Generation of mtDNA Homoplasmic Cloned Lambs

Abstract

Generally in mammals, individual animals contain only maternally inherited mitochondrial DNA (mtDNA), as paternal (sperm)-derived mitochondria are usually eliminated during early development. Somatic cell nuclear transfer (SCNT) bypasses the normal routes of mtDNA inheritance and introduces not only a different nuclear genome into the recipient cytoplast (in general an enucleated oocyte) but also somatic mitochondria. Differences in mtDNA genotype between recipient oocytes and potential mtDNA heteroplasmy due to persistence and replication of somatic mtDNA means that offspring generated by SCNT are not true clones. However, more importantly, the consequences of the presence of somatic mtDNA, mtDNA heteroplasmy, or possible incompatibility between nuclear and mtDNA genotypes on subsequent development and function of the embryo, fetus and offspring are unknown. Following sexual reproduction, mitochondrial function requires the biparental control of maternally inherited mtDNA, whereas following SCNT incompatibility between the recipient cell mitochondrial and transplanted nuclear genomes, or mtDNA heteroplasmy, may result in energy imbalance and initiate the onset of mtDNA-type disease, or disruption of normal developmental events. To remove the potentially adverse effects of somatic mtDNA following SCNT we have previously produced embryos using donor cells depleted to residual levels of mtDNA (mtDNA^R). We now report that these cells support development to term and produced live lambs in which no donor somatic mtDNA was detected, the lambs being homoplasmic for recipient oocyte DNA.

Introduction

Almost all mammalian cells possess mitochondria, organelles that mediate and direct cellular homeostasis, apoptosis, and steroid and energy production. Mitochondria possess their own circular genome, mitochondrial DNA (mtDNA), which is approximately 16.6 kb in size and encodes 13 polypeptides of the electron transfer chain (ETC), the cell's major producer of ATP through the process of oxidative phosphorylation (OXPHOS) (Anderson et al., 1981). It also encodes 22 transfer RNAs (tRNAs) and 2 ribosomal RNAs (rRNAs) that contribute, with support from nuclear-encoded genes, to its transcription and translation. MtDNA copy number in cell types varies considerably and reflects a cell's requirement for ATP. Mutation, deletion or depletion of mtDNA can lead to the onset of severe or fatal diseases that result from decreased energy production (Wallace, 1999).

The fertilized zygote contains both maternal and paternal mtDNA derived from the oocyte (>200,000 copies) (Spikings et al., 2007) and sperm (<20 copies) (Amaral et al., 2007), respectively. However, transmission of mtDNA is restricted to being maternal only by elimination of sperm mtDNA prior to embryonic genome activation, most likely through a ubiquitination-mediated process (Sutovsky et al., 1999). This elimination is limited to intraspecific (i.e., same strains or breeds within a species) crossings (Kaneda et al., 1995), although rare exceptions have been reported (Schwartz and Vissing, 2002; St. John et al., 2000). However, sperm mtDNA can be transmitted following interspecific crossing, and this is most likely due to the failure of the strain or breed specific ubiquitination system to target the genetically more diverse ubiquitin label (Sutovsky et al., 1999).

The maternally inherited copies of mtDNA in the oocyte tend to be identical (homoplasmic), most likely due to a restriction event that takes place during very early embryogenesis just before or as the primordial germ cells (PGCs) are established, either with (Cree et al., 2008) or without a reduction in mtDNA content (Cao et al., 2007). The 200 or so mtDNA genomes present in each cell are then clonally expanded as the PGCs differentiate into oocytes, and in particular, following release from meiosis I arrest during maturation (Cree et al., 2008; Shoubridge and Wai 2007; Spikings et al., 2007). Furthermore, some early partitioning of heteroplasmic populations of mtDNA could account for the variable loading of mtDNA content between oocytes from the same female (Cree et al., 2008).

In domestic animals produced by nuclear transfer (NT), the embryo is reconstructed with cytoplasmic contributions from both the recipient cell (in general, an MII oocyte) and the nuclear donor cell, both of which contain mitochondria and mtDNA. However, in some modifications of the technique such as serial nuclear transfer (Hall et al., 2006; Kurome et al., 2008; Ono et al., 2001) and double nuclear transfer (Polejaeva et al., 2000), or when two or more recipient oocytes are concomitantly fused with the donor cell to increase cytoplast volume such as in sheep (Peura et al., 1998) or “Hand-Made Cloning” procedures as in cattle and pigs (Kragh et al., 2004; Vajta et al., 2004) then mtDNA will be contributed by each cell potentially resulting in heteroplasmy consisting of two or more mtDNA genotypes as demonstrated in cattle (Bowles et al., 2008) and pigs (St. John et al., 2005). In general, recipient oocytes are obtained randomly from slaughterhouses, and therefore the recipient mtDNA tends to be nonmaternally related. Consequently, the offspring produced are not true “clones” but rather “genomic copies,” as they possess mtDNA from either the recipient oocyte only, or from both the recipient oocyte and donor cell (heteroplasmy). However, dependent upon species, the production of true “clones” in terms of identical nuclear and mitochondrial genomes may be approached by selecting oocytes of identical mtDNA genotypes, which may be achieved in several ways; for instance, the use of oocytes from the nuclear donor animal (females) or from the mother or female siblings of the donor animal (males and females) alternatively oocyte donors may be preselected for identical mtDNA haplotypes, or dependent upon species, selection of inbred lines demonstrates that variation in mtDNA genotype is rare (i.e., mouse) (Dai et al., 2001). Studies using both oocytes from the nuclear donor (Hiendleder et al., 2004) and from half sibs (Bruggerhoff et al., 2002) have been reported; however, these studies did not account for the potential harmful effects of somatic mtDNA as suggested following microinjection of mitochondria into mouse zygotes (Takeda et al., 2005).

The contributions of donor and recipient DNA detected in individual offspring derived by nuclear transfer varies considerably with reported contributions of donor mtDNA ranging from 0% in sheep (homoplasmy) (Evans et al., 1999) up to 59% (heteroplasmy) in cattle (Hiendleder et al., 1999; Meirelles et al., 2001; Steinborn et al., 1998; Takeda et al., 2003). In addition, different mtDNA molecules also appear to segregate randomly to different tissues (Takeda et al., 2003), as is also observed in patients with mtDNA disease (Schwartz and Vissing, 2002). Based on these observations, it was initially hypothesized that transmission of donor mtDNA was species-specific as Dolly and nine other ovine clones were all homoplasmic for recipient oocyte mtDNA (Evans et al., 1999). However, it has been recently reported that sheep also tend to heteroplasmy and exhibit random patterns of transmission and segregation, but no heteroplasmy was detected in peripheral blood (Burgstaller et al., 2007). The potential effects of somatic mtDNA on embryo and fetal development following SCNT are unknown. Nevertheless, as diverse populations of mtDNA could coexist, sequence differences between different breeds and strains may have the potential to induce phenotypes associated with mtDNA disease such as those including myopathies and liver diseases, which have been reported in cloned offspring (Cibelli et al., 2002). Similar outcomes may arise from nucleo-mitochondrial incompatibility between the encoding genes of the ETC or from the nuclear-encoded mtDNA-specific replication factors that could mediate a form of mtDNA-depletion type syndrome (for discussion, see Hiendleder, 2007; Smith et al., 2005; St. John et al., 2004). To avoid these possibilities and to demonstrate that homoplasmic offspring can be specifically generated, we have adopted an approach used in somatic cybrid biology that allows the importance of putative mtDNA rearrangements to be studied, namely, the generation of mtDNA depleted cells fused to enucleated cells harboring either a mtDNA rearrangement or are wild-type (King and Attardi, 1996).

Materials and Methods

All experiments involving animals were performed under Home Office Regulation. All reagents and chemicals were acquired from Sigma (Poole, Dorset, UK) unless otherwise stated.

mtDNA depletion of donor cells

Cultures of Ovis aries primary fetal fibroblasts (termed SFF1) were established from a 35-day-old fetus, cultured, and stored as previously described (Wilmut et al., 1997). SFF1 cells were depleted of mtDNA as described in King and Attardi (1996). Briefly, cells frozen at passages 2–3 were thawed and cultured in Dulbecco's modified Eagle's medium (DMEM) containing 4500 mg/L glucose and 1 mM pyruvate, supplemented with 10% v/v fetal bovine serum (FBS), 1 mM L-Glutamine, and 50 μg/mL uridine. At passage 4, cells were then cultured with and without 50 ng/mL ethidium bromide (EthBr) to generate mtDNA^R (residual levels of mtDNA) and mtDNA⁺ (nonreduced levels of mtDNA) donor cells for SCNT, respectively. The percentage of mtDNA per cell was determined over time by calculating the number of copies of the nuclear-encoded gene B-Actin and the mtDNA-encoded ND1 gene for a population of cells by real-time PCR. Passage 10 MtDNA^R cells (containing 1.05% original mtDNA levels) were used as donors for NT, as were time-matched control cells. The concentration of FCS was reduced to 0.1% in cell cultures 3 days prior to their use as donors for nuclear transfer.

Oocyte recovery and in vitro maturation

Sheep ovaries were collected from a local slaughterhouse, transported to the laboratory in PBS at 25°C, and processed as previously described (Bowles et al., 2007b). Briefly, oocytes were asp irated from follicles (2–3 mm in diameter). Good-quality oocytes with compact cumulus cells and evenly pigmented cytoplasm were selected under a dissection microscope. Selected oocytes were washed in HEPES-buffered TCM 199 (Gibco Life Technologies, Glasgow, UK) containing 10% FBS (Gibco) and cultured in maturation medium consisting of bicarbonate-buffered TCM 199 (Gibco) supplemented with 10% FBS, 5 μg/mL FSH (Vetrepharm, Galway, Ireland), 5 μg/mL LH (Vetrepharm), 1 μg/mL estradiol, 0.3 mM sodium pyruvate, 100 μM cysteamine, and 50 μL/mL gentamycin. Groups of 40–50 oocytes were transferred to four-well dishes (Nunc, Roskilde, Denmark) containing 500 μL of maturation medium covered with mineral oil at 39°C in a humidified atmosphere atmosphere of 5% CO₂.

Somatic cell nuclear transfer

Oocytes to be used as cytoplast recipients for NT were enucleated at anaphase/telophase of the first meiotic division (AI-TI). At 15 h postonset of maturation (hpm), oocytes were exposed to HEPES-buffered Synthetic Oviduct Fluid (H-SOF) containing 300 IU/mL of hyaluronidase and then vortexed for 4–5 min to remove cumulus cells. The oocytes were then stained with 1 μg/mL Hoechst 33342 for 10–15 min. A portion of cytoplasm containing the extruding AI-TI spindle was removed in H-SOF plus 7.5 μg/mL cytochalasin B (CB). The aspirated karyoplast in the pipette was visualized under fluorescent light to confirm the presence of chromatin. Enucleated oocytes were cultured in maturation medium until the injection of donor cells. MtDNA⁺ cultured cells and mtDNA^R were used as donor cells. For each experiment, the mtDNA⁺ cells were cultured to the same time points as the mtDNA^R cells prior to use. Experiments using mtDNA^R and mtDNA⁺ cells as nuclear donors were conducted alternately twice weekly. At 23–24 hpm, single donor cells were transferred into the perivitelline space of enucleated oocytes, and the donor–cytoplast couplets were exposed to a single electric pulse of 1.25 kV/cm for 30 μsec in 0.3 M mannitol without calcium ions using an Eppendorf Multiporator (Eppendorf, Germany). Fused couplets were placed in the incubator in modified SOF medium supplemented with 4 mg/mL BSA until activation. Fused couplets were activated by 5 min of incubation in 5 μg/mL calcium ionophore (A23187) followed by culture in mSOF containing 10 μg/mL cycloheximide (CHX) and 7.5 μg/mL CB for 5 h at 39°C. Activated embryos were then washed three times in 1 mL culture medium and transferred into 50-μL drops of mSOF supplemented with 2% (v/v) BME amino acids, 1% (v/v) MEM nonessential amino acids, and 4 mg/mL BSA covered with mineral oil and incubated at 39°C in a humidified atmosphere of 5% CO₂, 5% O₂, 90% N₂. Cleaved embryos were transferred into fresh culture medium containing 10% FBS on days 2, 4, and 6 of culture. At day 7 blastocyst stage embryos were transferred to synchronized surrogate recipient ewes, two to three embryos per recipient (Campbell et al., 1996).

Subsequent to these studies a further series of experiments were conducted using untreated mtDNA⁺ cells and SCNT conditions as described above as the control group. The results of this study are not included here; however, the single live animal obtained was included in the mtDNA analysis.

PCR amplification of region of mtDNA D-loop

To identify polymorphic variants to distinguish between the donor cell and recipient oocyte mtDNA contributions through allele-specific PCR (AS-PCR) analysis and to perform mtDNA genetic distance analysis, we amplified the mtDNA D-loop from nt15532 to nt16075 of the sheep reference sequence (NC-001941) (Hiendleder et al., 1998) to produce 543 bp of sequence. This region is most frequently used to identify variants between different mtDNA lineages. This was performed on an MJ Research PTC-200 machine (GRI, UK). Each 20-μL reaction consisted of 1 × PCR Buffer (Bioline, London, UK), 1.5 mM MgCl₂ (Bioline), 200 μM each dNTP (Bioline), 0.5p μM of each primer (D1F: 5′ CTT CCC ACT CCA CAA GCC 3′ and D4R: 5′ CCT CAT GCA TAT AAG CAC GTA C 3′) and 1U BioTaq DNA polymerase (Bioline). Reactions were run at 95°C for 5 min followed by 35 cycles of 94°C for 30 sec, 56°C for 30 sec, and 72°C for 45 sec. Products were detected on a 2% agarose gel at 100 V for 1 h, and subsequently extracted and purified using the QIAquick Gel Extraction Kit (Qiagen, London, UK) according to the manufacturer's protocol.

DNA sequencing

A total of 200 ng of purified PCR D-loop product and 3.2 pmol primer (D1F and D4R) were made up to a final volume of 10 μL with H₂O. Sequencing was carried out using an ABI PRISM BigDye Terminator v3.1 Cycle Sequencing reaction kit and a GeneAmp PCR system 9700 (Applied Biosystems, Foster City, CA, USA).

Determination of evolutionary distance from sequence data

The mtDNA genetic distance between the donor cell and the recipient oocyte was analyzed as described in Bowles et al. (2007b). Briefly, following removal of the first and last 20 bp of each sequence and alignment of the sequences in ClustalW with a Phylip output format (Thompson et al., 1994), they were then determined using DNADIST that utilizes the F84 model of nucleotide substitution (PHYLIP, version 3.6) (Felsenstein, 2006).

Real-time PCR to determine copy number following mtDNA depletion

mtDNA copy number was determined for each total DNA sample using a Rotorgene-3000 real-time PCR machine (Corbett Research, Mortlake, Australia) and the intercalator Syb-Green. Donor cell DNA was diluted to 10 ng/μL prior to amplification. β-Actin (nuclear housekeeping gene) was amplified with β-ActinF (CATGTATGTGGCCATCCAGGCTG), β-ActinR (GACGCCGCAGTGGCCATCTC), and ND1 (mtDNA encoded) with NDF1 (CTCAACACTAGCAGAAACAA) and NDR1 (TTAGTTGGTCGTAACGGAAT) primers. Purified PCR product of the target gene of known concentration was used to produce standards consisting of 10-fold serial dilutions of the first standard, as described in Bowles et al. (2007b). Each 20-μL reaction contained 7.5 μL Sybr Green Absolute QPCR master mix (Abgene, Epsom, UK), 0.33 μM of each forward and reverse primer, and 2 μL DNA template at 10 ng/μL. Reaction conditions were 95°C for 15 min followed by 50 cycles of 95°C for 10 sec, annealing at 63°C (β-actin) or 51°C (ND1) for 10 sec, and 72°C for 20 sec. Fluorescence data were acquired in the FAM/Sybr channel during the extension phase. To eliminate the effects of primer dimerization, a further extension of 10 sec was included, just above the melting temperature, and fluorescence data were acquired. These values were subtracted from the first acquisition phase. Melt curve analysis was performed by ramping from 72 to 99°C, holding for 5 sec at each step and acquiring from the FAM/Sybr channel. The number of ND1 copies in a sample was divided by the number of cells present in the sample, as calculated from β-Actin, to give a value for mtDNA copy number per cell as previously described (Bowles et al., 2007b).

Restriction enzyme digest

To increase the possibility of detecting absolute minimal levels of donor cell mtDNA, we also digested recipient oocyte mtDNA PCR product prior to AS-PCR. A 40-ng D-loop PCR product was added to 1.5 μL 10× Buffer, 1 μL enzyme Mse I, and made up to 15 μL with H₂O. This was incubated at 37°C for 4 h, followed by deactivation at 65°C for 20 min.

Allele-specific (AS) real-time PCR analysis of mtDNA

AS real-time analysis was performed on the donor cell line (SSF1) and blood samples from the live offspring A088, A089 (mtDNA^R), and A090 (mtDNA⁺) and a range of tissue samples including kidney, liver, heart, lung, and muscle (snap frozen at postmortem) from two animals that died shortly after birth C244 and C261 (mtDNA^R), C236 (mtDNA⁺), which aborted at approximately day 128 and A088 (mtDNA^R), which died from noncloning related reasons at 6 months of age, using the Rotorgene-3000 real-time PCR machine. Each 20-μL reaction consisted of: 1 ng/μL gel purified PCR product, 1 × Buffer (Abgene), 1.8 mM MgCl₂ (Abgene), 200 μM each dNTP (Chemicon International, Temecula, CA, USA), 0.0125 pM of a FAM tagged primer specific to the donor cell GAAGGTGACCAAGTTCATGCTCCCAACATATCTTATGTCTGTCC (FAM tag underlined), 0.125 pM common reverse primer (CATGCAAACGAGTACATAGT), 0.5 μL of 20 × Amplifluor SNP primer FAM (Chemicon International) and 0.5 U Thermostart DNA Polymerase (Abgene). The reaction consisted of an initial run of eight cycles to allow for determination of any background fluorescence at 95°C for 120 sec, 52°C for 15 sec, and 72°C for 10 sec, followed by 55 cycles of 95°C for 20 sec, 52°C for 15 sec, and 72°C for 10 sec where the fluorescence in the FAM channel was recorded. All samples were run alongside 10-fold dilution standards of the known molecular concentration of donor SFF1 allele (100, 10, 1, 0.1, 0.01, 0.001, and 0.0001%) and ratios of SFF1 and SFF2 (nonspecific template; 100:0; 10:90; 1:99; 0.1:99.9; 0.01:99.99; 0.001:99.999; 0.0001:99.9999) to demonstrate reaction sensitivity. The percentage of donor mtDNA present was calculated by the following formulae to determine the number of mtDNA molecules present: pmol dsDNA = (μg dsDNA × 1515)/number base pairs, followed by: Molecules mtDNA = pmol dsDNA × Avagadros constant. A value of 1515 is derived from the mean molecular weight of a nucleic acid base pair (660 Da; equal to 1515 μg).

Microsatellite analysis of cloned lambs

The offspring were genotyped using Applied Biosystems StockMarks for Cattle Genotyping Kit (PN4330663) according to the manufacturer's protocol. Microsatellite markers were evenly distributed across the genome. They were highly polymorphic and can be identified within DNA samples using PCR. The kit amplifies several microsatellite loci using fluorescent dye-labeled primers. Not all the primers amplified ovine samples but six of them were homologous to bovine loci. The PCR fragments were separated on an AB 1330 Genetic Analyzer and the results analyzed using Genemapper 3.7 software.

Statistical analysis

Statistical analysis was performed using Sigma-Stat software (Jandel Scientific, USA). Results were analyzed using chi-squared analysis (with Yates' correction). Live offspring per blastocyst data were also analyzed by Fisher's exact test. A probability value of <0.05 was considered as of statistical significance.

Results

Depletion of mtDNA in donor cells and development of somatic cell nuclear transfer (SCNT) embryos

Following 14 days in culture the mtDNA content of cells treated with 50 ng/mL EthBr was reduced to 1.05% mtDNA (mtDNA^R) of that found in time-matched controls (untreated cells; mtDNA⁺) (Fig. 1A). SCNT carried out with age-matched mtDNA^R and mtDNA⁺ cells as nuclear donors resulted in production of 360 and 452 couplets respectively (Table 1). Following fusion and activation no statistical difference was observed in the frequency of cleavage, or development to blastocyst between groups. However, a statistically significant decrease in the frequency of fusion was observed between mtDNA^R and mtDNA⁺ groups (63.6 vs. 88.0%; p < 0.005). This decrease in fusion may relate to changes in the membrane composition or integrity due to the culture conditions. A statistical increase in pregnancy rate was observed in the mtDNA^R group (20.8 vs. 0.0%). Analysis of live lambs (Fig. 2) per blastocyst transferred was not significantly different between mtDNA^R and mtDNA⁺ groups by chi-squared analysis but was significantly increased when analyzed by Fishers' exact test (p = 0.0439). The 6.1% frequency of development to live lambs is in good agreement with previous reports (Peura et al., 2003; Wilmut et al., 1997); however, the small sample size in these studies may mask any significant differences, which the effects of mtDNA depletion may have upon development to term.

FIG. 1.

Analysis of mtDNA during depletion and in SCNT-derived offspring. (A) Depletion of mtDNA during EthBr treatment. Day 0 represents the start of treatment where cells had a full complement of mtDNA. Real-time PCR analysis was used to determine the quantity of mtDNA present in the SFF1 donor cells, as a percentage of that found in the untreated control cells. Cell number in each sample was calculated by analyzing the nuclear-encoded gene β-Actin, and mtDNA copy number per cell was determined by analyzing the mitochondrial gene ND1. Error bars represent SEM. (B) ClustalW alignment of sequences from the region of mtDNA D-loop of SFF1 donor cells and recipient oocytes used for AS-PCR. Red regions mark the AS-primers. The forward primers were designed to incorporate an SNP at their 3′ end to allow allele specific real-time to distinguish between donor cell and recipient oocyte mtDNA. The SNP site is marked in bold red type. The site at which Mse I (TTAA) digests recipient oocyte mtDNA is marked in bold black type. Product size = 47 bp.

FIG. 2.

Cloned lambs produced by SCNT from mtDNA^R (AO88, AO89) and mtDNA⁺ (AO90) donor cell lines.

Table 1.

Development of Ovine Embryos and Fetuses Produced by SCNT from mtDNA ^R and mtDNA ⁺ Donor Cells

	No. Replicates	No. Enucleated Oocytes/No. Fused	No. Cleaved (% Fused)	No. Blastocysts (% Fused) (% Cleaved)	No. Pregnancies/Recipients (%)	No. Live Lambs (% Blastocyst)
mtDNA^R	4	360/229 (63.6)^a	184 (80.3)	49 (21.4) (26.6)	5/24 (20.8)^c	3 (6.1)^e^*
mtDNA⁺	5	452/398 (88.0)^b	309 (77.6)	88 (22.1) (28.5)	0/37 (0.0)^d	0 (0.0)^f^*

mtDNA⁺(untreated cells containing a normal mtDNA complement).

mtDNA^R (cells depleted to residual levels of mtDNA by treatment with ethidium bromide).

Different superscripts within columns represent statistical difference (p < 0.005) by chi- square analysis.

Fishers exact test.

Analysis of mtDNA content of tissues from cloned fetuses and offspring

Although no live lambs were produced from untreated control cells, a single lamb (A090) was produced from mtDNA⁺ donor cells in a subsequent study (Choi et al., 2008) and this was included in the mtDNA analysis. We also included two offspring generated from mtDNA^R cells that died shortly after birth (C244 and C261) and a fetus derived from mtDNA⁺ cells that aborted at day 128 of gestation (C236). All three surviving lambs were identified as derived from the donor cells by microsatellite analysis of six loci using Stockmarks genotyping kit for cattle (Applied Biosystems PN4330663) as previously reported for Dolly (Ashworth et al., 1998) (Table 2). Sequencing of the D-loop region of the mitochondrial genome for each offspring and the donor cell line and alignment in ClustalW verified derivation by SCNT due to variation in mtDNA haplotypes between offspring and donor cells. Single nucleotide polymorphisms (SNPs) (Fig. 1B) were identified for allele-specific PCR (AS-PCR), which demonstrated that each of the offspring possessed less than the lowest standard (0.0001%) for donor cell mtDNA contribution to its total mtDNA content. For all three offspring, the calculated mean (±SEM) percentage for donor cell mtDNA present was 2.5 × 10⁻⁸ ± 3 × 10⁻⁹. Digestion of D-loop PCR product generated for each of the offspring with the restriction enzyme, Mse I (TTAA), which uniquely targets recipient oocyte mtDNA (Fig. 1B), allows any residual donor cell mtDNA persisting to be preferentially amplified by AS-PCR (St. John et al., 2000). Amplification of the resultant product again demonstrated that donor cell mtDNA was present at extremely low levels consistent with the threshold for nonspecific amplification.

Table 2.

Microsatellite Analysis of Donor Cells, Cloned Lambs and Recipient Ewes

Marker	Cell LineSFF1	LambAO88	Recipient EweC278	LambA089	Recipient EweC080	LambA090	Recipient EweC239
TGLA53	152/160	152/160	158	152/160	147/158	152/160	160
SPS115	237	237	237/243	237	237/250	237	243/252
TGLA126	127	127	118/127	127	129/131	127	131
TGLA122	160/163	160/163	141/160	160/163	135/141	160/163	135/142
ETH225	142	142	144/151	142	144	142	142/144
ETH10	207/209	207/209	207	207/209	207	207/209	207

We further probed tissues from A088 (mtDNA^R), which died after 6 months from noncloning related causes, and did not detect the presence of any donor cell mtDNA in any of the tissues (Table 3). Additional tissues from A089 (mtDNA^R) have not been analyzed as this animal is now 3 years of age and healthy. We further examined tissues from C244 and C261 and also found no trace of the residual donor cell mtDNA that had been introduced. However, the fetus C236 generated with mtDNA⁺ cells did possess detectable levels of donor cell mtDNA in heart tissue (0.02%; Table 2).

Table 3.

Allele-Specific (AS)-PCR Analysis of mtDNA from Cloned Lambs Generated Using mtDNA ^R and mtDNA ⁺ Donor Cells

Animal	Donor Cell Type	Survival	Tissue	mtDNA Composition
A089	mtDNA^R	>6 months	Blood	Homoplasmic
A090	mtDNA⁺	>6 months	Blood	Homoplasmic
A088	mtDNA^R	>6 months	Blood	Homoplasmic
			Kidney	Homoplasmic
			Liver	Homoplasmic
			Heart	Homoplasmic
			Lung	Homoplasmic
			Muscle	Homoplasmic
C244	mtDNA^R	Died shortly after birth	Kidney	Homoplasmic
			Liver	Homoplasmic
			Heart	Homoplasmic
			Lung	Homoplasmic
			Muscle	Homoplasmic
C261	mtDNA^R	Died shortly after birth	Kidney	Homoplasmic
			Liver	Homoplasmic
			Heart	Homoplasmic
			Lung	Homoplasmic
			Muscle	Homoplasmic
C236	mtDNA⁺	Spontaneous abortion ∼128 days gestation	Kidney	Homoplasmic
			Liver	Homoplasmic
			Heart	Heteroplasmic; 0.02%
			Lung	Homoplasmic

mtDNA⁺(untreated control cells containing a normal mtDNA complement).

mtDNA^R (cells depleted to residual levels of mtDNA).

Discussion

Reconstruction of an oocyte or zygote by removal and replacement of the genetic material can be accomplished at a range of developmental stages to serve a variety of purposes. Transfer of diploid embryonic or somatic nuclei into enucleated metaphase II or activated oocytes can be used to generate embryos, which can give rise to live offspring (Wilmut et al., 1997), so-called reproductive cloning, or used for the isolation of embryonic stem cells (Wakayama, 2003), so-called therapeutic cloning. Alternatively, transfer of germinal vesicle or meiotic spindles between oocytes or pronuclei between zygotes have been suggested as methods to overcome a range of fertility related problems (Bai et al., 2006; Bao et al., 2003; Wakayama et al., 2004; Wang et al., 2001). To date, all of these methods involve the transfer of the donor genetic material in association with variable amounts of the donor cytoplasm (karyoplast) to the enucleated recipient (cytoplast), thereby mixing donor and recipient mtDNAs. Analysis of the mtDNA content in offspring produced by SCNT has revealed varying contributions with 0 to 59% of the offspring's total mtDNA content being donor cell in origin (St. John et al., 2004). Similarly, variable contributions have been reported in mice in several studies involving the transfer of donor cytoplasm (5–80%) (Jenuth et al., 1996; Laipis, 1996) or pronuclei (0–69%) (Meirelles and Smith, 1997). Although the mtDNA content of embryos and offspring was not reported in early studies of spindle transfer in both cattle (Bao et al., 2003) and mice (Bai et al., 2006; Wakayama et al., 2004; Wang et al., 2001), a recent report in primates suggests that spindle-associated mtDNA is not transmitted to the resultant offspring, and that this technique would be an appropriate assisted reproductive technology for those women who are carriers of mtDNA disease (Tachibana et al., 2009). However, it has yet to be clearly demonstrated that no mtDNA is transferred with the spindle. Consequently, as mtDNA is randomly segregated during gastrulation, assumptions that karyoplast mtDNA has been eliminated must be supported by the analysis of karyoplasts and their accompanying mtDNA content and several tissue types at a high degree of sensitivity, which will often indicate the necessity for prescribed elimination of karyoplast mtDNA if homoplasmy is to be achieved.

In this respect, the analysis of mtDNA in peripheral blood from Dolly and her fellow sheep clones detected only recipient oocyte mtDNA (Evans et al., 1999). This observation, when coupled with results in other species (Steinborn et al., 1998, 2002; Takeda et al., 2003, 2006) prompted speculation as to whether mtDNA transmission may be technique or species specific. However, we demonstrated that donor cell mtDNA did persist to the blastocyst stage in sheep preimplantation embryos (Lloyd et al., 2006) and a subsequent report on tissues from the sheep analyzed with Dolly demonstrated that some were heteroplasmic for donor cell mtDNA with variable contributions (Burgstaller et al., 2007). In one offspring, heteroplasmy between tissues ranged from 6.8 to 46.5%, which is similar to levels reported in both pigs (Takeda et al., 2006) and cattle (Takeda et al., 2003). In this study, we have demonstrated that two 6-month-old sheep generated with mtDNA^R cells were homoplasmic for donor cell mtDNA in isolated peripheral blood cells and confirmed for one of these animals, and two others that died shortly after birth, that none of a range of tissues analyzed possessed any donor cell mtDNA. In contrast, an animal generated with mtDNA⁺ donor cells was heteroplasmic.

The mechanisms, which control the random transmission and subsequent segregation of somatic mtDNA following SCNT, are presently unknown. One contributing factor may be the number of copies in the donor cell—larger donor cells having more copies and therefore a greater degree of transmission. This is partially supported by studies in cattle using embryonic blastomeres, where smaller blastomeres have fewer copies and lower rates of transmission; however, there are exceptions (Steinborn et al., 1998). An additional or alternative explanation is the continued expression of donor cell mtDNA-specific replication factors such as DNA Polymerase Gamma and mitochondrial transcription factor A, which are upregulated in ovine SCNT-derived preimplantation embryos (Bowles et al., 2007b). These factors would preferentially transcribe and amplify their own mitochondrial genome during the first few divisions of the preimplantation embryo due to its close proximity to the nucleus. This preferential replication would increase following embryonic genome activation fixing the donor mtDNA population into the offspring's genetic composition (Bowles et al., 2007b). This could also account for the persistence of karyoplast mtDNA accompanying the germinal vesicle and pronuclei and the persistence of sperm mtDNA that contributed to the two donor blastomeres, which generated the only two nonhuman cloned primates (Macaca mulatta) (St. John and Schatten, 2004).

The degree of mtDNA genetic distance between the donor cell and recipient oocyte is also an important criterion in successful embryo and fetal development. In the ovine model, intra- and interspecific blastocysts have been generated within a genetic distance of 0.0022–0.0391%. However, when the genetic distance was increased, as in a goat–sheep interspecies model (mean = 0.4114%), development arrested at the time that activation of the embryonic genome should occur (Bowles et al., 2007b). Similar outcomes have been observed in cattle, where the mean mtDNA genetic distance between the donor cell and recipient oocyte that developed to blastocyst is 0.051 ± 0.006% (Bowles et al., 2007a). In the animals produced here, the genetic distance between the donor and recipient mtDNAs is 0.0097 (AO88), 0.0156 (AO89), and 0.0157 (AO90)%; these not only fall within our previously reported range that support development in sheep SCNT (0.0022–0.0391%) but are not too divergent suggesting that the small degree of genetic distance is compatible for efficient electron transfer chain function and offers the possibility of introducing hybrid vigor into the offspring (Bowles et al., 2008). Typically for SCNT, recipient oocytes are not selected on genetic compatibility to the donor cell. Consequently, nonmatching of mtDNA variants from different breeds within a species could result in differing amino acids being synthesized, as predicted for interspecific SCNT in pigs (St. John et al., 2005) and cattle (Steinborn et al., 2002), and thus affect electron transfer chain function. Therefore, success in the cloning process may require both depletion of donor cell/karyoplast mtDNA, thus eliminating conflict between the two populations and also selection of compatible oocytes, which may not be direct mtDNA descendents. These outcomes will also have important consequences for spindle and pronuclear transfer if they are to be used to treat human mtDNA disease as selection of more genetically diverse cytoplasts may or may not result in the nontransmission of mutant mtDNA but mediate nucleo-mtDNA conflict. Equally so, as the oocyte's cytoplasm mediates programming of the embryonic genome, more diverse fusions may result in epigenetic outcomes similar to those observed following other assisted reproductive technologies (Cox et al., 2002; DeBaun et al., 2003; Gicquel et al., 2003; Orstavik et al., 2003).

Footnotes

Acknowledgments

We thank David Edwards, Michael Baker, and Donna Schofield for assistance with animal husbandry and embryo transfer. This work was supported by University of Nottingham, The Medical School postgraduate program at The University of Birmingham, and a Lachesis Research and Development Grant awarded to K.C. and J.St.J.

Author Disclosure Statement

Drs. St. John and Campbell are inventors of a patent: Cloning methods and other methods of producing cells, Number WO03/057863.

Present address for Joon-Hee Lee: Animal Development and Biotechnology Group, Division of Applied Life Science, College of Agriculture and Life Science, Gyeongsang National University, Jinju, South Korea.

Present address for Amy Peters: Birmingham Clinical Trials Unit, School of Cancer Sciences, University of Birmingham, Robert Aitken Institute, Edgbaston, Birmingham, B15 2TT, UK.

Present address for Justin C. St. John: Centre for Reproduction and development, Monash Institute of Medical Research, 27-31 Wright Street, Clayton, 3168, Victoria, Australia.

References

Amaral

, Ramalho-Santos

, St. John

J.C.

2007. The expression of polymerase gamma and mitochondrial transcription factor A and the regulation of mitochondrial DNA content in mature human sperm. Hum. Reprod., 22:1585–1596.

Anderson

, Bankier

A.T.

, Barrell

B.G.

et al. 1981. Sequence and organization of the human mitochondrial genome. Nature, 290:457–465.

Ashworthm

, Bishop

, Campbell

K.H.S.

et al. 1998. DNA microsatellite analysis of Dolly. Nature, 394:329.

Bai

Z.D.

, Liu

, Wang

X.Y.

2006. Developmental potential of aged oocyte rescued by nuclear transfer following parthenogenetic activation and in vitro fertilization. Mol. Reprod. Dev., 73:1448–1453.

Bao

, Ushijima

, Hirose

et al. 2003. Development of bovine oocytes reconstructed with a nucleus from growing stage oocytes after fertilization in vitro. Theriogenology, 59:1231–1239.

Bowles

E.J.

, Campbell

K.H.

, St. John

J.C

. 2007a. Nuclear transfer: preservation of a nuclear genome at the expense of its associated mtDNA genome(s) Curr. Top. Dev. Biol., 77:251–290.

Bowles

E.J.

, Lee

J.H.

, Alberio

et al. 2007b. Contrasting effects of in vitro fertilization and nuclear transfer on the expression of mtDNA replication factors. Genetics, 176:1511–1526.

Bowles

E.J.

, Tecirlioglu

R.T.

, French

A.J.

et al. 2008. Mitochondrial DNA transmission and transcription after somatic cell fusion to one or more cytoplasts. Stem Cells, 26:775–782.

Bruggerhoff

, Zakhartchenko

, Wenigerkind

et al. 2002. Bovine somatic cell nuclear transfer using recipient oocytes recovered by ovum pick-up: effect of maternal lineage of oocyte donors. Biol. Reprod., 66:367–373.

10.

Burgstaller

J.P.

, Schinogl

, Dinnyes

et al. 2007. Mitochondrial DNA heteroplasmy in ovine fetuses and sheep cloned by somatic cell nuclear transfer. BMC. Dev. Biol., 7:141.

11.

Campbell

K.H.

, McWhir

, Ritchie

W.A.

et al. 1996. Sheep cloned by nuclear transfer from a cultured cell line. Nature, 380:64–66.

12.

Cao

, Shitara

, Horii

et al. 2007. The mitochondrial bottleneck occurs without reduction of mtDNA content in female germ cells. Nat. Genet., 39:386–390.

13.

Choi

, Lee

J.-H.

, Fisher

et al. 2008. Nuclear reprogramming and embryonic and fetal development of cloned ovine embryos produced using caffeine-treated oocytes as cytoplast recipients. Reprod. Fertil. Dev., 20:93–94.

14.

Cibelli

J.B.

, Campbell

K.H.S.

, Seidel

G.E.

et al. 2002. The health profile of cloned animals. Nat. Biotechnol., 20:13–14.

15.

Cox

G.F.

, Burger

, Lip

et al. 2002. Intracytoplasmic sperm injection may increase the risk of imprinting defects. Am. J. Hum. Genet., 71:162–164.

16.

Cree

L.M.

, Samuels

D.C.

, Cuva da Sousa Lopes

et al. 2008. A reduction of mitochondrial DNA molecules during embryo genesis explains the rapid segregation of genotypes. Nat. Genet., 40:249–254.

17.

Dai

J.G.

, Wei

, Xiao

Y.B.

2001. The study of genetic variability of mtDNA in common laboratory inbred strains of mice. Yi Chuan Xue Bao, 28:115–119.

18.

DeBaun

M.R.

, Niemitz

E.L.

, Feinberg

A.P.

2003. Association of in vitro fertilization with Beckwith-Wiedemann syndrome and epigenetic alterations of LIT1 and H19. Am. J. Hum. Genet., 72:156–160.

19.

Evans

M.J.

, Gurer

, Loike

J.D.

et al. 1999. Mitochondrial DNA genotypes in nuclear transfer-derived cloned sheep. Nat. Genet., 23:90–93.

20.

Felsenstein

2006. PHYLIP (Phylogeny Inference Package) version 3.6. http://evolution.genetics.washington.edu/phylip/doc/main.html. 2006 May .

21.

Gicquel

, Gaston

, Mandelbaum

et al. 2003. In vitro fertilization may increase the risk of Beckwith-Wiedemann syndrome related to the abnormal imprinting of the KCN1OT gene. Am. J. Hum. Genet., 72:1338–1341.

22.

Hall

V.J.

, Ruddock

N.T.

, Cooney

M.A.

et al. 2006. Production of a cloned calf using zona-free serial nuclear transfer. Theriogenology, 65:424–440.

23.

Hiendleder

2007. Mitochondrial DNA inheritance after SCNT. Adv. Exp. Med. Biol., 591:103–116.

24.

Hiendleder

, Mainz

, Plante

et al. 1998. Analysis of mitochondrial DNA indicates that domestic sheep are derived from two different ancestral maternal sources: no evidence for contributions from urial and argali sheep. J. Hered., 89:113–120.

25.

Hiendleder

, Schmutz

S.M.

, Erhardt

et al. 1999. Transmitochondrial differences and varying levels of heteroplasmy in nuclear transfer cloned cattle. Mol. Reprod. Dev., 54:24–31.

26.

Jenuth

J.P.

, Peterson

A.C.

, Fu

et al. 1996. Random genetic drift in the female germline explains the rapid segregation of mammalian mitochondrial DNA. Nat. Genet., 14:146–151.

27.

Kaneda

, Hayashi

, Takahama

et al. 1995. Elimination of paternal mitochondrial DNA in intraspecific crosses during early mouse embryogenesis. Proc. Natl. Acad. Sci. USA, 92:4542–4546.

28.

King

M.P.

, Attardi

1996. Isolation of human cell lines lacking mitochondrial DNA. Methods Enzymol., 264:304–313.

29.

Kragh

P.M.

, Vajta

, Corydon

T.J.

et al. 2004. Production of transgenic porcine blastocysts by hand-made cloning. Reprod. Fertil. Dev., 16:315–318.

30.

Kurome

, Hisatomi

, Matsumoto

et al. 2008. Production efficiency and telomere length of the cloned pigs following serial somatic cell nuclear transfer. J. Reprod. Dev., 54:254–258.

31.

Laipis

P.J.

1996. Construction of heteroplasmic mice containing two mitochondrial DNA genotypes by micromanipulation of single-cell embryos. Methods Enzymol., 264:345–357.

32.

Lloyd

R.E.

, Lee

J.H.

, Alberio

et al. 2006. Aberrant nucleo-cytoplasmic cross-talk results in donor cell mtDNA persistence in cloned embryos. Genetics, 172:2515–2527.

33.

Meirelles

F.V.

, Smith

L.C.

1997. Mitochondrial genotype segregation in a mouse heteroplasmic lineage produced by embryonic karyoplast transplantation. Genetics, 145:445–451.

34.

Meirelles

F. V.

, Bordignon

, Watanabe

et al. 2001. Complete replacement of the mitochondrial genotype in a Bos indicus calf reconstructed by nuclear transfer to a Bos taurus oocyte. Genetics, 158:351–356.

35.

Ono

, Shimozawa

, Ito

et al. 2001. Cloned mice from fetal fibroblast cells arrested at metaphase by a serial nuclear transfer. Biol. Reprod., 64:44–50.

36.

Orstavik

K.H.

, Eiklid

, van der Hagen

C.B.

et al. 2003. Another case of imprinting defect in a girl with Angelman syndrome who was conceived by intracytoplasmic semen injection. Am. J. Hum. Genet., 72:218–219.

37.

Peura

T.T.

, Lewis

I.M.

, Trounson

A.O.

1998. The effect of recipient oocyte volume on nuclear transfer in cattle. Mol. Reprod. Dev., 50:185–191.

38.

Peura

T.T.

, Hartwich

K.M.

, Hamilton

H.M.

et al. 2003. No differences in sheep somatic cell nuclear transfer outcomes using serum-starved or actively growing donor granulosa cells. Reprod. Fertil. Dev., 15:157–165.

39.

Polejaeva

I.A.

, Chen

S.H.

, Vaught

T.D.

et al. 2000. Cloned pigs produced by nuclear transfer from adult somatic cells. Nature, 407:86–90.

40.

Schwartz

, Vissing

2002. Paternal inheritance of mitochondrial DNA. N. Engl. J. Med., 347:576–580.

41.

Shoubridge

E.A.

, Wai

2007. Mitochondrial DNA and the mammalian oocyte. Curr. Top. Dev. Biol., 77:87–111.

42.

Smith

L.C.

, Thundathil

, Filion

2005. Role of the mitochondrial genome in preimplantation development and assisted reproductive technologies. Reprod. Fertil. Dev., 17:15–22.

43.

Spikings

E.C.

, Alderson

, John

J.C.

2007. Regulated mitochondrial DNA replication during oocyte maturation is essential for successful porcine embryonic development. Biol. Reprod., 76:327–335.

44.

St. John

J.C.

, Schatten

2004. Paternal mitochondrial DNA transmission during nonhuman primate nuclear transfer. Genetics, 167:897–905.

45.

St. John

, Sakkas

, Dimitriadi

et al. 2000. Failure of elimination of paternal mitochondrial DNA in abnormal embryos. Lancet, 355:200.

46.

St. John

J.C.

, Lloyd

R.E.

, Bowles

E.J.

et al. 2004. The consequences of nuclear transfer for mammalian foetal development and offspring survival. A mitochondrial DNA perspective. Reproduction, 127:631–641.

47.

St. John

J.C.

, Moffatt

, D'Souza

2005. Aberrant heteroplasmic transmission of mtDNA in cloned pigs arising from double nuclear transfer. Mol. Reprod. Dev., 72:450–460.

48.

Steinborn

, Zakhartchenko

, Wolf

et al. 1998. Non-balanced mix of mitochondrial DNA in cloned cattle produced by cytoplast–blastomere fusion. FEBS Lett., 426:357–361.

49.

Steinborn

, Schinogl

, Wells

D.N.

et al. 2002. Coexistence of Bos taurus and B. indicus mitochondrial DNAs in nuclear transfer-derived somatic cattle clones. Genetics, 162:823–829.

50.

Sutovsky

, Moreno

R.D.

, Ramalho-Santos

et al. 1999. Ubiquitin tag for sperm mitochondria. Nature, 402:371–372.

51.

Tachibana

, Sparman

, Sritanaudomchai

et al. 2009. Mitochondrial gene replacement in primate offspring and embryonic stem cells. Nature, 460:367–372.

52.

Takeda

, Akagi

, Kaneyama

et al. 2003. Proliferation of donor mitochondrial DNA in nuclear transfer calves (Bos taurus) derived from cumulus cells. Mol. Reprod. Dev., 64:429–437.

53.

Takeda

, Tasai

, Iwamoto

et al. 2005. Microinjection of cytoplasm or mitochondria derived from somatic cells affects parthenogenetic development of murine oocytes. Biol. Reprod., 72:1397–1404.

54.

Takeda

, Tasai

, Iwamoto

et al. 2006. Transmission of mitochondrial DNA in pigs and progeny derived from nuclear transfer of Meishan pig fibroblast cells. Mol. Reprod. Dev., 73:306–312.

55.

Thompson

J.D.

, Higgins

D.G.

, Gibson

T.J.

1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids. Res., 22:4673–4680.

56.

Vajta

, Bartels

, Joubert

et al. 2004. Production of a healthy calf by somatic cell nuclear transfer without micromanipulators and carbon dioxide incubators using the Handmade Cloning (HMC) and the Submarine Incubation System (SIS) Theriogenology, 62:1465–1472.

57.

Wakayama

, Thuan

N.V.

, Kishigami

et al. 2004. Production of offspring from one-day-old oocytes stored at room temperature. J. Reprod. Dev., 50:627–637.

58.

Wakayama

2003. Cloned mice and embryonic stem cell lines generated from adult somatic cells by nuclear transfer. Oncol. Res., 13:309–314.

59.

Wallace

D.C.

1999. Mitochondrial diseases in man and mouse. Science, 283:1482–1488.

60.

Wang

M.K.

, Chen

D.Y.

, Liu

J.L.

et al. 2001. In vitro fertilisation of mouse oocytes reconstructed by transfer of metaphase II chromosomes results in live births. Zygote, 9:9–14.

61.

Wilmut

, Schnieke

A.E.

, McWhir

et al. 1997. Viable offspring derived from fetal and adult mammalian cells. Nature, 385:810–813.