Mitochondrial-Derived Signaling Mediates Differentiation of Parietal Epithelial Cells into Podocytes

Abstract

Aims:

Parietal epithelial cells (PECs) are potential stem cells within the glomerulus, migrating into site of podocyte loss to differentiate into podocytes. Little is known about the mechanism mediating differentiation of PECs into podocytes.

Results:

In vitro differentiation of PECs into podocytes led to upregulation of podocyte markers such as Wilms’ tumor gene 1 (WT-1), Forkhead box C1 (FOXC1), synaptopodin and podocin, accompanied by increased mitochondrial abundance. Preincubation with a mitochondrial reactive oxygen species (ROS) inhibitor prevented all these events in PECs. In vivo, adriamycin (ADR)-treated mice exhibited albuminuria, decreased WT1 positive cells, and claudin-1 expressed in glomerular capillary tuft, as well as peroxisome proliferator-activated receptor-γ coactivator-1α (PGC1α) overproduction in PECs. Expression of the ROS-related molecule nuclear factor erythroid 2-related factor 2 (Nrf2) and its target protein Brahma-related gene 1 (Brg1) increased during differentiation of PECs into podocytes. Suppressing Nrf2 or Brg1 reduced the differentiation of PECs, whereas overexpression had the opposite effect. Brg1 directly regulated WT-1 transcription in PECs. Activation of Nrf2 with bardoxolone-methyl (CDDO-Me) resulted in less proteinuria and more WT1 positive cells in ADR mice. PECs conditional human Nrf2 knock-in mice showed increased WT1 cell numbers.

Conclusion:

It concluded that mitochondria-derived ROS mediated differentiation of PECs into podocytes via Nrf2 and Brg1 signaling. Antioxid. Redox Signal. 42, 393–407.

Innovation

Glomerular parietal epithelial cells (PECs) are potential progenitor cells. Previous studies found that PECs differentiate into podocytes compensating for lost podocytes. In this study, we found mitochondria generation increasing combined with mitochondrial-derived reactive oxygen species (mtROS); Nrf2 and Brg1 increased during differentiation of PECs into podocytes in vitro. PECs differentiated into podocytes dependent on mtROS-Nrf2-Brg1. Brg1 regulated WT-1 transcription directly in PECs. In vivo, bardoxolone-methyl, an Nrf2 agonist, and PECs conditional overexpression of human Nrf2 increased WT1-positive cells in glomeruli of adriamycin nephropathy mice.

Introduction

Podocytes are one of the most important cells to maintain the barrier for glomerular filtration (Shankland, 2006). However, podocytes are terminally differentiated cells that usually have only a very limited capacity to regenerate, which hinders repair after podocyte injury.

Glomerular parietal epithelial cells (PECs) are potential progenitor cells within the glomerulus (Eng et al., 2015; Ronconi et al., 2009), capable of migrating into the site of podocytes loss to express podocyte-specific marker protein, as well as differentiating into podocytes (Ohse et al., 2010; Zhang et al., 2012a). Several molecules may be involved in PECs differentiation into podocytes. Meyer-Schwesinger et al. found that microRNA-193a (miR-193a) downregulation switches on the podocyte phenotype in PECs (Kietzmann et al., 2015). Growth inhibitor-specific gene 1 (Gas1) deficiency in PECs caused by early diabetes injury promoted the proliferation and differentiation of PECs into podocytes (Luna-Antonio et al., 2017). Activation of Notch signaling promotes PEC proliferation, and downregulation of the Notch signaling was required for the differentiation of PECs to podocytes in vitro (Lasagni et al., 2010). In addition, glucocorticoids (Zhang et al., 2013), angiotensin-converting enzyme inhibitors (Zhang et al., 2015), insulin growth factor 1 (Tan et al., 2016), and all-trans retinoic acid (ATRA) (Suzuki et al., 2003) can also promote the differentiation of PECs to podocytes. However, the roles of PEC organelles and the detailed mechanisms have not been completely investigated.

Imasawa et al. highlighted that during podocyte differentiation in vitro, mitochondrial size, oxygen consumption, mitochondrial DNA number, as well as mitochondria-related protein peroxisome proliferator-activated receptor-γ coactivator-1α (PGC1α), increased, suggesting a role for mitochondria in this process (Imasawa et al., 2017).

In the present study, we evaluated the roles of mitochondria generation and mitochondria-derived signaling molecule production during PEC differentiation into podocytes. Mice with overexpression human nuclear factor erythroid 2-related factor 2 (Nrf2) were developed to detect the podocyte density. We also estimated the effects by activation of Nrf2 signal in adriamycin (ADR)-induced nephropathy mice.

Results

Mitochondria generation increased during PEC differentiation into podocytes

Primary cultured PECs were incubated with differentiating medium (VRADM: ATRA [10 nM], calcitriol [100 nM], and dexamethasone [50 nM]) for 1 week, the podocyte markers WT-1, synaptopodin, podocin and FOXC1 increased and claudin-1 decreased (Fig. 1A, 1B). In addition, the abundance of mitochondria and the expression of mitochondrial DNA (mtDNA) significantly increased in differentiating medium incubated PECs (Fig. 1C, 1D, 1E, 1F, 1G). Figure 1H showed that PGC1α, cytochrome oxidase subunit IV (COX IV), translocase of the outer mitochondrial membrane member 20 (TOMM20), and cytochrome c (CytC) production increased when PECs differentiated into podocytes. Furthermore, small-interfering RNA (siRNA) was used to silence PGC1α in PECs (Supplementary Figure S3A). Following the induction of differentiation in PGC1α-knockdown PECs, the protein expression of podocyte markers WT-1 and synaptopodin was reduced significantly (Fig. 1J, 1K).

FIG. 1.

Inducing PECs differentiated into podocytes is accompanied by increased generation in mitochondria. (A) Western blotting showing expression of claudin-1, WT-1, synaptopodin, podocin, and FOXC1 in VRADM-treated PECs. (B) Quantitative analyses of claudin-1, WT-1, synaptopodin, and FOXC1 (n = 5). (C) Real-time RT-qPCR of mtDNA/nDNA expression in differentiated PECs (n = 5). (D) Transmission electron microscopy of PECs, and the white arrow indicated mitochondria. Scale bars: 40 µm. (E) Quantification of mitochondrial abundance (n = 5); (F) Mito-tracker red was detected. Scale bars: 20 µm. (G) Quantification of mean fluorescence intensity of Mito-tracker red staining (n = 5). (H) Production of PGC1α, COX IV, CytC, and TOMM20 increased in VRADM-incubated PECs. (I) Quantitative analyses of PGC1α, COX IV, CytC, and TOMM20 (n = 5). (J) Effects of PGC1α siRNA on PEC differentiation were determined by Western blotting. (K) Quantitative analyses of WT-1 and synaptopodin (n = 5). Data were presented as mean ± standard deviation (SD). **p < 0.01, ***p < 0.001, ****p < 0.0001 between groups. PECs, parietal epithelial cells; RT-qPCR, reverse transcription–quantitative polymerase chain reaction; PGC1α, peroxisome proliferator-activated receptor-γ coactivator-1α; COX IV, cytochrome oxidase subunit IV; CytC, cytochrome c; TOMM20, translocase of the outer mitochondrial membrane member 20; WT-1, Wilms’ tumor gene 1; FOXC1, Forkhead box C1.

To verify the differentiation of PECs to podocytes in vivo, we established ADR nephropathy mouse model. 2 and 6 weeks post-ADR administration, mice developed middle-molecular-weight proteinuria, foot process effacement, and focal segmental glomerulosclerosis, accompanied by a reduction in podocyte levels (Supplementary Figure S2A-S2D) and an increased urinary albumin-to-creatinine ratio (UACR) at both time points (Fig. 2A). Podocyte markers (WT-1, nephrin, podocin, and synaptopodin) showed a decline starting from 2 weeks after ADR injection (Fig. 2B, 2C). Increased proliferating cell nuclear antigen (PCNA) production in some PECs and a reduction of WT-1 positive cells were observed in mice with ADR nephropathy (Fig. 2D, 2E). Notably, some claudin-1 positive cells were seen migrating into glomerular capillary tuft (Fig. 2D white arrows), and there was an overproduction of PGC1α (Fig. 2D yellow arrows). Immunoelectron transmission microscopy revealed claudin-1-positive gold particles at the tight junctions of PECs and within the cytosol of some podocytes (Fig. 2F black arrows).

FIG. 2.

PECs differentiated into podocytes in adriamycin-induced nephropathy. (A) Urinary albumin to creatinine ratio (ACR) in mice of the control group and adriamycin-treated group (n = 5); (B) Western blotting showing expression of podocyte markers in the renal cortex. (C) Quantitative analyses of WT-1, synaptopodin, and nephrin. (D) Immunohistochemical staining was undertaken to detect WT-1, PCNA-positive cells in glomeruli. Black arrows showed PCNA-positive PECs. Immunofluorescence staining for the detection of claudin-1 (green)/podocalyxin (red) and claudin-1 (green)/PGC1α (red) in mouse kidneys. White and yellow arrows indicated PEC-regenerated podocytes and PGC1α positive PECs. Scale bars: 20 µm; E: Quantification of WT-1 and PCNA positive cells within glomeruli (n = 10). The results were blindly counted by one renal pathologist. (F) Immunoelectron microscopy showing claudin-1 location in the podocytes and PECs of mice with adriamycin-induced nephropathy. Black arrows showed golden nanoparticles. Scale bars: 20 µm, 5 µm. Data were presented as mean ± SD. **p < 0.01, ***p < 0.001, ****p < 0.0001 between groups. PCNA, proliferating cell nuclear antigen.

Mitochondria-derived reactive oxygen species is a key signal for the differentiation of PECs into podocytes

The role of mitochondrial reactive oxygen species (ROS) in the differentiation of PECs into podocytes was investigated by incubating PECs with the VRADM differentiating medium. Relative to the control group, there was a significant increase in both total ROS levels and mitochondrial ROS levels in PECs treated with VRADM. Preincubation with N-acetyl-L-cysteine (NAC, an ROS scavenger) or MitoTempo (a mitochondria-targeted antioxidant) effectively prevented this increase (Fig. 3A, 3B). Following the induction of differentiation of PECs, 3-nitrotyrosine (3-NT) increased and superoxide dismutase (SOD) decreased, suggesting that the differentiation of PECs to podocytes was accompanied by an increase in ROS (Fig. 3C, 3D). The preincubation with MitoTempo and NAC completely inhibited differentiation medium (DM)-induced upregulation of WT1 and synaptopodin (Fig. 3E and 3F). These data implicated mitochondrial ROS as crucial signaling molecules involved in the differentiation of PECs into podocytes.

FIG. 3.

Increased mitochondria-derived ROS generation during the differentiation of PECs to podocytes. (A) Total intracellular ROS and mitochondrial ROS were detected. Scale bars: 40 µm, 20 µm. (B) Quantification of mean fluorescence intensity of ROS and mitoSOX staining (n = 5). (C) SOD2 decreased and 3-NT increased in VRADM-incubated PECs. (D) Quantitative analyses of 3-NT and SOD2 (n = 5). (E) VRADM-treated cells in the presence or absence of NAC and MitoTempo showed differentiation of PECs to podocytes dependent on mitochondrial ROS. (F) Quantitative analyses of claudin-1, WT-1, and synaptopodin (n = 5). Data were presented as mean ± SD. **p < 0.01, ****p < 0.0001 between groups. SOD, superoxide dismutase; ROS, reactive oxygen species; NAC, N-acetyl-L-cysteine.

Nrf2 mediated the differentiation of PECs to podocytes

Next, we investigated the ROS-associated molecule Nrf2: a key transcription factor that regulates the transcription of antioxidant proteins and, together with other molecules, regulates various cellular signaling pathways (Mitsuishi et al., 2012; Murakami et al., 2023; Paul et al., 2014; Tsai et al., 2013). Upon incubation of PECs with the VRADM differentiating medium, a significant increase in Nrf2 levels was observed in both nuclei and cytoplasm (Fig. 4A, 4B, 4C), which can be prevented by NAC or MitoTempo pretreatment (Fig. 4D, 4E). Nrf2 siRNA repressed Nrf2 production (Fig. 4K) and eliminated DM-induced WT1 or synaptopodin overexpression (Fig. 4F, 4G). Neh4 and Neh5 are structural domains of Nrf2 involved in regulating the expression of several downstream target genes. PECs infected with a lentivirus overexpressing Neh4 and Neh5 showed increased Nrf2, WT1, synaptopodin, and FOXC1 production (Fig. 4H, 4I; Supplementary Figure S3C). Continued administrating of dimethyl fumarate (DMF, an Nrf2 activator) enhanced the effects of DM on PECs (Fig. 4J). Increased Nrf2 overproduction was detected in ADR mice glomeruli, specifically localized to PECs at 2 and 6 weeks post-ADR injection (Fig. 4L).

FIG. 4.

Mitochondrial ROS activates Nrf2 to mediate the differentiation of PECs to podocytes. (A) Western blotting of nuclear and cytoplasmic Nrf2 expression. (B) Immunofluorescence detection of claudin-1 (green) and Nrf2 (red) in PECs incubated with or without VRADM medium. Scale bars: 20 µm. (C) Quantification of mean fluorescence intensity of nuclear Nrf2 staining. (D) Western blotting of Nrf2 in the presence or absence of NAC and MitoTempo in PECs incubated with or without VRADM medium. (E) Quantitative analysis of Nrf2 in total proteins (n = 5). (F) Effects of Nrf2 siRNA on PEC differentiation were determined by Western blotting. (G) Quantification of WT-1 and synaptopodin (n = 5). (H) Effects of transfection of plasmids overexpressing Nrf2 subunit, Neh4 and Neh5 on podocyte markers and Brg1 in PECs detected by Western blotting. (I) Quantitative analyses of WT-1 and synaptopodin (n = 5). (J) After treatment with an Nrf2 agonist (DMF), Western blotting showed Nrf2 and WT-1 expression. (K) Silencing Nrf2 with siRNA decreased Brg1 production. (L) Immunofluorescence of podocalyxin and Nrf2 in the kidneys of mice with adriamycin-induced nephropathy, and the arrow showed that PECs expressed Nrf2. Scale bars: 20 µm. Data were presented as mean ± SD. *p < 0.05, **p < 0.01, ****p < 0.0001 between groups. Nrf2, nuclear factor erythroid 2-related factor 2; Brg1, Brahma-related gene 1.

Nrf2 regulates Brg1 binding with WT-1 in the differentiation of PECs to podocytes

There is no direct evidence that Nrf2 directly regulates WT-1 or other podocyte marker gene expressions. However, Brahma-related gene 1 (Brg1) has been shown to mediate Nrf2-regulated heme oxidase-1 (HO-1) gene transcription (Sun et al., 2020). Therefore, we explored whether Brg1 is involved in the Nrf2-mediated transformation of PECs into podocytes. Our results demonstrated that incubation with VRADM led to a 2.82-fold upregulation of Brg1 mRNA (Fig. 5A). In addition, Brg1 and WT-1 proteins were overexpressed in differentiated PECs (Fig. 5B). Using siRNA to suppress Brg1 in PECs (Supplementary Figure S3B), we observed that the overexpression of WT-1 and FOXC1 in VRADM-incubated PECs was reduced by Brg1 knockdown (Fig. 5C, 5D). Next, we infected PECs with a Brg1-overexpressing adenovirus (Supplementary Figure S3D). A significant increase in WT-1, synaptopodin, as well as FOXC1, has been found in the infected PECs (Fig. 5E, 5F). To determine if Brg1 directly binds to the WT-1 promoter in PECs, we examined the binding of Brg1 to seven evolutionary conserved regions (ECRs) in PECs using chromatin immunoprecipitation (ChIP) analysis (Supplementary Figure S3E). We confirmed that Brg1 bound to two ECRs (+4.0 kb and +5.8 kb) within the intron of WT-1. Enrichment of Brg1 was more than 20-fold at the +4.0 kb ECR and more than 15-fold at the +5.8 kb ECR compared with the control (IgG) (Fig. 5G).

FIG. 5.

Nrf2 regulates the differentiation of PECs to podocytes by mediating Brg1. (A) Detection of Brg1 mRNA expression in differentiated PECs by real-time RT-qPCR (n = 5). (B) Western blotting showing Brg1 expression in PECs with or without VRADM medium. (C) Effect of Brg1 siRNA on PEC differentiation was determined by Western blotting. (D) Quantitative analyses of WT-1 and FOXC1 (n = 5). (E) Effects of transfection of plasmids overexpressing Brg1 on podocyte markers in PECs detected by Western blotting. (F) Quantification of WT-1 and FOXC1 (n = 5). (G) ChIP-detected interactions between Brg1 and WT-1. Quantification of Brg1 binding at +4.0 kb and +5.8 kb of WT-1 by real-time RT-qPCR (n = 3). (H) Western blotting of Brg1 expression in the presence or absence of NAC and MitoTempo in PECs with or without VRADM. (I) Quantitative analysis of Brg1. (J) Co-IP showed interactions between Nrf2 and Brg1. (K) Immunohistochemical and immunofluorescence staining were done to detect Brg1 and Nrf2 production in PECs of ADR mice. Black arrows and yellow arrows showed Brg1 positive and Nrf2 positive PECs, respectively. White arrows indicated both Nrf2 and Brg1 positive PECs. Scale bars: 20 µm. (L) The number of Brg1-positive PECs was blindly counted by a renal pathologist. A bar graph of data expressed as the proportion of Brg1 positive PECs (n = 8). Data were presented as mean ± SD. **p < 0.01, ***p < 0.001, ****p < 0.0001 between groups. ChIP, chromatin immunoprecipitation; Co-IP, coimmunoprecipitation.

Furthermore, we investigated the relationship among ROS, Nrf2, and Brg1. After ROS depletion, the overproduction of Brg1 was prevented by MitoTempo or NAC pretreatment (Fig. 5H, 5I). Suppressing Nrf2 with siRNA or increasing Nrf2 with Neh4-Neh5 lentivirus reduced or promoted Brg1 production (Fig. 4K, 4H). The interaction between Nrf2 and Brg1 was confirmed (Fig. 5H).

We also detected Brg1 expression in ADR mice. The number of Brg1-positive PECs increased by 3.19-folds (p < 0.0001) and 2.59-folds (p < 0.001) after ADR injection at 2 weeks and 6 weeks compared with that at 0 week (Fig. 5K, 5L).

Nrf2 activation or overexpression increases WT-1 positive cells in ADR mice

Normal mice and mice with ADR-induced nephropathy were treated with or without the nrf2 agonist bardoxolone-methyl (CDDO-Me). Pretreatment with CDDO-Me reduced UACR levels and glomerulosclerosis in ADR mice (Fig. 6A, 6B). WT-1 positive cells in ADR mice were decreased, which can be partially relieved by CDDO-Me pretreatment (Fig. 6A, 6C). We also found that mice treated with CDDO-Me exhibited Nrf2 overproduction in PECs (Fig. 6A).

FIG. 6.

Nrf2 activation promotes PEC differentiation in vivo. (A) Periodic acid–Schiff staining, immunohistochemical staining for WT-1, as well as immunofluorescence staining of claudin-1 and Nrf2 in the kidneys of different groups. Yellow arrows indicated Nrf2-positive PECs. Scale bars: 20 µm. (B) Urinary albumin to creatinine ratio (ACR) in mice of the different groups (n = 5). (C) Quantification of WT-1 positive cells within glomeruli in different groups (n = 5). (D) Immunohistochemical staining showed WT1 and Brg1 positive PECs in Nrf2^flox/+ (Control) mice, Pax8 Cre: Nrf2^flox/+ (cKI) mice treated with saline (Control), or ADR. Black arrows showed Brg1 positive PECs. Scale bars: 20 µm. (E) Quantification of WT-1-positive cells/μm² of glomerulus (n = 50) from four groups. Data were presented as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 between groups.

PEC specific human NRF2 knock-in mice were generated by crossing Pax8 Cre mice (PAX8 Cre+) with hNRF2^flox/flox mice. Genotype identification results are shown in Supplementary Figure S4A. We found that human Nrf2 gene was expressed in the kidney and liver and Nrf2 protein produced in PECs in Pax8 Cre+: hNRF2^flox/+ mice (Supplementary Figure S4B, S4C). However, the area of glomeruli in Pax8 Cre+: hNRF2^flox/+ mice was smaller than that in hNRF2^flox/+ mice (Supplementary Figure S4D). Thus, Pax8 Cre+: hNRF2^flox/+ (conditional knock-in [cKI]) mice and hNRF2^flox/+ (Control) mice were used for further study (Supplementary Figure S4E). We found that the number of Brg1 positive PECs in cKI mice was more than that in Control mice (Fig. 6D). Furthermore, WT1 positive cells per μm² of glomeruli in cKI mice were more than that in Control mice (Fig. 6D, 6E).

Discussion

In the present study, we found an increase in mitochondrial generation during the differentiation of PECs into podocytes. Mitochondrial-derived ROS signaling mediated the translocation of Nrf2 from the cytoplasm to nuclei. Nrf2 regulated Brg1 binding with WT-1 promoter.

Recent studies have identified PECs as potential stem cells within the glomerulus that can differentiate toward podocytes and facilitate repair following podocyte injury. Retinoic acid plays an important role in the differentiation of PECs (Zhang et al., 2012b). However, in mice with ADR nephropathy, retinoic acid may be sequestered by proteinuria (Peired et al., 2013). In the present study, we observed a decrease in the number of WT1 positive cells in mice with ADR nephropathy, suggesting that podocyte regeneration by PECs is low efficiency although there was Nrf2 and Brg1 activation in PECs. We believed that endogenous retinoic acid alone activated ROS-Nrf2-Brg1 signaling insufficiently when retinol is blocked to generate retinoic acid by proteinuria. Direct activation of Nrf2 in vivo and in vitro study significantly increased PEC differentiation into podocyte, implicating that this may be a potential strategy to promote podocyte regeneration in proteinuria-related diseases.

Some studies have proposed that Notch signaling, miR-193a, and Gas1 are involved in regulating the differentiation of renal progenitors or PECs into podocytes (Kietzmann et al., 2015; Lasagni et al., 2010; Luna-Antonio et al., 2017), which implies that different signaling pathways regulate PEC transformation. Several studies have highlighted the significant role of mitochondria in stem cell differentiation (Chakrabarty and Chandel, 2021). Adenosine triphosphate (ATP) generation from glycolysis metabolism shifting to oxidative phosphorylation-dependent metabolism has been demonstrated in the differentiation of progenitor cells or stem cells (Hsu et al., 2016; Jorgensen and Khoury, 2021). Therefore, the generation of mitochondria may be necessary for energy supply in PEC transformation, as PECs had less mitochondria in the stable status, which may be similar with podocyte differentiation in vitro (Imasawa et al., 2017). Besides ATP generation, ROS production, release of cytochrome C as well as calcium regulation from mitochondria also control cell fate (Bigarella et al., 2014; Sun et al., 2016). In induced pluripotent stem cells and embryonic stem cells, a moderate increase in ROS is necessary for differentiation into different lineages (Tan and Suda, 2018). ROS affect multiple intracellular signaling pathways, such as nuclear factor kappa-B (NFκ B), mitogen-activated protein kinases (MAPKs), phosphoinositide 3 kinase-protein kinase B (PI3K-Akt), mitochondrial permeability transition pore (mPTP) and protein kinases, by activating/inactivating receptors, proteins, ions, and signaling molecules (Bae et al., 2011). Inhibition of the mitochondrial respiratory chain or depolarization of the mitochondrial membrane potential prevents the differentiation of pluripotent stem cells but maintains pluripotency (Mandal et al., 2011). Thus, fewer mitochondria maintaining a low basal level of ROS in stable PECs may be necessary to maintain the characteristics of potential stem cells.

ROS accumulation in mitochondria induces the transcription and protein production of antioxidant genes. The Forkhead box protein O (FOXO) family members and Nrf2 are the most important transcription factors that regulate antioxidant genes and protect cells from high levels of ROS. Recent advancements in understanding the Nrf2 pathway have underscored its crucial role in bolstering cellular resilience against oxidative stress and its potential therapeutic applications across a range of degenerative diseases(Calabrese et al., 2005; Catino et al., 2015; Mancuso et al., 2008; Scuto et al., 2020). Meanwhile, Nrf2 is involved in the regulation of the proliferation and differentiation of stem cells and progenitor cells (Jang et al., 2016; Paul et al., 2014; Tsai et al., 2013). Nrf2 belongs to the CNC transcription factor family and has a highly conserved basic leucine zipper structure (Motohashi et al., 2002). The Nrf2 protein consists of seven highly conserved Neh structural domains (1–7) (Baird and Dinkova-Kostova, 2011). Among them, Neh4 and Neh5 are N-terminal structural domains with different trans-activating properties that synergistically bind the coactivator CPEB binding protein and Brg1 to activate transcription of target genes (Katoh et al., 2001; Zhang et al., 2006). Yamamoto et al. found that under oxidative stress, Brg1 interacts with Nrf2 to enhance the transcriptional activity of Nrf2 by promoting the formation of Z-DNA and consequent recruitment of RNA polymerase II, which is critical for HO-1 activation (Zhang et al., 2006). Our findings indicate that PECs in conditional hNRF2 knock-in mice exhibit higher podocyte density, suggesting that Nrf2 plays a key role in podocyte repair. In fact, we screened Nrf2 expression in Nephroseq: Nrf2 expression increased in patients with chronic kidney disease (CKD) compared with those with normal kidney function (Nakagawa et al., 2015). Activation of Nrf2 signaling protects against podocyte injury and reduces 24-h urinary albumin in diabetic nephropathy mice (Lv et al., 2023), while Nrf2 deficiency worsens diabetic kidney disease (Liu et al., 2022), implicating Nrf2 as crucial for podocyte repair. However, Su K et al. found that Nrf2 knockout reduced UACR in Db/Db mice. In their study, Nrf2 deficiency was not conditional in PECs and was associated with reduced fasting blood glucose and glomerular filtration rate (GFR)/body weight (BW) ratio (Su et al., 2023). Thus, the decrease in UACR might be attributable to metabolic control. CDDO-Me has been shown to improve progression of renal dysfunction in patients with CKD and type-2 diabetes mellitus (Pergola et al., 2011). The urinary ACR, however, did not decrease in CDDO-Me groups, potentially due to the advanced stage of CKD in the enrolled patients. In patients with an estimated GFR of 20–45 mL/min/1.73 m², more than half of the glomerulus might be destroyed. Thus, most PECs would be lost, and the capability of differentiation would decrease. Curcumin (Nrf2 activator) has been found to attenuate urinary excretion of albumin in patients with early-stage kidney disease due to diabetes mellitus (Yang et al., 2015).

The Neh4 and Neh5 structural domains of Nrf2 interact with Brg1 to regulate transcription. Brg1 is the central catalytic ATPase subunit of the switch/sucrose nonfermentable (SWI/SNF) chromatin remodeling complex (Clapier and Cairns, 2009). As a major factor in chromatin remodeling, Brg1 plays a key part in the replication, repair, recombination, and transcriptional regulation of DNA by interacting with various nuclear proteins (e.g., receptors, transcription factors, chromatin-modifying enzymes) (Mohrmann and Verrijzer, 2005; Trotter and Archer, 2007). Brg1 is involved in the proliferation, apoptosis, and differentiation of cells (Marathe et al., 2017; Singh et al., 2016; Wu et al., 2016). It also plays roles in cancer (Pyo et al., 2018), liver fibrosis (Li et al., 2018), and heart disease (Vieira et al., 2017). Riley et al. constructed a mouse model of epicardial conditional knockout of Brg1 expression. They found that targeting Brg1 reduced its binding to the ECRs of WT-1, leading to reduced WT-1 expression in the heart, indicating that BRG1 is required for WT-1 activation (Vieira et al., 2017). We demonstrated that Brg1 could bind to two ECR sites (+4.0 kb and +5.8 kb) in the WT-1 intron. Within the glomerulus, WT-1 (the most complex transcription factor of a podocyte) directly regulates the transcription of genes such as podocalyxin (Palmer et al., 2001) and nephrin (Wagner et al., 2004). Therefore, Brg1 might mediate the differentiation of PECs to podocytes through regulation of WT-1 transcription.

There are some limitations in the present study. We were unable to perform PECs lineage tracing in vivo, which would provide more intuitive evidence. Second, we do not establish a conditional knockout mouse line of Nrf2 or Brg1 mouse line to further confirm their roles in PEC differentiation in vivo. We believe only a small number of PECs differentiated into podocytes can be found in limited glomeruli. Thus, knockout Nrf2 or Brg1 in PECs may be unable to show the effects. Third, Pax8 presents in tubular epithelial cells and may not be so specific for PECs. To our knowledge, there is currently no suitable specific marker for PECs that can be used to develop conditional knockout or knock-in mice.

In summary, the present study demonstrated that mitochondrial-derived ROS generation, Nrf2 translocation, and Brg1 binding to WT-1 promoter are key events that regulate the differentiation of PECs into podocytes.

Materials and Methods

Reagents

ADR was purchased from MedChemExpress (Monmouth Junction, NJ, USA, cat# HY-15142). NAC was obtained from Sigma (Burlington, MA, USA, cat# A7250). MitoTempo was sourced from Abcam (Cambridge, UK, cat# ab144644). DMF was from APExBIO Technology (Houston, TX, USA, cat# B1931). CDDO-Me was purchased from Selleck Chemicals (Houston, TX, USA, cat# S8078).

Cell culture of PECs

To isolate glomeruli, mice were euthanized by overdose of pentobarbital sodium (1 g/kg BW). The kidney cortex was dissected free and cut into small pieces in culture medium. Then, the tissue suspension was poured onto a stainless-steel 80-mesh screen (pore size: 180 μm). The resultant mixture was transferred onto a 150-mesh screen (pore size: 100 μm) and a 200-mesh screen (pore size: 75 μm) successively. Glomeruli-enriched tissue was retained on a 200-mesh screen placed under a 150-mesh screen. Tissue fragments were collected and suspended in RPMI 1640 medium (Gibco, Grand Island, NY, USA, 11875085) supplemented with 5% fetal bovine serum, penicillin, streptomycin (Gibco, cat# 15070063), EGF (Gibco, cat# PMG8045), hydrocortisone (Tocris Bioscience, Bristol, UK, cat# 4093), and ITS (Gibco, cat# 41400045). After culture for one week, cellular outgrowths from glomeruli were detached using a trypsin-EDTA solution and filtered with a 40-μm strainer to remove glomerular fragments. Identification of PECs is shown in Supplementary Figure S1. PECs incubated with differentiated medium (RPMI 1640 with calcitriol 100 nM, ATRA 10 nM, and dexamethasone 50 nM) for 1 week.

Conditional knock-in of Nrf2 in mouse PECs

To generate PEC specific Nrf2 knock-in mice, CAG-LSL-human NRF2-IRES-luciferase-2A-tdTomato mice (C57BL/6Smoc-Gt[ROSA]26Sor^{em1(CAG-LSL-NRF2-IRES-luciferase-2A-tdTomato)Smoc} ) were crossed to Pax8-Cre mice (C57BL/6Smoc-Pax8^{em1(Cre-WPRE-polyA)Smoc} ). Both mice were purchased from Shanghai Model Organisms Center, Inc. (Shanghai, China). Nrf2 transgenic/PAX8-Cre mice were confirmed by PCR genotyping. We found that the livers and kidneys from Pax8 Cre+: hNRF2^flox/+ mice expressed human nfe2l2 gene well (Supplementary Figure S4B). Furthermore, we demonstrated that PECs in Pax8 Cre+: hNRF2^flox/+ mice can produce Nrf2 protein (Supplementary Figure S4C) and the glomeruli smaller in Pax8 Cre+: hNRF2^flox/+ mice than those in hNRF2^flox/+ mice (Supplementary Figure S4D).

Animal experiments

Animal experiments were undertaken using a protocol approved by Renji Hospital within Shanghai Jiaotong University School of Medicine (Shanghai, China). Animals were housed under defined conditions (22°C, specified pathogen-free, 12-h day/12-h night cycle) and fed standard laboratory chow ad libitum. Male specific-pathogen-free BALB/c mice (6–8 weeks; Shanghai SLAC Laboratory Animals, Shanghai, China) were divided into two groups as follows: control and ADR treatment. Nephropathy was induced by a single injection of ADR (10 mg/kg BW, i.v.). At 2 weeks and 6 weeks of age, mice were sacrificed using pentobarbital sodium. A urine sample was collected and kidneys harvested for subsequent analyses.

At the age of 8 weeks, 20 male BALB/c mice were weighed and randomized into four groups of five as follows: vehicle control, CDDO-Me treatment, ADR treatment, and ADR+CDDO-Me treatment. Mice in vehicle control group were administered 0.1 mL of vehicle consisting of dimethyl sulfoxide and Sulfobutylether-β-Cyclodextrin (SBE-β-CD) in saline by oral gavage daily. In the CDDO-Me treatment group, mice were administered CDDO-Me at a dose of 10 μmol/kg/day in 0.1 mL of vehicle. At the age of 6 weeks, mice from the four groups were killed 24 h after the final administration of vehicle or CDDO-Me.

Transgenic Pax8 Cre+: hNRF2^flox/+ mice (cKI) and hNRF2^flox/+ mice (Control) grouping is shown in Supplementary Figure S4E. Mice were subjected to unilateral nephrectomy at 6–8 weeks old. Mice with ADR (10 mg/kg BW, i.v.) or saline were injected into mice in ADR or control groups 1 week after nephrectomy. Six weeks after injection, mice were anesthetized (pentobarbital injection) and perfused with 1% phosphate-buffered saline (PBS). Samples of urine and blood were collected, and the kidneys were harvested for processing.

Immunoblotting

Protein was extracted from fractionated cells. The protein concentration was determined using a Bicinchoninic-Acid Assay Kit (Thermo Scientific, Waltham, MA, USA). We wished to extract protein from cell supernatants. The cell supernatant was collected and centrifuged at 12,000×g for 10 min at 4°C, and 20 μL of the cell supernatant was aspirated from near the bottom of the centrifuge tube (taking care not to touch the cell pellet). Protein samples were resolved by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose membranes. Immunoblot bands were visualized using an imaging system from Tanon (Zhejiang, China).

The antibodies we used were as follows: anti-synaptopodin (Proteintech, Wuhan, China, cat# 21064), anti-PGC1α (Proteintech, cat# 66369), anti-SOD2 (Proteintech, cat# 24127), anti-Nrf2 (Proteintech, cat# 80593), anti-tubulin (Proteintech, cat# 10094), anti-WT1 (Cell Signaling Technology, Danvers, MA, USA, cat# 83535), anti-GAPDH (Santa Cruz, CA, USA, cat# sc-47724), anti-CytC (Santa Cruz, cat# sc-13560), anti-TOMM20 (Santa Cruz, cat# sc-17764), anti-COX IV (Abcam, cat# ab16056), anti-claudin-1 (Abcam, cat# ab307692), anti-Brg1 (Abcam, cat# ab150077), anti-FOXC1(Abcam, cat# ab223850), anti-nephrin (Abcam, cat# ab216692), and anti-3-NT (Abcam, cat# ab314438).

RNA extraction and real-time reverse transcription–quantitative polymerase chain reaction

Total RNA was extracted using TRIzol^® Reagent (Thermo Scientific) according to manufacturer’s instructions. After reverse transcription, complementary (c)DNA samples were denatured and amplified using a LightCycler™ 480 real-time PCR system (Roche Applied Science, Mannheim, Germany). Amplification conditions were 45 cycles of 95°C for 30 s, 95°C for 10 s, and 60°C for 20 s. The primers we used are shown in Table 1.

Table 1.

Primers Used in Real-Time Reverse Transcription–Quantitative Polymerase Chain Reaction for Selected Genes

Gene	Forward sequence (5′—3′)	Reverse sequence (5′—3′)
GAPDH	AGGTCGGTGTGAACGGATTTG	GGGGTCGTTGATGGCAACA
mtDNA	CTAGCAGAAACAAACCGGGC	CCGGCTGCGTATTCTACGTT
nDNA	CTAAGGGGTTCAAGTCCAGTGG	AGACCAATCTCGCAGTTCTGA
Tomm40	TTGGGGAGTCCAACTACCACT	AGAACCACGGTACTCGCCA
VDAC1	CCCACATACGCCGATCTTGG	GCTGCCGTTCACTTTGGTG
Tomm20	GCCCTCTTCATCGGGTACTG	ACCAAGCTGTATCTCTTCAAGGA
Tim29	GCTTTTGCTCGCTGGTTTACG	CGTCGTTGATGTCGCAATCAT
Tim44	CTAGGCAGCGGAATCCAATTT	AGCAAGCCTGACAAAAACCCT
HSP60	TTGGAGCTAAACTTGTTCAGGAC	CCTCCTTGGCAATAGATCGTG
HSP70	GAGATCGACTCTCTGTTCGAGG	GCCCGTTGAAGAAGTCCTG
CytC	CCAAATCTCCACGGTCTGTTC	ATCAGGGTATCCTCTCCCCAG
nfe2l2	CAGCCATGACTGATTTAAGCAG	CAGCTGCTTGTTTTCGGTATTA
Neh4	TCCCAGGTTGCCCACATTCCC	GGCAAGCGACTCATGGTCATCTAC
Neh5	AGAGCAGGACATGGAGCAAGTTTG	TGGCTTCTGGGCTGGGAACAG
Brg1	GAAGATTGAGAAGGAGGACGAC	CTTGATCTTCACCTTGACGGAG
−4.4 kb	TTCTCCTCCTCCTCCTCCTC	AGGGGCTAAAACCACCTAGC
−3.4 kb	GCAAGGCTACAGCGTGTTTA	GGCGCATAATTATTACAAGATGAA
−0.3 kb	CCCCAAAGTTAGGCTATCTGC	TAATGAGTCCCCTCGGTGTC
−0.2 kb	GACACCGAGGGGACTCATTA	CCCTAGCCTAGCTCAGCAAA
−42 bp	ACACCCCCGGTGCTAGTAA	CAGCTTCCCAAAGCTCAAA
+4.0 kb	GGAGGAGAGCTCAGAGCCTTA	GCAGAGAGATTGCTGACTTCG
+5.8 kb	CCCCCTACAAGCTTTCCTAAA	ACAAACAACACCGTGGCTCT
(−)ECR	CTGGAAACTGAGCCCTATGC	TGTAGCCTTGCGATCTGTCA

RNA interference

PGC1α siRNA, Nrf2 siRNA, Brg1 siRNA, and negative control siRNA were purchased from Jiman (Shanghai, China). siRNAs (100 nmol/L) were transfected transiently using Lipofectamine™ 3000 according to manufacturer’s (Thermo Scientific) instructions.

Immunofluorescence and immunohistochemical staining

Cryosections of thickness of 2 μm were prepared using a cryostat. They were fixed in 4% paraformaldehyde for 15 min. After blocking, the cryosections were incubated with primary antibodies and then with Alexa Fluor^® 488 secondary antibody and Alexa Fluor^® 555 secondary antibody (1:200; Abcam, cat# ab150077, ab150078). Fluorescence images were recorded using a confocal microscope (TCS SP5II; Leica, Bensheim, Germany). The primary antibodies we used were anti-podocalyxin (1:200; R&D Systems), anti-claudin-1 (1:200; Abcam), and anti-PGC1α (1:100; Proteintech).

For immunohistochemical analyses, after deparaffinization, rehydration, antigen retrieval, and blockade, cryosections were incubated with anti-PCNA (1:100; Proteintech, cat# 60097) and anti-Brg1 (1:200, Abcam). Then, cryosections were incubated with a horseradish peroxidase-labeled secondary antibody (Beyotime Institute of Biotechnology, Shanghai, China).

Transmission electron microscopy and immunoelectron microscopy

Cortical kidney sections were fixed with 2.5% glutaraldehyde in PBS at 4°C overnight, postfixed in 1.0% OsO4, and embedded in LR White Resin (London Resin, Hampshire, England). Ultrathin sections (70 nm) were stained with uranyl acetate and examined under an electron microscope (CM120; Philips, Eindhoven, the Netherlands) at 80 kV.

For immunoelectron microscopy, kidneys were perfused through the heart with 4% paraformaldehyde/2.5% glutaraldehyde in PBS for 20 min at 4°C. Cortical kidney sections were cut and dipped in 4% paraformaldehyde/2.5% glutaraldehyde for 1 h. Sections were embedded in LR White Resin, and ultrathin sections were prepared. Ultrathin sections were incubated with rabbit anticlaudin-1 antibody (1:50) and gold conjugate nanoparticles (10 nm; 1:50) overnight at 4°C. An electron microscope (CM120; Philips) was used for examination of sections.

Construction and transfection of plasmids

A plasmid directing overexpression of the Nrf2 ECH homolog Neh4 and Neh5 domains of Nrf2 was purchased from Jiman. A fragment of the target gene was first amplified using the following primers: forward, 5′-CGAATTCGAAGTATACCTCGAGGAATTCGCCACCATGGGATC-3′ and reverse, 5′-GATCGCAGATCCTTGGATCCTCACGAGGAGATCGATGAGTAAAAATG-3′. Then, the amplified fragment was ligated into a lentiviral vector (PGMLV-CMV-NeH4-P2A-NeH5-EF1-ZsGreen1-T2A-Puro) through restriction sites contained at both ends. The ligation product was transfected into competent bacterial cells. Newly grown monoclonal colonies were sequenced to confirm their identity. We aligned the correct clones to construct the overexpressing adenoviral vector containing the gene of interest. Plasmid transfection was undertaken using a FuGENE^™ Transfection Kit (Promega, Madison, WI, USA) according to manufacturer’s instructions.

The brg1 overexpression plasmid was purchased from Shanghai Jikai Gene Chemical Technology (Shanghai, China). Theforward primer was 5′-AGGTCGACTCTAGAGGATCCCGCCACCATGTCTACTCCAGACCCACCCTTGGGTG-3′, and the reverse primer was 5′-TCCTTGTAGTCCATACCGGTGTCTTCCTCACTGCCACTTCCTGAGCG-3′. The amplified fragment was ligated into an adenoviral vector (CMV-MCS-3FLAG-SV40-EGFP).

Detection of albumin and creatinine in urine

Mouse albumin was determined using an Albumin Assay Kit (Jiancheng, Nanjing, China). Absorbance was determined at 510 nm using a microplate reader. The creatinine concentration in urine was determined using a creatinine assay kit (Cayman Chemicals, Ann Arbor, MI, USA) according to manufacturer’s instructions. The creatinine concentration in urine samples was determined using a standard curve for creatinine. The dynamic range of the kit was 0–15 mg/dL of creatinine. The absorbance at 500 nm was determined using a microplate reader.

Coimmunoprecipitation

The cells were lysed using a commercial kit (abs955, Absin Bioscience Inc., Shanghai, China). After 10-min centrifugation at 14,000×g, the supernatants were incubated with anti-Flag (Nrf2) antibody and control IgG, respectively, at 4°C overnight followed by the treatment with protein A/G agarose beads and further incubated at 4°C overnight. Then, lysates were centrifuged, and the precipitate was washed thrice with cold wash buffer. Finally, the immunoprecipitated proteins of Nrf2 and Brg1 were detected by Western blot analysis.

ChIP

PECs were crosslinked with 1% formaldehyde at room temperature for 10 min, incubated first in nuclei extraction buffer, then in lysis buffer, and sonicated. Solubilized chromatin was incubated overnight at 4°C with a rabbit monoclonal anti-Brg1 antibody (Abcam) coupled to antirabbit immunoglobulin (Ig)G Dynabeads. After primary ChIP, specific immunoprecipitates were washed, eluted, and incubated with dithiothreitol (10 mM) for 30 min at 37°C. Then, they were diluted 10-fold in ChIP buffer (EDTA [10 mM], Tris-HCl [50 mM, pH 8.0], 1% SDS, protease inhibitors) and reimmunoprecipitated with secondary antibodies. Isolation of reimmunoprecipitated chromatin was done according to manufacturer’s instructions (Millipore, Bedford, MA, USA). Extracted DNA was used for real-time reverse transcription–quantitative polymerase chain reaction (RT-qPCR) (see above). Fold enrichment was determined as percent fold-change in ChIP signal/IgG signal at the target region.

Statistical analyses

The results are expressed as mean ± standard deviation (SD) for each group. Statistical analyses were undertaken using one-way analysis of variance (ANOVA) followed by a Newman–Keuls multiple-comparisons test using Prism 6.0 (GraphPad, La Jolla, CA, USA) for analyses of data from histology, immunohistochemistry, real-time RT-qPCR, and Western blot studies. Repeat ANOVA was used for analyses of albumin excretion and serum levels of creatinine. p < 0.05 was considered significant.

Footnotes

Acknowledgments

The authors thank the staffs in Renal Pathology Laboratory of Shanghai Jiao Tong University affiliated Renji Hospital for their technical support.

Authors’ Contributions

Conceived and designed the experiments: L.G. and R.L. Performed the experiments: M.W., W.W., J.L., and K.X. Analyzed the data: A.S., B.Z., and W.W. Contributed reagents/materials/analysis tools: L.M. and Y.L. Wrote the first draft of the article: M.W., W.W., and K.X. Revised the article: L.G. L.G. is also the guarantor of this work and, as such, had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.

Ethics Approval

The animal study was approved by the Institutional Animal Care and Use Committee (IACUC) of Shanghai Jiaotong University.

Availability of Data and Materials

All of the data of this study are available from the corresponding author.

Author Disclosure Statement

All authors declared no financial or scientific conflicts of interest with regard to the research described in this article.

Funding Information

This work was supported by the National Natural Science Foundation of China (Grant nos. 81970610, 81770665, and 82000634), the Program of Shanghai Academic/Technology Research Leader (22XD1431400), the Natural Science Foundation of Shanghai (22140903900), the Shanghai Municipal Education Commission Gaofeng Clinical Medicine (Grant no. 20172015), and Shanghai Sailing Program (Grant no.20YF1425000).

Supplementary Material

Supplementary Figure S1

Supplementary Figure S2

Supplementary Figure S3

Supplementary Figure S4

Abbreviations Used

References

Bae

, Oh

, Rhee

, et al. Regulation of reactive oxygen species generation in cell signaling. Mol Cells, 2011; 32(6):491–509; doi: 10.1007/s10059-011-0276-3

Baird

, Dinkova-Kostova

. The cytoprotective role of the Keap1-Nrf2 pathway. Arch Toxicol, 2011; 85(4):241–272; doi: 10.1007/s00204-011-0674-5

Bigarella

, Liang

, Ghaffari

. Stem cells and the impact of ROS signaling. Development, 2014; 141(22):4206–4218; doi: 10.1242/dev.107086

Calabrese

, Colombrita

, Guagliano

, et al. Protective effect of carnosine during nitrosative stress in astroglial cell cultures. Neurochem Res, 2005; 30(6–7):797–807; doi: 10.1007/s11064-005-6874-8

Catino

, Paciello

, Miceli

, et al. Ferulic acid regulates the Nrf2/Heme Oxygenase-1 system and counteracts Trimethyltin-Induced neuronal damage in the human neuroblastoma cell line SH-SY5Y. Front Pharmacol, 2015; 6:305; doi: 10.3389/fphar.2015.00305

Chakrabarty

, Chandel

. Mitochondria as signaling organelles control mammalian stem cell fate. Cell Stem Cell, 2021; 28(3):394–408; doi: 10.1016/j.stem.2021.02.011

Clapier

, Cairns

. The biology of chromatin remodeling complexes. Annu Rev Biochem, 2009; 78:273–304; doi: 10.1146/annurev.biochem.77.062706.153223

Eng

, Sunseri

, Kaverina

, et al. Glomerular parietal epithelial cells contribute to adult podocyte regeneration in experimental focal segmental glomerulosclerosis. Kidney Int, 2015; 88(5):999–1012; doi: 10.1038/ki.2015.152

Hsu

, Wu

, Yu

, et al. Mitochondria in mesenchymal stem cell biology and cell therapy: From cellular differentiation to mitochondrial transfer. Semin Cell Dev Biol, 2016; 52:119–131; doi: 10.1016/j.semcdb.2016.02.011

10.

Imasawa

, Obre

, Bellance

, et al. High glucose repatterns human podocyte energy metabolism during differentiation and diabetic nephropathy. FASEB J, 2017; 31(1):294–307; doi: 10.1096/fj.201600293R

11.

Jang

, Wang

, Lalli

, et al. Primary Cilium-Autophagy-Nrf2 (PAN) axis activation commits human embryonic stem cells to a Neuroectoderm Fate. Cell, 2016; 165(2):410–420; doi: 10.1016/j.cell.2016.02.014

12.

Jorgensen

, Khoury

. Musculoskeletal progenitor/stromal cell-derived mitochondria modulate cell differentiation and therapeutical function. Front Immunol, 2021; 12:606781; doi: 10.3389/fimmu.2021.606781

13.

Katoh

, Itoh

, Yoshida

, et al. Two domains of Nrf2 cooperatively bind CBP, a CREB binding protein, and synergistically activate transcription. Genes Cells, 2001; 6(10):857–868; doi: 10.1046/j.1365-2443.2001.00469.x

14.

Kietzmann

, Guhr

, Meyer

, et al. MicroRNA-193a regulates the transdifferentiation of human parietal epithelial cells toward a podocyte phenotype. J Am Soc Nephrol, 2015; 26(6):1389–1401; doi: 10.1681/asn.2014020190

15.

Lasagni

, Ballerini

, Angelotti

, et al. Notch activation differentially regulates renal progenitors proliferation and differentiation toward the podocyte lineage in glomerular disorders. Stem Cells, 2010; 28(9):1674–1685; doi: 10.1002/stem.492

16.

, Lan

, Han

, et al. Brg1 promotes liver fibrosis via activation of hepatic stellate cells. Exp Cell Res, 2018; 364(2):191–197; doi: 10.1016/j.yexcr.2018.02.003

17.

Liu

, Uruno

, Saito

, et al. Nrf2 deficiency deteriorates diabetic kidney disease in Akita model mice. Redox Biol, 2022; 58:102525; doi: 10.1016/j.redox.2022.102525

18.

Luna-Antonio

, Rodriguez-Muñoz

, Namorado-Tonix

, et al. Gas1 expression in parietal cells of Bowman’s capsule in experimental diabetic nephropathy. Histochem Cell Biol, 2017; 148(1):33–47; doi: 10.1007/s00418-017-1550-z

19.

, Cheng

, Zhang

, et al. Triptolide protects against podocyte injury in diabetic nephropathy by activating the Nrf2/HO-1 pathway and inhibiting the NLRP3 inflammasome pathway. Ren Fail, 2023; 45(1):2165103; doi: 10.1080/0886022x.2023.2165103

20.

Mancuso

, Capone

, Ranieri

, et al. Bilirubin as an endogenous modulator of neurotrophin redox signaling. J Neurosci Res, 2008; 86(10):2235–2249; doi: 10.1002/jnr.21665

21.

Mandal

, Lindgren

, Srivastava

, et al. Mitochondrial function controls proliferation and early differentiation potential of embryonic stem cells. Stem Cells, 2011; 29(3):486–495; doi: 10.1002/stem.590

22.

Marathe

, Watkins-Chow

, Weider

, et al. BRG1 interacts with SOX10 to establish the melanocyte lineage and to promote differentiation. Nucleic Acids Res, 2017; 45(11):6442–6458; doi: 10.1093/nar/gkx259

23.

Mitsuishi

, Taguchi

, Kawatani

, et al. Nrf2 redirects glucose and glutamine into anabolic pathways in metabolic reprogramming. Cancer Cell, 2012; 22(1):66–79; doi: 10.1016/j.ccr.2012.05.016

24.

Mohrmann

, Verrijzer

. Composition and functional specificity of SWI2/SNF2 class chromatin remodeling complexes. Biochim Biophys Acta, 2005; 1681(2–3):59–73; doi: 10.1016/j.bbaexp.2004.10.005

25.

Motohashi

, O’Connor

, Katsuoka

, et al. Integration and diversity of the regulatory network composed of Maf and CNC families of transcription factors. Gene, 2002; 294(1–2):1–12; doi: 10.1016/s0378-1119(02)00788-6

26.

Murakami

, Kusano

, Okazaki

, et al. NRF2 signalling in cytoprotection and metabolism. Br J Pharmacol, 2023; doi: 10.1111/bph.16246

27.

Nakagawa

, Nishihara

, Miyata

, et al. Molecular markers of Tubulointerstitial fibrosis and tubular cell damage in patients with chronic kidney disease. PLoS One, 2015; 10(8):e0136994; doi: 10.1371/journal.pone.0136994

28.

Ohse

, Vaughan

, Kopp

, et al. De novo expression of podocyte proteins in parietal epithelial cells during experimental glomerular disease. Am J Physiol Renal Physiol, 2010; 298(3):F702–F711; doi: 10.1152/ajprenal.00428.2009

29.

Palmer

, Kotsianti

, Cadman

, et al. WT1 regulates the expression of the major glomerular podocyte membrane protein Podocalyxin. Curr Biol, 2001; 11(22):1805–1809; doi: 10.1016/s0960-9822(01)00560-7

30.

Paul

, Bisht

, Darmawan

, et al. Dynamic changes in intracellular ROS levels regulate airway basal stem cell homeostasis through Nrf2-dependent Notch signaling. Cell Stem Cell, 2014; 15(2):199–214; doi: 10.1016/j.stem.2014.05.009

31.

Peired

, Angelotti

, Ronconi

, et al. Proteinuria impairs podocyte regeneration by sequestering retinoic acid. J Am Soc Nephrol, 2013; 24(11):1756–1768; doi: 10.1681/asn.2012090950

32.

Pergola

, Raskin

, Toto

, et al. Bardoxolone methyl and kidney function in CKD with type 2 diabetes. N Engl J Med, 2011; 365(4):327–336; doi: 10.1056/NEJMoa1105351

33.

Pyo

, Son

, Oh

, et al. BRG1 is correlated with poor prognosis in colorectal cancer. Hum Pathol, 2018; 73:66–73; doi: 10.1016/j.humpath.2017.12.013

34.

Ronconi

, Sagrinati

, Angelotti

, et al. Regeneration of glomerular podocytes by human renal progenitors. J Am Soc Nephrol, 2009; 20(2):322–332; doi: 10.1681/asn.2008070709

35.

Scuto

, Trovato Salinaro

, Modafferi

, et al. Carnosine activates cellular stress response in podocytes and reduces Glycative and Lipoperoxidative stress. Biomedicines, 2020; 8(6); doi: 10.3390/biomedicines8060177

36.

Shankland

. The podocyte’s response to injury: Role in proteinuria and glomerulosclerosis. Kidney Int, 2006; 69(12):2131–2147; doi: 10.1038/sj.ki.5000410

37.

Singh

, Foley

, Rubino

, et al. Brg1 enables rapid growth of the early embryo by suppressing genes that regulate apoptosis and cell growth arrest. Mol Cell Biol, 2016; 36(15):1990–2010; doi: 10.1128/mcb.01101-15

38.

, Zhao

, Yang

, et al. NRF2 deficiency attenuates diabetic kidney disease in Db/Db Mice via down-regulation of angiotensinogen, SGLT2, CD36, and FABP4 expression and lipid accumulation in renal proximal tubular cells. Antioxidants (Basel), 2023; 12(9); doi: 10.3390/antiox12091715

39.

Sun

, Youle

, Finkel

. The mitochondrial basis of aging. Mol Cell, 2016; 61(5):654–666; doi: 10.1016/j.molcel.2016.01.028

40.

Sun

, Yu

, Kang

. Upregulation of heme oxygenase-1 by Brahma-related gene 1 through Nrf2 signaling confers protective effect against high glucose-induced oxidative damage of retinal ganglion cells. Eur J Pharmacol, 2020; 875:173038; doi: 10.1016/j.ejphar.2020.173038

41.

Suzuki

, Ito

, Imai

, et al. Retinoids regulate the repairing process of the podocytes in puromycin aminonucleoside-induced nephrotic rats. J Am Soc Nephrol, 2003; 14(4):981–991; doi: 10.1097/01.asn.0000057857.66268.8f

42.

Tan

, Suda

. Reactive oxygen species and mitochondrial homeostasis as regulators of stem cell fate and function. Antioxid Redox Signal, 2018; 29(2):149–168; doi: 10.1089/ars.2017.7273

43.

Tan

, Yi

, Zhao

, et al. Intraglomerular crosstalk elaborately regulates podocyte injury and repair in diabetic patients: Insights from a 3D multiscale modeling study. Oncotarget, 2016; 7(45):73130–73146; doi: 10.18632/oncotarget.12233

44.

Trotter

, Archer

. Nuclear receptors and chromatin remodeling machinery. Mol Cell Endocrinol, 2007; 265–266:162–167; doi: 10.1016/j.mce.2006.12.015

45.

Tsai

, Dudakov

, Takahashi

, et al. Nrf2 regulates haematopoietic stem cell function. Nat Cell Biol, 2013; 15(3):309–316; doi: 10.1038/ncb2699

46.

Vieira

, Howard

, Villa Del Campo

, et al. BRG1-SWI/SNF-dependent regulation of the Wt1 transcriptional landscape mediates epicardial activity during heart development and disease. Nat Commun, 2017; 8:16034; doi: 10.1038/ncomms16034

47.

Wagner

, Wagner

, Xing

, et al. The major podocyte protein nephrin is transcriptionally activated by the Wilms’ tumor suppressor WT1. J Am Soc Nephrol, 2004; 15(12):3044–3051; doi: 10.1097/01.Asn.0000146687.99058.25

48.

, Madany

, Dobson

, et al. The BRG1 chromatin remodeling enzyme links cancer cell metabolism and proliferation. Oncotarget, 2016; 7(25):38270–38281; doi: 10.18632/oncotarget.9505

49.

Yang

, Xu

, Zhou

, et al. Curcumin attenuates urinary excretion of albumin in type II diabetic patients with enhancing nuclear factor erythroid-derived 2-like 2 (Nrf2) system and repressing inflammatory signaling efficacies. Exp Clin Endocrinol Diabetes, 2015; 123(6):360–367; doi: 10.1055/s-0035-1545345

50.

Zhang

, Hansen

, Pippin

, et al. De novo expression of podocyte proteins in parietal epithelial cells in experimental aging nephropathy. Am J Physiol Renal Physiol, 2012a;302(5):F571–F580; doi: 10.1152/ajprenal.00516.2011

51.

Zhang

, Ohta

, Maruyama

, et al. BRG1 interacts with Nrf2 to selectively mediate HO-1 induction in response to oxidative stress. Mol Cell Biol, 2006; 26(21):7942–7952; doi: 10.1128/mcb.00700-06

52.

Zhang

, Pippin

, Krofft

, et al. Podocyte repopulation by renal progenitor cells following glucocorticoids treatment in experimental FSGS. Am J Physiol Renal Physiol, 2013; 304(11):F1375–F1389; doi: 10.1152/ajprenal.00020.2013

53.

Zhang

, Pippin

, Vaughan

, et al. Retinoids augment the expression of podocyte proteins by glomerular parietal epithelial cells in experimental glomerular disease. Nephron Exp Nephrol, 2012b;121(1–2):e23–e37; doi: 10.1159/000342808

54.

Zhang

, Yanez

, Floege

, et al. ACE-inhibition increases podocyte number in experimental glomerular disease independent of proliferation. J Renin Angiotensin Aldosterone Syst, 2015; 16(2):234–248; doi: 10.1177/1470320314543910

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

11.39 MB