

Farrall

Assimes

, et al. Large-scale association analysis identifies new risk loci for coronary artery disease. Nature Genetics. 2013; 45(1): 25-33.

21.

Wobst

Rumpf

Dang

Segura-Puimedon

Erdmann

Schunkert

. Molecular variants of soluble guanylyl cyclase affecting cardiovascular risk. Circulation Journal: Official Journal of the Japanese Circulation Society. 2015; 79(3): 463-9.

22.

Baltrons

Garcia

. Nitric oxide-independent down-regulation of soluble guanylyl cyclase by bacterial endotoxin in astroglial cells. Journal of Neurochemistry. 1999; 73(5): 2149-57.

23.

Kloss

Rodenbach

Bordel

Mulsch

. Human-antigen R (HuR) expression in hypertension: Downregulation of the mRNA stabilizing protein HuR in genetic hypertension. Hypertension. 2005; 45(6): 1200-6.

24.

Sharina

Cote

Martin

Doursout

Murad

. RNA splicing in regulation of nitric oxide receptor soluble guanylyl cyclase. Nitric Oxide: Biology and Chemistry/Official Journal of the Nitric Oxide Society. 2011; 25(3): 265-74.

25.

Alexandre

Leiria

Silva

Mendes-Silverio

Calmasini

Davel

, et al. Soluble guanylyl cyclase (sGC) degradation and impairment of nitric oxide-mediated responses in urethra from obese mice: Reversal by the sGC activator BAY 60-2770. The Journal of Pharmacology and Experimental Therapeutics. 2014; 349(1): 2-9.

26.

Yue

Chen

. Post-transcriptional regulation of soluble guanylate cyclase that governs neuropathic pain in alzheimer’s disease. Journal of Alzheimer’s Disease: JAD. 2019; 71(4): 1331-8.

27.

Kim

Park

Nam

Han

Cho

. Potential therapeutic mechanism of extremely low-frequency high-voltage electric fields in cells. Technology and Health Care: Official Journal of the European Society for Engineering and Medicine. 2016; 24(3): 415-27.

28.

Lee

Martin

Murad

. Human recombinant soluble guanylyl cyclase: Expression, purification, and regulation. Proceedings of the National Academy of Sciences of the United States of America. 2000; 97(20): 10763-8.

29.

Shearer

Saunders

. Experimental design for stable genetic manipulation in mammalian cell lines: Lentivirus and alternatives. Genes to Cells: Devoted to Molecular & Cellular Mechanisms. 2015; 20(1): 1-10.

30.

Kaluz

Kaluzova

Stanbridge

. Rational design of minimal hypoxia-inducible enhancers. Biochemical and Biophysical Research Communications. 2008; 370(4): 613-8.