Efficient Genetic Modification of Cynomolgus Monkey Embryonic Stem Cells with Lentiviral Vectors

Cell Culture

cmES cells (kindly provided by Dr. Nakatsuji) (37) were maintained in undifferentiated state on irradiated mouse embryonic fibroblasts (MEFs). The culture medium contained 80% Knock-out DMEM (Invitrogen, Carlsbad, CA, USA), supplemented with 16% knockout serum replacement (Invitrogen), 4% fetal bovine serum (Hyclone, Logan, UT, USA), 0.1 mM β-mercaptoethanol (Sigma, St. Louis, MO, USA), 1% nonessential amino acids (Hyclone), 100 IU/ml penicillin (Hyclone), 100 μg/ml streptomycin (Hyclone), and 4 ng/ml human basic fibroblast growth factor (bFGF) (Chemicon, Temecula, CA, USA).

Vector Constructions

To generate a pDest_puro vector, we first performed PCR using pBabe-puro vector DNA (AddGene, Inc., Cambridge, MA, USA) as a PCR template to amplify the fragment of puromycin resistance encoding sequence with restriction enzyme sites of PmlI and KpnI. We subsequently used the PCR product of puromycin resistance encoding sequence to replace both the blasticidin resistance encoding sequence and the bacterial EM7 promoter of lentiviral 2k7_bsd vector between PmlI and KpnI sites of the vector (kindly provided by Dr. David M. Suter, University of Geneva Medical School, Geneva, Switzerland) (38) in order to generate a pDest_puro destination vector, in which the fragment of attR4 site—ccdB-chloramphenicol resistance encoding sequence—attR2 site was still retained. In order to generate entry vectors, EF1α promoter and either hrGFP or dTomato of two different reporter genes were cloned into pDONR™P4-P1R and pDONR™221 (Invitrogen), respectively, by utilizing the Gateway BP recombination reaction following the product instructions. The resulting vectors, which we named pUp-EF1α, pDown-hrGFP, and pDown-dTomato, were then recombined into the pDest_puro vector generated above following the protocol for LR recombination reaction using the Gateway LR plus clonase enzyme mix to construct expression lentiviral vectors, designated as pLV/Final-puro-EF1α-hrGFP or pLV/Final-puro-EF1α-dTomato.

Lentivirus Production and Transduction of cmES Cells

The lentiviral particles were prepared by transient cotransfection of pLV/Final-puro-EF1α-hrGFP or pLV/Final-puro-EF1α-dTomato with pRSV-REV, pCMV-VSVG, and pMDL-G/P-RRE (kindly provided by Professor Hsiang-fu Kung, The Chinese University of Hong Kong, China) into 293FT cells using Lipofectamine 2000. Three days after transfection, viral particles were harvested from the medium, filtered through 0.45-μm pore size polyethersulfone membrane, and concentrated by ultracentrifugation (50,000 × g, for 120 min at 4°C). Titers of the concentrated lentivirus ranged from 5 × 10⁷ to 8 × 10⁷ U/ml. cmES cells were transduced with lentivirus at multiplicity of infection (MOI) of 50 or 100. Undifferentiated cmES cells were washed with PBS and dissociated to single cells by 0.25% TrypLE™ Select (Invitrogen) for 3–5 min at 37°C. A selective Rho-associated kinase (ROCK) inhibitor, Y-27632, was added to the culture medium to enhance the survival of dissociated cmES cells before and after trypsinization as described elsewhere (46). Then the dissociated cells were plated onto the fresh MEF feeder layer with lentiviral particles. Eight hours after infection, the medium was changed to fresh culture medium and cells were incubated at 37°C for a subsequent 16 h. Seven days after transduction, puromycin was added to the culture medium at a concentration of 1–5 μg/ml and maintained for 7 days.

Fluorescence-Activated Cell Sorting Analysis

We analyzed the transduction rate by fluorescence-activated cell sorting (FACS) analysis 5 days after infection. Transduced and untransduced cmES cells were mechanically separated from MEFs and then were dissociated to single cells by TrypLE™ Select. The isolated cells were resuspended in phosphate-buffered saline (PBS) and analyzed on a FACScan (Becton Dickinson, Franklin Lakes, NJ, USA) using excitation at 500 nm (hrGFP) and 554 nm (dTomato) and fluorescence detection at 506 nm (hrGFP) and 581 nm (dTomato). Untransduced cells served as negative controls.

Self-Inactivation of Lentivectors in 293FT Cells

293FT cells (2 × 10⁵) seeded on one well of a six-well plate were transduced with pLV/Final-puro-EF1α-hrGFP (dTomato) concentrated lentivirus for 96 h without changing the medium, when most of the cells expressed green (red) fluorescent protein. The supernatants were then collected and filtered through a 0.45-μm pore size polyethersulfone membrane, and 1 or 2 ml was incubated with newly plated 2 × 10⁵ 293FT cells. Experiments were performed in triplicate. After 72 h of incubation, no green (red) fluorescent protein expression could be detected in 293FT cells incubated in either supernatant, demonstrating that pLV/Final-puro-EF1α-hrGFP (dTomato)-transduced 293FT cells do not release infectious lentiviral particles into the medium.

In Vitro Differentiation of Transduced cmES Cells

For neural differentiation, transduced cmES cells of 80% confluency were dissociated as described above. The resulting cell clumps were cultured in a petri dish to form embryoid bodies (EBs) for 7 days using culture medium containing 20% serum replacement without bFGF, then EBs were plated on the 2% gelatin-coated six-well plate for 14 days using neural progenitor medium (NPM) (51) containing 20 ng/ml bFGF and 20 ng/ml epidermal growth factor (EGF) (Chemicon). For mesodermal differentiation, dissociated transduced cmES cell clumps were cultured in a petri dish to form EBs for 7 days using culture medium containing 20% fetal bovine serum without bFGF, then EBs were plated on a 2% gelatin-coated six-well plate for 14 days using the same medium. For endodermal differentiation, when the cmES cells reached 80% confluency, ES medium was changed to RPMI-1640 medium (Invitrogen) containing 100 ng/ml human activin A (R&D Systems, Minneapolis, MN, USA) and lasted for 5 days.

Teratoma Formation of Transduced cmES Cells

About 1–2 × 10⁷ morphologically undifferentiated fluorescent cmES cells were collected and injected subcutaneously into inguinal groove of 6-week-old nude mice. After 12 weeks, tumors were taken out, fixed in 4% paraformaldehyde, dissected, and examined histologically after hematoxylin and eosin staining. All experimental procedures involving animals were approved by the Animal Ethics Committee of Sun Yat-sen University.

Immunocytochemistry, Immunohistochemistry, and Alkaline Phosphatase Activity Assay

For immunocytochemistry assessment, undifferentiated and differentiated transduced cmES cells were fixed in 4% paraformaldehyde for 20 min and washed twice with PBS. Nonspecific antibody binding was blocked with goat serum and 1% bovine serum albumin (BSA, Sigma) and then incubated with primary antibodies against SSEA-4 (1:200; DSHB, Iowa City, IA, USA), TRA-1-60 (1:200; DSHB), OCT-4 (1:100; Santa Cruz, CA, USA), SOX17 (1:100; R&D Systems), desmin (1: 200; Neomarker, Westinghouse Drive, Fremont, CA, USA), and nestin (1:100; Abcam, Cambridge, UK) overnight at 4°C. Secondary antibody was added at room temperature for 1–2 h in the dark: goat Cy3-conjugated anti-mouse (1:400; Jackson, West Grove, PA, USA), goat R-phycoerythrin-conjugated and fluorescein isothiocyanate-conjugated anti-mouse (1:400; Southernbiotech, Birmingham, AL, USA). Nucleus was counterstained with Hoechst33342 (Sigma). MEFs were used as negative controls.

For immunohistochemistry assessment, formalin-fixed and paraffin-embedded teratoma samples were deparaffinized, rehydrated, and then incubated with fresh 3% hydrogen peroxide (H₂O₂) in methanol for 10 min. After rinsing with PBS, antigen retrieval was carried out by microwave treatment in 0.01 M sodium citrate buffer (pH 6.0) at 100°C for 15 min. Next, nonspecific binding was blocked with normal goat serum for 15 min at room temperature, followed by incubation with anti-βIII-tubulin antibody (1:100; R&D Systems), anti-collagen II antibody (1:200, Chemicon), and anti-AFP antibody (1: 100; R&D Systems) overnight at 4°C. After rinsing with PBS, slides were incubated for 10 min at room temperature with biotin-conjugated secondary antibodies, followed by incubation with streptavidin-conjugated peroxidase working solution for 10 min. Subsequently, sections were stained for 15–30 min with 3-amino-9-ethylcarbazole (AEC), counterstained with Mayer's hematoxylin. Negative controls were prepared by substituting PBS for primary antibody.

The activity of alkaline phosphatase was performed by histochemical staining. Transduced cmES cells were fixed in 4% paraformaldehyde at room temperature for 15 min and washed twice with PBS, and then stained with the alkaline phosphatase substrate BCIP/NBT (Sigma) for 20–30 min. The cells were observed for color reaction by light microscopy.

Reverse Transcription-PCR

Total RNA was extracted from undifferentiated and differentiated transduced cmES cells, or from control MEF cells with Trizol reagent (Invitrogen). For eliminating any contaminating genomic DNA, the total RNA was subjected to DNase I (Fermentas, MD, USA) according to the directions of the manufacturer. Reverse transcription was carried out using murine leukemia virus reverse transcriptase (Fermentas) and oligo-dT primers (Fermentas) according to the manufacturer's instruction. Then the samples were subjected to amplification with human-specific primers. β-Actin was used as positive control. The PCR products were analyzed by 1.2% agarose gel electrophoresis and visualized by ethidium bromide staining. The detailed information of primers is listed in Table 1.

OPEN IN VIEWER

Table 1.

Sequences, Product Size, and Annealing Temperature of Primers Used for PCR Amplification

Gene	Sequence (5′–3′)	Length (bp)	Annealing Temperature (°C)
OCT-4	CGTGAAGCTGGAGAAGGAGAAGCTG CAAGGGCCGCAGCTTACACATGTTC	247	55
Nanog	CAAAGGCAAACAACCCACTT CTGGATGTTCTGGGTCTGGT	426	56
Rex1	CTGAAGAAACGGGCAAAGAC GAACATTCAAGGGAGCTTGC	343	55
SOX2	CAACGGCAGCTACAGCA GGAGTGGGAGGAAGAGGT	283	60
Collagen 1	GATGGATTCCAGTTCGAGTATG GTTTGGGTTGCTTGTCTGTTTC	480	58
SOX17	GGCGCAGCAGAATCCAGA CCACGACTTGCCCAGCAT	60	60
Neurofilament	ACCCGACTCAGTTTCACCA TTCTTCACCTTCACCTCCTTC	356	58
β-Actin	GTGGGGCGCCCCAGGCACCA CTCCTTAATGTCACGCACGATTTC	540	62

Construction of pLV/Final Lentivectors

The self-inactivating lentiviral vector, 2k7_bsd, contains a double recombination cassette (attR4 and attR2 Gateway cassette), which allows the recombination of a promoter and a gene of interest from two separate entry vectors. This vector also contains a blasticidin resistance under the control of a ubiquitous promoter, SV40. Compared with other conventional selection drugs, G418 and hygromycin, the antibiotic puromycin is considered to be more effective in the selection of ES cells with shorter selection time and higher germline differentiating potency (47). We then replaced the blasticidin resistance with a puromycin resistance as described above. This new destination vector was referred to as pDest_puro (Fig. 1). The EF1α promoter was cloned into the recombination site (attL4 and attR1) of the pDONRR1) of the P4-P1R vector, and the reporter gene, hrGFP or dTomato, was subsequently cloned into the recombination site (attL1 and attL2) of the pDONRR1) of the 221 vector, respectively. The generated entry vectors, pUp-EF1α, pDown-hrGFP, and pDown-dTomato (Fig. 1), were then recombined into pDest_puro destination vector to generate two expression clones, pLV/Final-puro-EF1α-hrGFP and pLV/Final-puro-EF1α-dTomato (Fig. 1).

OPEN IN VIEWER

Figure 1.

Construction of pLV/Final lentivectors, pLV/Final-puro-EF1α-hrGFP and pLV/Final-puro-EF1α-dTomato.

Constitutive Expression of hrGFP or dTomato in cmES Cells

cmES cells were transduced by simply being exposed to lentivirus on MEF feeder layers. Five days after transduction, the percentage of hrGFP (Fig. 2a) or dTomato (Fig. 2b) positive cmES cells was analyzed by microscopic observation and FACS analysis. We found that the transduction efficiency was MOI dependent: 30–40% with MOI of 50 and 70–85% with MOI of 100. Transduced cells were then subsequently selected by puromycin (1–5 μg/ml) for 7 days. Fluorescence was observed in all of the infected cmES cells after selection (Fig. 2c, d) and the expression levels were well maintained over 6 months in culture in the absence of the antibiotic. These results suggested that integration of the pLV/Final vectors in undifferentiated cmES cells was stable in vitro and the transduced cmES cells can be maintained as a purified population for a prolonged period after puromycin selection.

OPEN IN VIEWER

Figure 2.

cmES cells were analyzed for hrGFP (a, c) and dTomato (b, d) expression 5 days after transduction (a, b) and 7 days (c, d) after puromycin selection under fluorescent microscope and by FACS. Untransduced cmES cells served as negative control. Scale bars: 100 μm.

Characteristics of Lentivirus-Transduced cmES Cells

The stem cell properties of transduced cmES cells, self-renewal and pluripotency, were assessed by immunocytochemistry, RT-PCR, immunohistochemistry, and histological analysis. hrGFP or dTomato expressed cmES cells maintained the characteristics of the parental cmES cells. The cell morphology was typical of cmES cells (Fig. 3) and they exhibited a high level of alkaline phosphatase activity (Fig. 3a, e), as well as continuing to express the markers of pluripotency, including OCT-4 (Fig. 3b, f), SSEA-4 (Fig. 3c, g), TRA-1–60 (Fig. 3d, h), Nanog, SOX2, and Rex-1 (Fig. 4). Fluorescence microscopy observations (Fig. 5) showed that hrGFP and dTomato expression were well maintained in EBs too (Fig. 5a, e).

OPEN IN VIEWER

Figure 3.

Immunofluorescence analysis of transduced cmES cells. Pluripotent ES cell markers of hrGFP (a–d) and dTomato cmES cells (e–h), including AKP (a, e), OCT-4 (b, f), SSEA-4 (c, g), and TRA-1-60 (d, h) were detected. MEFs were used as negative controls. Scale bars: 100 μm.

OPEN IN VIEWER

Figure 4.

RT-PCR analysis of undifferentiated cmES cells. Expression of markers associated with undifferentiated transduced cmES cells, including OCT-4, Nanog, Rex1, and SOX2 in hrGFP and dTomato cmES cells at passage 35. β-Actin was used as a housekeeping gene control.

OPEN IN VIEWER

Figure 5.

In vitro differentiation assays of transduced cmES cells. hrGFP (a) and dTomato cmES cells formed EBs in vitro (e). Immunofluorescence analysis revealed that these transduced cells differentiated into cells belong to three germ layers, including nestin (b, f), desmin (c, g), and SOX17 (d, h), while maintaining expression of hrGFP and dTomato. MEFs were used as negative controls. Scale bars: 100 μm.

Immunocytochemistry analysis showed that infected cmES cells gave rise to cells expressing ectoderm (nestin), endoderm (SOX17), and mesoderm (desmin) markers (Fig. 5b–d, f–h) in vitro, while sustaining transgene expression. RT-PCR detection demonstrated that these differentiated cmES cells expressed neurofilament (NF), collagen I and SOX17, while OCT-4 expression was downregulated (Fig. 6). Transduced cmES cells also formed teratomas (Fig. 7) 12 weeks after implantation (Fig. 7a, i). Most of the cells inside tumors were hrGFP or dTomato positive (Fig. 7b, j). Histological analysis of teratomas derived from hrGFP cmES (Fig. 7c–h) and dTomato cmES (Fig. 7k–p) revealed that both of them contained derivatives of three germ layers, including ectoderm-derived neural lineage cells (Fig. 7c) and squamous epithelium (Fig. 7k), mesoderm-derived chondrocytes (Fig. 7d), and muscle cells (Fig. 7l), as well as endoderm-derived glandular epithelium (Fig. 7e) and respiratory tract epithelium (Fig. 7m). Immunohistochemistry analysis also revealed that βIII-tubulin (ectoderm marker) (Fig. 7f, n), collagen II (mesoderm marker) (Fig. 7g, o), and AFP (endoderm marker) (Fig. 7h, p) were all expressed in hrGFP or dTomato cmES cell-derived teratomas.

OPEN IN VIEWER

Figure 6.

Expression of pluripotent marker and three germ layer markers in differentiated transduced cmES cells, including OCT-4, neurofilament (NF), collagen 1, and SOX17.

OPEN IN VIEWER

Figure 7.

In vivo differentiation of transduced cmES cells. Transduced cmES cells formed fluorescent teratomas (a, i) 12 weeks later after implantation. Most of the cells inside tumors were hrGFP or dTomato positive (b, j). Histological analysis of teratomas derived from hrGFP cmES (c–h) and dTomato cmES (k–p) revealed that both of them contained derivatives of three germ layers, including ectoderm-derived neural-lineage cells (c) and squamous epithelium (k), mesoderm-derived chondrocytes (d) and muscle cells (l), as well as endoderm-derived glandular epithelium (e) and respiratory tract epithelium (m). Immunohistochemistry analysis also revealed that βIII-tubulin (ectoderm marker) (Fig. 7f, n), collagen II (mesoderm marker) (Fig. 7g, o), and AFP (endoderm marker) (Fig. 7h, p) were all expressed in hrGFP or dTomato cmES cell-derived teratomas. Scale bars: 100 μm.