Characterization,GFP Gene Nucleofection,and Allotransplantation in Injured Tendons of Ovine Amniotic Fluid-Derived Stem Cells

Isolation and Culture of oAFMSCs

The oAFMSCs were isolated and cultured as previously described (49). Briefly, sheep fetuses were collected at a local abattoir by removing the whole pregnant uterus and bringing it at 30°C to the laboratory for further evaluation and processing. Only fetuses of 25–35 cm of length, at approximately 3 months of development, were used. Once opened the uterus wall, ~100 ml of amniotic fluid (AF) was recovered with a sterile 20-ml syringe on a 18-gauge needle. oAFMSCs were centrifuged at 800 × g for 20 min to remove cell debris, and the resulting pellets were seeded in 250-ml flasks in growth medium (GM) composed of minimum essential medium α-transformation (α-MEM) (Gibco) supplemented with 20% fetal calf serum (FCS) (Lonza), 1% ultraglutamine (Lonza), 1% penicillin/streptomycin (Lonza), and 5 ng/ml fibroblast growth factor (β-FGF), as described (4). The cells were incubated at 38.5°C in 5% CO₂. After 7 days of culture, the medium was replaced with fresh medium and was subsequently replaced three times a week. At 80% confluence, the flasks were washed to remove dead cells and debris, the cells were harvested with 0.05% trypsin-EDTA for 5 min at 38.5°C and plated again at 3 ×10³/cm² for 12 consecutive expansion passages.

Mitotic Activity and Cell Proliferation

The mitotic activity of the cells was recorded using the bromodeoxyuridine (BrdU) assay. The cells were plated at a density of 3 × 10³/cm², and when they reached 50% confluence, they were incubated with BrdU labeling medium (10 μmol/l) (5-Bromo-2′-deoxy-uridine Labeling and Detection Kit I, Roche) for 30 min at 38.5°C with 5% CO₂. Paraformaldehyde fixed cells were incubated with anti-BrdU antibody at 38.5°C for 30 min, then immunostained with anti-mouse Ig-fluorescein for 30 min and DAPI (1:5,000/PBS) for 5 min. All samples were analyzed using an Axioskop 2 Plus incident-light fluorescence microscope (Zeiss) equipped with a CCD camera (Axiovision Cam, Zeiss) with a resolution of 1,300 × 1,030 pixels, configured for fluorescence microscopy, and interfaced to a computer workstation, provided with an interactive and automatic image analyzer (Axiovision, Zeiss). Digital images were acquired at 400x magnification using standard filter setup for fluorescein isothiocyanate (FITC) or DAPI. At least, five different plates were examined for each sample.

The proliferative activity of oAFMSCs, recovered from three different amniotic fluid samples, was analyzed at passages 1, 6, and 12 by calculating the population doubling time (i.e., the time during which the cell population doubled). The doubling time was calculated with the following formula:

T D = t ( 1 g 2 / lg N t − lg N 0 )

where T_D represents the cell doubling time, t represents the duration of cell culture, amd N₀ and N_t represent the cell number after inoculation and the cell number after culturing for t hours, respectively.

Flow Cytometry

oAFMSCs derived from three different fetuses at different phases of expansion (passages 1 and 12) were evaluated by flow cytometry for the surface molecules and for intracellular stem cell markers.

For surface protein, 5 × 10⁵ cells were pelleted and resuspended in 100 μl washing buffer [phosphate-buffered saline (PBS), 0.1% sodium azide, and 0.5% bovine serum albumin (BSA)] containing a saturating concentration of surface antibody and incubated in the dark for 30 min at 4°C with the following primary antibodies: anti-CD14 and anti-CD58 (LifeSpan Bioscences), anti-CD29 (VMRD), anti-CD31 and anti-CD45 (AbD Serotec), anti-CD49f (Beckman Coulter), anti-CD117 and anti-sex-determining region Y box 2 (SOX2; Abcam), anti-CD166 (Ancell), anti-OCT4 (Becton Dickinson), anti-TERT (telomerase reverse transcriptase; Calbiochem), and anti-NANOG (Chemicon International).

For intracellular antigens, before incubation with primary antibody, cells were incubated in fluorescence-activated cell sorting (FACS) lysing solution (BD) at room temperature (RT) in the dark for 10 min and then in Perm 2 (BD) at RT in the dark for 10 min. Primary antibodies were labeled using the appropriate FITC Zenon Antibody Labeling Kit (Gibco), following the manufacturer's instructions. Cells were analyzed on a FACSCalibur flow cytometer (BD) using CellQuest^™ software (BD). Flow cytometer settings were established using unstained cells. Cells were gated by forward scatter to eliminate debris. To eliminate the possible auto-fluorescence of cells, the contribution of unstained cells in the measurement channel was removed. Twenty thousand events were counted for each analysis. All antibodies were titrated under assay conditions, and optimal photomultiplier (PMT) gains were established for each channel. Data were analyzed using FlowJo^™ software (TreeStar). Mean fluorescence intensity (MFI) ratio was calculated dividing the MFI of positive events by the MFI of negative events.

Immunocytochemistry

For immunocytochemistry, oAFMSCs were cultured on glass cover slips, fixed in 4% paraformaldehyde for 10 min at room temperature (RT), and then washed with 0.05% Tween 20 in PBS. Nonspecific binding was blocked with 1% BSA in PBS for 1 h at RT. Cells were incubated overnight at 4°C with the following primary antibodies: anti-SOX2 (1:200; Abcam), anti-TERT (1:250; Calbiochem), and anti-NANOG (1:1000; Millipore). After three washes, the secondary antibody was added [cyanine 3 (Cy3) or Alexa Fluor 488-conjugated anti-rabbit antibody 1:500] and incubated for 1 h at RT. Nuclei were counterstained with DAPI (1:5,000; Vectastain) for 10 min. Images were captured using the Axiovision Cam Zeiss.

RNA Isolation and Reverse Transcription-Polymerase Chain Reaction (RT-PCR)

Total RNA was extracted from oAFMSCs using TRI reagent following manufacturer's instructions. The RNA was treated with DNaseI digestion for 15 min at RT. One microgram of total RNA was used for reverse transcription reaction with Oligo dT primer and BioScript^™ (Bioline). 2X Ready Mix^™ Taq PCR reaction mix was used for PCR reaction using 3 μl of cDNA and 0.5 μM of each primer, in a final volume of 25 μl. The PCR primers and parameters are shown in Table 1. The reaction mixtures were incubated for 5 min at 95°C, followed by 95°C for 30 s, 55°C for 30 s, 72°C for 45 s, and 72°C for 7 min. The PCR products were separated on 2% agarose gel stained with ethidium bromide, visualized on a Gel Doc 2000 (Biorad), and analyzed with Quantity One 1-D Analysis software (Biorad). RT-PCR was normalized by the transcriptional levels of the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene. Each PCR reaction was carried out in triplicate.

OPEN IN VIEWER

Table 1.

PCR Primers Used for RT-PCR Analysis

Gene	GeneBank No.	Primer Sequences (5′–3′)	Amplicon Size (bp)	PCR Cycles
OCT4A	NM_174580.1 bovine	For: TATGACTTGTGTGGAGGGATG	327	45
		Rev: AAAGAGAACCCCCAGGGTGA
SOX2	X96997.1 ovine	For: ACCAGAAGAACAGCCCGGAC	264	45
		Rev: TCATGAGCGTCTTGGTTTTCCG
NANOG	FJ970651.1 ovine	For: TGGATCTGCTTATTCAGGACAG	209	40
		Rev: TGCTGGAGACTGAGGTATTTC
TERT	EU139125.1 ovine	For: TTGTCCCCGCAGGTGTCTTG	176	45
		Rev: TGACCGTGTTGGGCAGGTAG
GAPDH	AF030943.1 ovine	For: CCTGCACCACCAACTGCTTG	224	40
		Rev: TTGAGCTCAGGGATGACCTTG
COL1A1	AF129287.1 ovine	For: CGTGATCTGCGACGAACTTAA	212	40
		Rev: GTCCAGGAAGTCCAGGTTGT
OCN	DQ418490.1 ovine	For: AGACACCATGAGAACCCCCAT	234	40
		Rev: TTGAGCTCACACACCTCCCT
GFP		For: CGGTGGGAGGTCTATATAAGC	356	45
		Rev: TAGCGTGAGAAGCACTGCAC

Karyotype Analysis

Cytogenetic evaluation was performed in non-nucleofected oAFMSCs at passages 1, 6, and 12 and in nucleofected cells at passage 6. Confluent cells were harvested from flasks, transferred in amino dish, and then incubated at 37°C for 24–48 h in Chang medium (Irvine Scientific). Metaphase cells were arrested with 0.1 μg/ml colchicine for 2 h at 37°C. Then oAFMSCs were detached from dishes, resuspended in a hypotonic solution (0.075 M KCl), and incubated for 20 min at 37°C. Cells were centrifuged at 1,000 rpm for 10 min and fixed in methanol/ glacial acetic acid (3:1) for 10 min. Chromosome spreads were obtained by dropping the cell suspension onto ice-cold glass slides and air dried. Metaphase chromosomes were subjected to GTG banding (Giemsa staining). A median of 30–40 metaphases were examined for each sample at approximately the 350–450 band level using a Nikon Eclipse 80i microscope and analyzed by Genikon software (Nikon). A normal ovine karyotype consists in 27 pairs (2n = 54) of chromosomes. A chromosomal aberration was defined as clonal when at least two metaphases showed the same abnormality.

In Vitro Osteogenic Differentiation

To analyze the osteogenic differentiation property of oAFMSCs, cells at passages 1, 6, and 12 were cultured for 7, 14, or 21 days in growth medium (GM) or in differentiation medium (DM) represented by GM supplemented with 50 μM ascorbic acid, 10 mM β-glycerophosphate, 0.2 μM dexamethasone, and 10% FCS. Osteogenesis was assessed by evaluating Alizarin red staining, alkaline phosphatase (ALP) activity, calcein uptake, and the expression of two bone-related genes (osteocalcin and collagen type I) (Table 1). In brief, fixed oAFMSCs (cold 4% paraformaldehyde) were incubated in 40 mM Alizarin Red S for 30 min at RT before stopping the reaction with 80% acetone. ALP activity was processed and analyzed according to the manufacturer's instructions (BCP/NBT liquid substrate system). In brief, cells were fixed in 4% paraformaldehyde and incubated with phosphatase substrate reagent (2 mg/ml). The reaction was evaluated under an optical microscope. Calcein uptake was analyzed after a preincubation of oAFMSCs with calcein (1 μg/ml) for 48 h. The calcein incorporation in the matrix was qualitative and evaluated under a fluorescent microscopy.

oAFMSC Nucleofection

Nucleofection of oAFMSCs was performed according to the optimized protocols for human MSCs provided by the manufacturer (Amaxa Biosciences). Briefly, about 6 × 1 0 ⁵ cells were resuspended in 100 μl of human MSC nucleofector solution and nucleofected with or without 2.5 μg of pAcGFP-N1 vector (Clontech). In some experiments, the linearized form of the same plasmid, obtained after an overnight (ON) digestion at 37°C with DrdI restriction enzyme (Biolabs), was used. The U23 (high transfection efficiency) and C17 (high cell survival) programs were tested on the Nucleofector II device. Immediately after, cells were plated onto 90-mm dishes, with growth medium. Twenty-four hours after nucleofection, the medium was changed to remove dead cells, and cells were analyzed for cell recovery and transfection efficiency. For the establishment of oAFMSCs that stably express GFP, neomycin treatment (400 μg/ml) was applied 48 h after nucleofection. The selection was carried out for further 2 weeks. Cell recovery, expressed as the percentage of number of viable transfected cells over the number of viable nontransfected cells (control), was determined by trypan blue exclusion method. Transfection efficiency was based on the percentage of cells expressing GFP assessed by flow cytometry. oAFMSCs were stained with propidium iodide (PI), resuspended in 500 μl of PBS, and then analyzed with the flow cytometer Coulter Epics XL (Beckman Coulter). The fluorescence of GFP was measured in channel FL1, while the fluorescence of PI was in channel FL2, both on a logarithmic scale. At least 10,000 events were acquired for each sample.

For clonal selection, after 4 weeks of culture under 400 μg/ml of neomycin selection, oAFMSCs were harvested by trypsinization. Two hundred microliters of cell suspension containing a total of 4 × 10³ cells were used for serial dilutions in 96-well plates. At confluence, the wells with the highest percentage of fluorescent cells were chosen by fluorescence microscopy. Selected clones were plated in 12-well plates and, successively, into 90-mm dishes. Finally, GFP expression of each single clone was analyzed by flow cytometry, as described above.

Experimental Tendon Lesion, Transplantation, and Evaluation

In vivo experiments were carried out on a total of six 50-kg adult sheep of Appeninica breed according to the guidelines and approval by the Health Italian Ministery and by the Ethical Committee CEISA of the University of Chieti and Teramo. All surgical procedures were performed under general anesthesia. First, a bilateral core lesion was created in Achilles tendons under ultrasound (US) guidance by injecting 400 UI of Clostridium histolyticum type 1A collagenase (Sigma) diluted in 0.5 ml saline (17, 18). In detail, the enzyme was injected in the middle portion of the tendon (5 cm proximal to the calcaneal tuberosity). Twenty days later, the enzymatically induced tendon defects were identified with the aid of US: one limb was injected with a suspension of 2 × 10⁶ oAFMSCs in 0.5 ml of saline solution while the contralateral with saline alone (control tendon, CTR). The experiments were performed in three animals for each group (cell-treated and control). After surgical procedures, the animals were maintained under daily observation for signs of discomfort. Thirty days later, the animals were euthanatized. The explanted tendons were randomly divided and used for the biomechanical tests or for the morphological/biochemical analysis.

For the biomechanical tests, three samples for each tendon group were considered. The tendons were harvested at the calcaneus and musculotendinous junction and firmly ripped by serrated grips 2 cm away from the edge of repair site and the remaining free length of all specimens. The maximum specific rupture force (N/mm²) and the maximum stiffness (expressed as % of preloaded sample) were evaluated using a digital dynamometer (Tinius Olsen H10KT dynamometer). Before measurements, specimens were preloaded for 1 min with 10 N to provide initial tension (11). The displacement rate was 6 mm/min. Specimens were kept moist throughout the test period with isotonic NaCl solution prewarmed at 38°C. The morphological analysis was performed on the isolated explanted tendons transversally cut at least 5 mm far from the injured area. The specimens were placed in liquid nitrogen. Cryosections, 7 μm in thickness, were processed for hematoxylin–eosin (H&E) and Herovici (HE; a polychrome stain for differentiating precollagen from collagen) in order to describe the recovery of tissue architecture. In parallel, immunohistochemistry studies were performed to analyze the process of extracellular matrix remodeling. To this aim, primary anti-collagen 1 (COL 1; 1:200 PBS/1% BSA; Chemicon Int.) and 3 (COL 3; 1:500 PBS/1% BSA; Chemicon Int.) antibodies were used. Both antigens were revealed with secondary anti-mouse Alexa Fluor 488 (diluted 1:400 PBS/1% BSA; Molecular Probes) antibodies, while section cell nuclei were counterstained with DAPI. Moreover, sections with retrieved GFP-labeled oAFMSCs were immunostained for COL 1, as described above, and the antigen was revealed with an anti-mouse Cy3-conjugated (diluted 1:400 PBS/1% BSA; Millipore) secondary antibody. Morphological sample examinations were performed with an Axioscop 2plus epifluorescence microscope (Zeiss) equipped with a cooled color charge coupled device camera (CCD; Axiovision Cam, Zeiss) interfaced with an interactive and automatic image analyzer (Axiovision, Zeiss) at 200x of magnification. Frozen sections were also used for mRNA extraction to detect the presence of the transgene mRNA in the host tissue by reverse transcriptase (RT)-PCR analysis using GFP-specific primers (Table 1).

Statistical Analysis

The normality of data was tested with Shapiro–Wilks test before proceeding with ANOVA test, followed when necessary by the post hoc Tukey's test (for parametrical data) or by Kruskal–Wallis test followed by Dunn's post hoc test (for nonparametrical data) (Microcal Origin 6.0 and GraphPad Prisms). The data were expressed as mean ± standard deviation (SD). A value of p < 0.05 was considered significant, and a value of p < 0.01 was considered highly significant.

Characterization of oAFMSCs

The isolation and expansion of oAFMSCs was feasible using the plastic adherence ability of mesenchymal stem cells and selected culture medium. Cell adhesion occurred in 5–6 days after the harvesting. Two distinct cell types, differing in morphology and size, were initially evident: smaller cells showed a fibroblastic-like shape, while larger polyhedral cells displayed a typical epithelioid appearance (Fig. 1A). During the in vitro expansion, the fibroblast-like cells prevailed, thus resulting in a more homogeneous cell population (Fig. 1B). The proliferation rate of oAFMSCs gradually decreased during the first six passages dropping from ~75% (passage 1) to ~45% (passage 6) to then stabilizing on levels of ~40–50% at passage 12 (Fig. 1C). The population doubling time resulted to be comprised between 12 and 18 h, without increasing with passage number. Moreover, the doubling time was not affected by the plating efficiency that did not change with passage number. Finally, no structural aberration and a normal euploid ovine chromosomal complement of 54 (either XX or XY) were found in the majority of investigated cells at passages 1, 6, and 12 after Giemsa staining (Fig. 1D). Only in one male fetus, oAFMSCs at passage 12 showed the presence of four trysomic cell clones (55, XY, +22) out of the 40 cells analyzed (data not shown).

OPEN IN VIEWER

Figure 1.

Characterization of ovine amniotic fluid-derived mesenchymal stem cells (oAFMSCs). (A, B) Phase-contrast microscopy (40x) image of oAFMSCs at passages 1 and 12, showing an heterogenous phenotype at passage 1 with larger epithelioid-like cells (indicated by arrows) (A) and a more homogeneous cell population after 12 passages (B). Scale bar: 25 μm. (C) Mitotic activity of oAFMSCs at passages 1, 6, and 12 calculated by bromodeoxyuridine (BrdU) labeling. During subculture passages, the proliferation rate of oAFMSCs gradually decreased from ~75% (passage 1) to ~45% (passage 6) and reaching levels of ~40–50% at passage 12. *p < 0.01 versus. P1. (D) Karyotype of oAFMSCs at passage 6, showing an euploid number of ovine chromosomes (54, XY).

The CD29 and CD58 surface antigens showed a high MFI ratio while CD166 a moderate expression at the beginning of culturing (passage 1) (Table 2). Then the MFI ratio of CD29 and CD58 decreased whereas the MFI ratio of CD166 remained stable. Conversely, oAFMSCs lacked expression of CD49f and of all the analyzed hematopoietic/endothelial markers (CD14, CD45, CD31, CD117) (Table 2).

OPEN IN VIEWER

Table 2.

Flow Cytometry Analysis on oAFMSCs

	Passage 1	Passage 12
Antigens	MFI Ratio ± SD	MFI Ratio ± SD	p
CD14	1.07 ± 0.09	1.03 ± 0.06	0.371
CD29	10.73 ± 1.93	7.93 ± 1.46	0.134
CD31	1.03 ± 0.06	1.07 ± 0.06	0.211
CD45	1.17 ± 0.15	1.10 ± 0.10	0.091
CD49f	1.23 ± 0.25	1.20 ± 0.20	0.211
CD58	15.53 ± 0.45	9.30 ± 0.10	0.001
CD117	1.10 ± 0.10	1.07 ± 0.12	0.371
CD166	3.57 ± 0.40	3.27 ± 0.15	0.143
TERT	61.27 ± 5.25	67.07 ± 6.10	0.235
NANOG	41.10 ± 13.29	56.20 ± 20.26	0.034
OCT3/4	5.53 ± 0.80	3.37 ± 0.64	0.058
SOX2	22.83 ± 2.50	23.33 ± 2.52	0.439

MFI ratio, the average of three different biological samples; ± standard deviation. Value of p is calculated versus passage 1 MFI ratio values. oAFMSCs, Ovine amniotic fluid-derived mesenchymal stem cells; MFI, mean fluorescent intensity.

The four markers NANOG, SOX2, OCT4, and TERT that are typical of pluripotent stem cells were evaluated at both mRNA and protein levels (Fig. 2). RT-PCR analysis showed a stable mRNA content for all four genes up to passage 12. In detail, high mRNA levels were evidenced for the TERT and NANOG genes, a moderate expression for SOX2, and a very low expression for OCT4 (Fig. 2D). Flow cytometry and immunocytochemical analyses provided more detailed information concerning both the content and cellular localization of the proteins encoded by these pluripotency-associated genes. Flow cytometry showed that freshly isolated oAFMSCs had a high MFI ratio for TERT and NANOG, a lower value for SOX2, and a very low MFI ratio for OCT4. After 12 passages, TERT, NANOG, and SOX2 increased their MFI ratio values, while the one of OCT4 further decreased (Table 2). Immunocytochemical analysis demonstrated a progressive translocation from the nucleus toward the cytoplasm of two of these proteins during the progression of in vitro expansion (Fig. 2A–C). In fact, while at the beginning of culture almost all the oAFMSCs displayed the proteins within the nucleus, after 12 passages TERT and SOX2 proteins moved toward the cytoplasm in a percentage that never overcame 30% (enlarged boxes in Fig. 2A, B).

OPEN IN VIEWER

Figure 2.

Expression of pluripotency-associated markers in oAFMSCs at the mRNA and protein level. (A–C) The immunocytochemical detection of sex-determining region Y box 2 (SOX2), telomerase reverse transcriptase (TERT), and NANOG proteins in oAFMSCs at passages 1 (P1) and 12 (P12) shows a progressive translocation from the nucleus toward the cytoplasm of SOX2 and TERT proteins during in vitro expansion (original magnification: 20x). Scale bar: 50 μm. In the enlarged boxes, the white arrows indicate the exclusive cytoplasmic localization of these proteins at passage 12 (original magnification: 100x). Scale bar: 10 μm. (D) The semiquantitative RT-PCR analysis of SOX2, NANOG, TERT, and octamer binding transcription factor 4 (OCT4) genes in cells at passages 1 (P1) and 12 (P12) showed a persistent and almost unchanged mRNA expression of all four genes up to passage 12. High mRNA levels were evidenced for TERT and NANOG, a moderate expression for SOX2, and a lower expression for OCT4. The expression levels of the pluripotency genes were normalized on that of the housekeeping glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene.

In Vitro Osteogenic Differentiation of oAFMSCs

To assess the in vitro mesenchymal differentiation potential of oAFMSCs, cells at passages 1 and 12 were incubated in osteogenic induction medium (DM) for 7, 14, and 21 days. A mineralized matrix started to be evident after 7 days as indicated by Alizarin Red and calcein uptake (Fig. 3A, C). The early in vitro osteogenic differentiation was also confirmed by ALP activity (Fig. 3B). Calcium deposition (Alizarin Red-positive nodular aggregates and calcein fluorescence) and ALP activity progressively increased as culture progressed (Fig. 3A–C). Neither or very low calcium mineralization or ALP activity was observed in control cells (CTR) cultured in growth medium (GM). The degree of matrix mineralization was also analyzed by evaluating the fluorescence of calcein (Fig. 3C). In osteoinduced cells, the amount of calcein uptake was higher than basal levels already after 2 weeks of culture in osteogenic medium and increased with progressive expansion. As expected, it was irrelevant in control cells that did not display any matrix formation. In all above-described analyses, there was no evidence of different behavior between cells induced to differentiate at passage 1 or passage 12 (data not shown).

OPEN IN VIEWER

Figure 3.

Osteogenic differentiation of oAFMSCs at the protein and mRNA levels. (A–C) Osteogenic differentiation as determined by Alizarin Red S staining, alkaline phosphatase (ALP) activity, and calcein deposition at 20x magnification. Scale bar: 50 μm. A mineralized matrix (A, C) was evident after 7 days of culture in differentiation medium. The early osteogenic differentiation was also confirmed by ALP activity (B). Calcium deposition and ALP activity progressively increased as culture progressed up to 21 days. No calcium mineralization or ALP activity was observed in control cells (CTR) cultured in growth medium. (D–E) Expression profile of collagen type I (COL1A) (D) and osteocalcein (OCN) (E) genes. (D) The expression of COL1A mRNA in cells grown in normal growth medium (GM) after 7, 14, and 21 days were comparable with one of the cells analyzed at the beginning of differentiation (T0). The COL1A mRNA expression significantly increased in cells incubated for 7, 14, and 21 days in differentiation medium (DM) compared to the levels detected in cells expanded in normal GM and after 21 days reached the levels detected in adult bone tissue. *p < 0.01 versus, CTR. (E) The expression of OCN mRNA remained very low in cells grown in normal GM after 7, 14, and 21 days and similar to one of the cells analyzed at the beginning of culture (T0). The OCN mRNA expression significantly increased in cells incubated for 14 and 21 days in DM and after 21 days almost reached the levels detected in adult bone tissue. *p < 0.01 versus CTR.

The process of osteogenic differentiation was finally assessed at the mRNA level by evaluating the transcripts expression of two genes related to early and late phases of osteogenesis, such as collagen type I (COL1A1) (Fig. 3D) and osteocalcin (OCN) (Fig. 3E). The expression of both COL1A and OCN mRNA significantly increased in oAFMSCs incubated for at least 14 days in DM compared to the levels detected in cells expanded in normal GM, regardless of the passage number considered (data not shown).

Nucleofection of oAFMSCs and Generation of Stable Clones

Two different nucleofector programs, specifically designed for high transfection efficiency (U23 program) and high cell survival (C17 program) of human MSCs, were tested on oAFMSCs immediately after isolation (passage 0 or 1) to introduce the circular form of the selectable plasmid pAcGFP1-N1. Twenty-four hours upon gene transfer, oAFMSCs were examined for morphology, cell recovery, and transfection efficiency. No relevant morphological changes occurred in GFP-expressing oAFMSCs (Fig. 4A). GFP fluorescence signal was localized in both cytoplasmic and nuclear compartments with evident differences in intensity signals among cells, but regardless of the considered pulsing program. Trypan blue exclusion count indicated that nucleofection per se (carried out in absence of plasmid DNA) reduced cell recovery that dropped to 24.2 ± 1.1% and 49.7 ± 3.3% using the U23 and C17 programs, respectively. The percentage of viable cells further decreased in the presence of the plasmid, reaching 14.2 ± 6.1% (U23 program) and 22.3 ± 1.7% (C17 program). Flow cytometry analysis demonstrated that 62.7 ± 9.1% and 37.3 ± 2.5% of surviving cells exhibited GFP expression 24 h after nucleofection when programs U23 and C17 were used, respectively (Fig. 4B, C).

OPEN IN VIEWER

Figure 4.

Characterization of nucleofected oAFMSCs as a pool (A–C, G) and as stable single clones (D–F, H). Morphology and green fluorescent protein (GFP) expression evaluated by fluorescent microscopy in nucleofected pooled cells (A) and in stable single clone D9 (D) at 20x magnification. The percentage of GFP-expressing cells, using the U23 program, as analyzed by flow cytometry in pooled cells was of 62.7% (B) and 96.6% (E) in single clone D9. The percentage of GFP-expressing cells, using the C17 program, as analyzed by flow cytometry in pooled cells was of 37.3% (C) and 92.6% (F) in single clone C8. Scale bar: 50 μm. Karyotype of nucleofected oAFMSCs as a pool (G) and single clone D9 (H) that revealed chromosomal stability after nucleofection and long-term culture. Results are representative of one independent experiment of both type of cells at passage 6.

In spite of the low cell recovery obtained with the U23 program, survived cells showed unaltered high proliferative potential (data not shown). The effect of plasmid vector shape on transfection efficiency was also evaluated by using the U23 program. GFP expression was ~2-fold lower when nucleofection was carried out with the linearized form of plasmid pAcGFP1-N1 (32% vs. 63%, linear vs. undigested circular plasmid, p < 0.01). Therefore, for the subsequent allotransplantation studies, the U23 program and the circular form of the plasmid vector were chosen.

In order to obtain a long-lasting expression of the GFP reporter gene, stable transfected clones were generated by limiting dilution method, under the selective pressure of antibiotic Geneticin. A few GFP-expressing oAFMSC clones were obtained for each nucleofection program used after two further weeks of antibiotic selection. Three and four stable clones, showing a diffuse and bright green fluorescence (Fig. 4D), were obtained for U23 and C17 programs, respectively, and clonally expanded in culture for more than 1 month. No stable transfected clones could be isolated from oAFMSCs nucleofected with the linearized DrdI-digested plasmid. Flow cytometry analysis revealed a maximum percentage of 96.6% and 92.6% GFP-expressing cells in the D9 (U23 program) and C8 (C17 program) clones (Fig. 4E, F) that were chosen for subsequent characterization. The percentages of GFP-expressing cells of the remaining five clones were 80.3%, 83.27%, and 93.1% for the C17 program and 80.8% and 95.5% for the U23 program (p > 0.05).

Assessment of Genomic Stability and Stem Cell Features of Nucleofected oAFMSCs

To evaluate whether nucleofection and long-term expansion of nucleofected cells could have affected oAFMSC phenotype and/or plasticity, GFP-expressing cells were analyzed for karyotype, pluripotency molecular markers, and in vitro differentiation potential. The structure and the modal number of chromosomes of nucleofected oAFMSCs were determined by karyotype analysis at passage 6 and after ~30 days of antibiotic selection. Pooled transfected oAFMSCs as well as each individual stable clone showed a modal chromosomal number of 54 (Fig. 4G, H), thus indicating the absence of gross chromosomal instability. The in vitro expansion of nucleofected oAFMSCs did not affect pluripotency marker expression, as shown by the protein and mRNA levels of SOX2, NANOG, and TERT (Fig. 5). Osteogenic differentiation, induced 2 weeks after antibiotic selection, indicated that nucleofection did not impair the differentiation features of oAFMSCs. In fact, the calcium deposition within the extracellular matrix (Alizarin Red S and calcein) (Fig. 6A, C), alkaline phosphatase activity (Fig. 6B), and the mRNA levels of the bone-specific COL1A and OCN genes (Fig. 6D, E) progressively increased when the cells were maintained under osteoinductive cultural conditions, similar to parental nontransfected oAFMSCs.

OPEN IN VIEWER

Figure 5.

Expression of pluripotency-associated markers in nucleofected oAFMSCs as a pool. (A–L) Immunocytochemical detection of TERT, NANOG, and SOX2 proteins in nucleofected oAFMSCs at 20x magnification, showing no substantial differences with protein expression detected in parental nontransfected cells (already described in Fig. 3). Scale bar: 50 μm. (M) Semiquantitative RT-PCR analysis of SOX2, NANOG, TERT, and OCT4 genes in nucleofected oAFMSCs compared to oAFMSCs. The comparable expression at mRNA levels of SOX2, NANOG, and TERT genes between parental and nucleofected oAFMSCs shows that nucleofection and subsequent in vitro expansion did not affect pluripotency marker genes expression. The expression levels of the analyzed genes were normalized on that of the housekeeping GAPDH gene.

OPEN IN VIEWER

Figure 6.

Osteogenic differentiation of nucleofected oAFMSCs at the protein and mRNA levels. (A–C) Osteogenic differentiation as determined by Alizarin Red S staining, alkaline phospatase (ALP) activity, and calcein deposition at 20x magnification. The calcium deposition (A, C) and ALP activity (B) increased with time when the nucleofected cells were cultured in osteoinductive medium. Scale bar: 50 μm. (D, E) Expression profile of collagen type I (COL1A) (D) and osteocalcein (OCN) (E) genes. The mRNA levels of the bone-specific COL1A and OCN genes progressively increased when the nucleofected cells were maintained under osteoinductive medium (DM) for 7, 14, and 21 days, compared to cells grown in standard medium (GM), and showed similar expression levels to the ones of parental nontransfected oAFMSCs. *p < 0.01 versus CTR.

Allotransplantation of GFP-Labeled oAFMSCs and Assessment of Functional Tendon Restoration

The allotransplantation of GFP-labeled cells was performed according previous studies that demonstrated the positive influence of transplanted and PHK26-labeled oAFMSCs on tendon healing (6, 51). To evaluate the behavior of GFP-labeled cells within the host tissue, the tendon core lesion were transplanted with 2 × 1 0 ⁶ nucleofected cells (n = 3) or with saline solution (CTR) (n = 3). The morphological and functional tissue recovery was evaluated after 30 days. All animals well tolerated the surgical procedures. Analgesic pharmacological treatments were used during the first week after collagenase injection when an algic syntomatology was observed in all animals. By contrast, no inflammatory reaction was revealed immediately after cell allotransplantation or saline injection. All tendon explants treated with oAFMSCs did not show any inflammatory reaction while different degree of swelling characterized all CTR tendons. The morphological analysis performed with H&E and HE staining showed a more advanced level of tissue and matrix organization in oAFMSCs allotransplanted tendons (Fig. 7A–D). In detail, the repairing zone of CTR tendon showed several polyhedral cells that resulted dispersed amongst an abundant extracellular matrix where short new fibers were deposited with an irregular orientation (Fig. 7B, D). Conversely, in all tendons transplanted with oAFMSCs, the regenerated site displayed a microarchitecture that was similar to that observed in the healthy tissue with a more organized extracellular matrix, characterized by parallel fibers oriented along the longitudinal axis of tendon filled with fusiform aligned cells (Fig. 7A, C). The biochemical composition of extracellular matrix confirmed the stimulatory role played by GFP-labeled oAFMSCs. In fact, COL 3, the immature form of collagen, is normally secreted during the early phase of tendon healing and persisted irregularly distributed only in the repairing zone of CTR tissues (Fig. 7F). By contrast, in the oAFMSCs allotransplanted tendons, COL 3 was absent and the extracellular matrix resulted composed by aligned fibers of COL 1 (Fig. 7E, G). In detail, COL 1 was organized in fibers that, after 30 days, showed a typical orientation along the longitudinal axis of the tendon and with similar density of the healthy tissue. By contrast, in CTR tendons, this protein was weakly expressed, and it displayed a scattered random distribution throughout the repairing site (Fig. 7H).

OPEN IN VIEWER

Figure 7.

Evaluation of allotransplantation of GFP-labeled oAFMSCs. Hematoxylin and eosin (H&E) and Herovici (HE) staining and immunohistochemistry (HI) for collagen proteins of injured Achille's tendon treated with GFP-labeled oAFMSCs or without cells (CTR). All images were photographed at 10x magnification, showing the healthy portion of the tendon under the white dotted line and the repair site within the upper portion. Scale bar: 100 μm. (A–D) H&E revealed an advanced status of regeneration in oAFMSC allotransplanted tendons with aligned fusiform shaped tenocyte-like cells with flattened nuclei entrapped within a regular extracellular matrix (A), composed as shown by HE staining of aligned collagen fibers, along the longitudinal axis of the tendon with a similar staining density to that recorded in the healthy tissue (C). By contrast, CTR tissue showed a disorganized structure with several polyhedral cells (B) dispersed in a scarce and irregularly distributed matrix within the repairing site (D). (E–H) The HI for the immature (COL 3) and mature (COL 1) matrix collagen proteins (green fluorescence) showed that in oAFMSC-allotransplanted tendons, COL 3 was barely detectable in the extracellular matrix, being replaced by COL 1 after 30 days (E, G). In fact, in the healing site COL 1 immunopositive fibers were abundant and parallel to the longitudinal axis of the tendon with a similar staining density of the healthy tissue (G). In CTR tendon, COL 3 immunoreaction revealed an irregular staining in the repairing site, and COL 3 fibers were not replaced by COL 1 fibers, since COL 1 was only weakly expressed (F, H). Nuclei were counterstained with DAPI. (I) Immunofluorescent microscopy (40x) image of GFP-labeled oAFMSCs that were recovered after 30 days from allotransplantation as green fluorescent polyhedral and fusiform cells entrapped within abundant COL 1 fibers (red fluorescence). One arrow indicates a GFP-labeled and fusiform cell that colocalized COL 1 protein (resulting in a yellow fluorescence). Two arrows indicate a polyhedral and immature GFP-labeled cell (green fluorescence). Nuclei were counterstained with DAPI. Scale bar: 25 μm. (J) RT-PCR analysis revealed the presence of GFP mRNA in expanded nucleofected oAFMSCs (lane 3) and in the healing portion of allotransplanted tendon (lane 1), while no expression was recorded in the CTR controlateral tendon (lane 2). M, molecular marker.

The long-lasting expression of the GFP transgene for 30 days at both protein and mRNA levels in the host tissue was also confirmed by immunohistochemistry (Fig. 7I) and by RT-PCR analyses (Fig. 7J). GFP-labeled oAFMSCs were always recovered within the engrafted tendon. The GFP signal indicated the presence of polyhedral and fusiform transplanted oAFMSCs that resulted entrapped among the new deposited extracellular matrix composed of COL 1. Some GFP-expressing cells, in particular those displaying a tenocyte-like fusiform shape, were able to colocalize the COL 1 protein (Fig. 7I, one arrow). No transgene mRNA expression was found in CTR tendons, following RT-PCR analysis (Fig. 7J, lane 2).

In parallel, the biomechanical test confirmed an acceleration of healing induced by the presence of transplanted oAFMSCs. In fact, the maximum failure load and stiffness that in damaged tendons reached values of 18 N/ mm² (16–22 N/mm²) and 21% (15–28%), respectively, as a consequence of the induced defect, increased of 2.5 times (45 N/mm², 41–49 N/mm²) and 1.7 times (35%, 32–40%) in the presence of cells and only of 1.6 times (29 N/mm², 26–31 N/mm²) and 1.2 times (25%, 23–27%) in CTR tendons (p < 0.01). However, in 30 days the process of tendon regeneration resulted incomplete, since healthy tendons showed higher biomechanical performances [maximum failure load: 80 N/mm² (74–88 N/mm²) and stiffness: 45% (39–50%)] (Fig. 8A, B).

OPEN IN VIEWER

Figure 8.

Biomechanical tests. (A, B) Biomechanical properties (A, maximum failure load; B, stiffness) of CTR, damaged, oAFMSC-treated and healthy tendons. The maximum failure load and stiffness in damaged tendons were of 18 N/mm² (16–22 N/mm²) and 21% (15–28%), respectively. In oAFMSC-treated tendons, both values increased 2.5 and 1.7 times, while in CTR tendons, they increased 1.6 and 1.2 times (p < 0.01). Healthy tendons showed higher biomechanical performances after 30 days posttransplantation. Data are expressed as minimum, maximum, and median values. Different superscripts denote statistically different values (p < 0.05).