Effects of Histone Acetylation Status on the Early Development of In Vitro Porcine Transgenic Cloned Embryos

Abstract

The purpose of this study was to investigate the effects of the histone deacetylase (HDAC) inhibitor trichostatin A (TSA) on transgene expression and development of porcine transgenic cloned embryos, specifically focusing on effects derived from TSA-treated donor cells or TSA-treated reconstructed embryos. The results showed that TSA treatment on reconstructed embryos modified the acetylation status, which significantly improved the development of porcine somatic cell nuclear transfer (SCNT) embryos in vitro, but not donor cells. Furthermore, the treatment of reconstructed embryos with TSA enhanced expression of the pluripotency-related gene POU5F1 and stimulated expression of the anti-apoptotic gene BCL-2. Enhanced green fluorescent protein (EGFP) mRNA expression of every group dropped drastically from donor cells to blastocysts. Interestingly, TSA is likely to prevent a decline in EGFP expression in nuclear reprogramming of porcine SCNT embryos. However DNA hypomethylation induced by modified histone acetylation of donor cells treated with TSA was significantly more effective in increasing EGFP expression in SCNT blastocysts. In conclusion, the acetylation status of both donor cells and reconstructed embryos modified by TSA treatment increased transgene expression and improved nuclear reprogramming and the developmental potential of porcine transgenic SCNT embryos.

Introduction

Genetically modified donor cells make it possible to produce transgenic animals via somatic cell nuclear transfer (SCNT), which has greatly facilitated our understanding of gene function and generated models for the study of human xenotransplantation and diseases. However, in most cases, transgene silencing often occurs with time in stably transfected cells and transgenic animals (Houdebine, 2000; Migliaccio et al., 2000; Yamauchi et al., 2007), creating a major limitation in the production of transgenic animals. Results of earlier studies have demonstrated that gene silencing is caused by DNA methylation and histone hypoacetylation (Bhaumik et al., 2007; Jenuwein and Allis, 2001; Swindle and Klug, 2002). It is known that DNA methylation of CpG islands located in the promoter is involved in the formation of compacted chromatin to repress gene expression (Esteller and Herman, 2002; Miranda and Jones, 2007). It is also well established that histone hypoacetylation can influence transcription by forming chromatin condensation structures and prevent transcription factors from binding. This occurs particularly in the promoter regions, which can regulate gene expression (Duncan et al., 2008; Kouzarides, 2007; Lee et al., 2007; Li et al., 2008a). Thus, the level of the DNA methylation and histone acetylation can serve as an indicator of gene activity (Grassi et al., 2003). On the other hand, low cloning efficiency is a significant barrier to the application of SCNT technology. It is generally believed that low cloning efficiency is mostly attributed to incomplete nuclear reprogramming of the donor cells. In addition, various epigenetic modifications, such as DNA methylation and histone modification, play a key role in improving the cloning efficiency in the nuclear reprogramming process (Su et al., 2011). Hence, prevention of abnormal epigenetic reprogramming may improve cloning success rate in animals.

Recent reports suggested that trichostatin A (TSA), an inhibitor of histone deacetylase (HDAC), not only reactivates transgene expression in transgenic cells (Kong et al., 2011) and increases the percentage of enhanced green fluorescent protein (EGFP)-positive morulae (Bo et al., 2011), but it also significantly improves in vitro and full-term development of SCNT embryos (Costa-Borges et al., 2010; Ding et al., 2008; Kishigami et al., 2006; Maalouf et al., 2009; Zhang et al., 2007). However, the effect of TSA-treated preimplantation SCNT embryos in vitro on transgene expression is unclear. In addition, the cloning efficiency of SCNT embryos derived from TSA-treated donor cells is controversial. Some reports showed that TSA-treated donor cells had no effect on embryonic development in bovine SCNT embryos (Shi et al., 2003), whereas other reports explained that TSA-treated donor cells did increase bovine SCNT blastocyst development compared with controls (Enright et al., 2003; Jafarpour et al., 2011). In pigs, although similar results were reported after reconstructed embryos were treated with TSA (Cervera et al., 2009; Li et al., 2008b; Zhang et al., 2007), no report about cloning efficiency of porcine SCNT embryos derived from TSA-treated donor cells has been evaluated systemically.

Taken together, we intend here to investigate whether histone acetylation of TSA-treated donors or TSA-treated reconstructed embryos affects transgene expression and embryonic development in porcine transgenic cloned embryos. The reporter gene EGFP has been successfully used as a marker without any adverse biological effects on development in vitro of transfected embryos and animals (Chan et al., 2001; Hyun et al., 2003; Park et al., 2001; Takada et al., 1997). Therefore, the objective of these experiments was to systemically assess the role of histone acetylation during the early development of in vitro porcine transgenic cloned embryos via observation of the effects of TSA on EGFP expression and embryonic development, and thus decipher the imminent correlation of transgene expression regulation and embryonic development with histone acetylation in vitro.

Materials and Methods

All chemicals were purchased from Sigma-Aldrich unless otherwise stated.

Preparation of nuclear donor cells

Porcine fetal fibroblast (PFF) cell lines were isolated from porcine fetuses on day 35 of gestation and cultured in vitro as previously reported (Lai and Prather, 2003). Before transfection, PFF cells were seeded in a 12-well plate with cell culture medium Dulbecco's Modified Eagle Medium (DMEM) supplemented with 15% (vol/vol) fetal bovine serum (FBS; Gibco), 100 IU/mL penicillin, and 100 μg/mL streptomycin at 38.5°C in 5% CO₂ with humidity air to reach 70–80% confluency on the day of transfection. PFF cells in each well were transfected with 1 μg of pEGFP-N1 and 10 μL of FuGENE^® HD transfection reagent (Roche) following the manufacturer's protocol. After 24 h, transfected cells were observed under a fluorescence microscope and then passed in a culture dish. After 24 h of culture, cells were selected with G418 (600 μg/mL; Invitrogen). After culture for 7–10 days, G418-resistant cell colonies expressing EGFP, as assessed by fluorescence microscopy, were isolated separately. Each single colony was seeded separately in cell culture medium with G418 (300 μg/mL) to expand the stable integrated cell population, and then cryopreserved in liquid nitrogen for further use in SCNT (Luo et al., 2013).

Oocyte collection and in vitro maturation

Collection and in vitro maturation (IVM) of pig oocytes were conducted as previously described (Wu et al., 2006). Porcine ovaries were collected from a local slaughterhouse and transported to the laboratory in physiological saline solution with antibiotics at 37°C within 2 h. Cumulus–oocyte complexes (COCs) from follicles between 2 and 5 mm in diameter were aspirated with a sterile syringe. The COCs with three or more layers of compact cumulus cells were chosen for the experiments. The IVM medium of oocyte was Tissue Culture Medium-199 (TCM-199; Gibco BRL) supplemented with 3.05 mM d-glucose, 0.91 mM sodium pyruvate, 0.1% polyvinyl alcohol (PVA; wt/vol), 0.1 mg/mL cysteine, 10 IU/mL human chorionic gonadotropin (hCG; Ningbo Hormonal Reagents Co., Ltd, Zhejiang, China), 10 IU/mL pregnant mare serum gonadotropin (PMSG; Tianjin Huafu High & New Biotech Co., Tianjin, China), 10 ng/mL epidermal growth factor (EGF), penicillin (75 mg/mL) and streptomycin (50 mg/mL), and 10% (vol/vol) porcine follicular fluid (pFF, self-made).

Each group of 80–100 COCs was transferred into one well of a four-well multidish (Nunclon, Roskilde, Denmark) containing 500 μL IVM medium pre-equilibrated for at least 4 h, and then cultured at 38.5°C in 5% CO₂ (100% humidity in air). After 22 h, the COCs were transferred into IVM medium without PMSG and hCG and cultured for another 20 h under the same conditions. The matured COCs were treated with 1 mg/mL hyaluronidase solution for 5 min to remove cumulus cells by repeated pipetting. Oocytes that had attained metaphase II (MII) with intact cell membrane, uniform cytoplasm, and first polar body (PBI) extruded into the perivitelline space were selected for further SCNT operations.

Nuclear transfer and culture of SCNT embryos

The nuclear donor cells derived from the same single colony were thawed, cultured routinely, and then trypsinized to harvest single cells. SCNT procedures were conducted as previously described (Ju et al., 2010; Luo et al., 2013). Briefly, all manipulations were performed in microdrops of HEPES-buffered TCM-199 medium supplemented with 0.3% bovine serum albumin (BSA) and 7.5 μg/mL cytochalasin B covered with mineral oil. The PBI together with 10–20% of its adjacent cytoplasm of the oocytes were removed by aspiration with an enucleation pipette. Afterward, a single intact fluorescent cell was injected into the perivitelline space through the same slit and placed adjacent to the recipient cytoplasm. After three washes in fresh warm Porcine Zygote Medium-3 (PZM-3) (Yoshioka et al., 2002) with 3 mg/mL BSA, the reconstructed oocytes were placed into overnight-equilibrated PZM-3 for 1.5 h until fusion and activation.

Fusion and activation were accomplished simultaneously with a single direct current (DC) pulse of 1.5 kV/cm for 40 μsec provided by an Electro Cell Manipulator (CRY-3, Ningbo Xinzhi Co., Ltd., Ningbo, China) in fusion medium (consisting of 0.5 mM HEPES, 0.3 M mannitol, 1.0 mM CaCl₂, and 0.1 mM MgCl₂). Subsequently, after three washes, the reconstructed oocytes were incubated in PZM-3 for 30 min and then evaluated for fusion under an inverted fluorescence microscope. Only fused embryos expressing EGFP were cultured further; each group of 30–50 embryos was placed into one well of a four-well cell culture plate containing 500 μL PZM-3 under mineral oil and cultured at 38.5°C and in 5% CO₂ with 100% humidity air for 7 days after activation.

TSA treatment

Transgenic donor cells before nuclear transfer and cloned embryos after activation were treated with or without 50 nM TSA for 24 h (Bo et al., 2011; Zhang et al., 2007). In group A, donor cells were treated with TSA; in group B, reconstructed embryos were treated with TSA; and in group C, both donor cells and reconstructed embryos were treated with TSA. Group D was the control without TSA treatment for both donor cells and reconstructed embryos.

Sampling and immunostaining

All steps were performed at room temperature unless otherwise stated. Embryos were washed three times (5 min each) in Dulbecco's phosphate-buffered saline (DPBS) containing 0.2% PVA and fixed in 4% paraformaldehyde for 20 min.

Embryos were permeabilized with 0.2% Triton X-100 in DPBS for 30 min. After three washes, they were blocked in the immunostaining blocking solution (Beyotime, P0102) for 12 h at 4°C and then incubated with the primary antibodies (ab10812, diluted 1:500; Abcam) against acetylated histone H3 acetyl K9 (AcH3K9) for 12 h at 4°C. After three washes, the embryos were treated with the secondary antibodies (diluted 1:500) of Alexa Fluor 488-labeled goat anti-rabbit immunoglobulin G (IgG) (Beyotime, A0423) for AcH3K9. Finally, the DNA was stained with 10 μg/mL Hoechst 33342 in darkness for 10 min. Samples were mounted on glass slides with a drop of antifade polyvinylpyrrolidone mounting medium (Beyotime). Subsequently, a coverslip was gently pressed to stretch the cells, which were observed and photographed under an inverted fluorescence microscope. The experiments were replicated three times. In each replication, five embryos per group were processed. The averaged intensity per embryo of AcH3K9 was analyzed by the ratios of AcH3K9 to Hoechst 33342 DNA signals using an image analyzer system, Image-Pro Plus (Media Cybernetics, Bethesda, MD), as described previously (Cervera et al., 2009; Li et al., 2008b; Su et al., 2011; Yamanaka et al., 2009).

Real-time PCR

Total RNA was extracted from 30–50 embryos pooled in each group using TRIzol reagent (Invitrogen), according to the manufacturer's instructions. RNA from each sample was converted to cDNA by using PrimeScript™ RT Master Mix (TaKaRa) according to manufacturer's instructions. Real-time PCR was performed using the SYBR Premix Ex Taq™ (TaKaRa) and the 7300 Real-Time PCR System (Applied Biosystems), as previously described (Ju et al., 2010), with the following parameters: 95°C for 30 sec, followed by 40 cycles at 95°C for 5 sec and at 60°C for 31 sec. For each cDNA sample, both target and reference genes were amplified independently on the same plate, and the same experiment was run in triplicate. Primer sequences, the size of amplified products, and the GenBank accession numbers are shown in Table 1.

Table 1.

Primers for Real-Time PCR

Gene	Primer sequences (5′ to 3′)	Product size (bp)
EGFP	F: TGAACCGCATCGAGCTGAAGGG	110
	R: ACCTTGATGCCGTTCTTCTGCTTG
HDAC1	F: GTTGGAAGGGCTGATGTG	124
	R: TGCTCGCTGCTGGACTTA
DNMT1	F: TCGAACCAAAACGGCAGTAGT	215
	R: CGGTCAGTTTGTGTTGGAGAAG
POU5F1	F: GAAGGTGTTCAGCCAAACGAC	185
	R: CGATACTTGTCCGCTTTC
BCL2	F: GCAACCCATCCTGGCACCT	133
	R: AACTCATCGCCCGCCTCCCT
ACTB	F: GAGAAGCTCTGCTACGTCG	255
	R: CCAGACAGCACCGTGTTGG

F, forward; R, reverse.

Statistical analysis

All experiments were repeated at least three times. Data for cleavage rate, blastocyst rate expressed as percentages, and cell number per blastocyst were presented as mean±standard error of the mean (SEM) values. The percentages were subjected to an arc–sine transformation. All data were analyzed with SPSS (Statistics Production for Service Solution, Version 19.0) using analysis of variance (ANOVA). Comparisons of mean values among treatments were performed using a multiple comparison test. Differences were considered significant when p<0.05.

Results

Histone acetylation status modified by TSA treatment improved the development of porcine transgenic cloned embryos in vitro

To assess whether modification of histone acetylation of donor cells or reconstructed embryos treated with TSA could improve in vitro preimplantation developmental competence, cleavage rates, blastocyst rates, and average cell number per blastocyst of transgenic cloned embryos were measured. The AcH3K9 levels were evaluated by fluorescent signal strength, and the histone deacetylase gene HDAC1 was detected by real-time PCR among all TSA treatment groups.

As shown in Table 2, no significant differences were observed in cleavage rates and average cell numbers per blastocyst of transgenic cloned embryos among all TSA treatment groups (p>0.05). However, the transgenic cloned blastocyst rates of groups C (35.8%) and B (33.0%) were significantly higher than group A (15.8%) and the control (20.1%; p<0.05). AcH3K9 levels of groups B and C at the two-cell stage were significantly higher than group A and the control (Fig. 1). However, at the blastocyst stage, no differences in AcH3K9 levels were observed among groups. HDAC1 mRNA expression of groups B and C showed a statistically lower level of expression at the two-cell stage (Fig. 2) than those from other groups. These results suggest that acetylation status of reconstructed embryos with TSA treatment could improve porcine preimplantation development in vitro.

FIG. 1.

AcH3K9 levels in SCNT embryos with different TSA treatment at the two-cell and blastocyst stages. (A) Staining of AcH3K9 in SCNT embryos. Embryos were immunostained with anti-histone H3 (acetyl K9) antibody (green). The DNA was counterstained with Hoechst 33342 (blue). Original magnification, 200×. (B) Comparison of AcH3K9/DNA intensity among SCNT embryos. Quantification of the AcH3K9/DNA signal ratio is represented as the mean±SEM. Different superscripts indicate significant differences (p<0.05). Group A was donor cells treated with TSA, group B was reconstructed embryos treated with TSA, group C was both donor cells and reconstructed embryos treated with TSA, and control was no treatment of donor cells or reconstructed embryos.

FIG. 2.

Relative mRNA level of HDAC1 among SCNT embryos. Different superscripts indicate significant differences (p<0.05).

Table 2.

Effect of Trichostatin A on the In Vitro Development of Porcine Transgenic Cloned Embryos

Group	No. embryos cultured	No. embryos cleaved (%)	No. blastocysts (%)	Total cell number in blastocyst (mean±SEM)
A	284	209 (73.6%)	45 (15.8%)^a	44.5±3.2^a
B	218	176 (80.7%)	72 (33.0%)^b	47.5±6.1^a
C	232	185 (79.7%)	83 (35.8%)^b	50.0±1.1^a
D (control)	249	188 (75.5%)	50 (20.1%)^a	42.8±6.3^a

Group A was donor cells treated with TSA, group B was reconstructed embryos treated with TSA, group C was both donor cells and reconstructed embryos treated with TSA, and control was no treatment of donor cells or reconstructed embryos. Every group was replicated three times. Different superscripts in the same column indicate significant differences (p<0.05).

SEM, standard error of the mean.

TSA treatments enhanced the expression of anti-apoptosis and development-related genes of porcine transgenic cloned embryos

To decipher the effects of acetylation status with TSA treatment on development of porcine transgenic cloned embryos, the relative mRNA expression levels of the pluripotency-related gene POU5F1 and anti-apoptosis gene BCL2 were analyzed by real-time PCR.

As shown in Figure 3, POU5F1 mRNA expression in groups B and C at four-cell and blastocyst stages was significantly higher than that of group A and the control. TSA treatment increased BCL2 levels at the four-cell stage compared with the control (Fig. 3). However, BCL2 mRNA expression in groups B and C at the blastocyst was significantly higher than that of group A and the control. These results suggest that treatment of reconstructed embryos with TSA enhances expression of the pluripotency-related gene POU5F1 and stimulates expression of the anti-apoptotic gene BCL2.

FIG. 3.

Comparative relative mRNA expression levels of POU5F1 (A) and BCL2 (B) at various developmental stages among all TSA treatment. Different superscripts indicate significant differences.

DNA hypomethylation induced by TSA treatment resulted in histone acetylation status and thus increased transgene expression of porcine transgenic cloned embryos

To investigate the regulatory mechanisms behind transgene expression and DNA methylation induced by modification on histone acetylation of donor cells or reconstructed embryos caused by TSA treatment, the relative mRNA expression levels of EGFP gene and the DNA methylation-related gene DNA methyltransferase (DNMT1) were measured by real-time PCR.

As shown in Figure 4, EGFP mRNA expression in donor cells with TSA treatment was significantly higher than the control without TSA treatment (p<0.05). Surprisingly, EGFP mRNA expression of every group drastically dropped from donor cells to blastocysts. However, EGFP mRNA expression at the blastocyst stage with TSA treatment was significantly higher than that without TSA treatment (p<0.05). EGFP mRNA expression analysis showed that the donor cells or both donor cells and reconstructed embryos treated with TSA (groups A and C) provided greater gene expression than the group with only reconstructed embryos treated with TSA (group B; p<0.05).

FIG. 4.

Comparative relative mRNA expression levels of EGFP (A) and DNMT1 (B) at various developmental stages of TSA treatment. Different superscripts indicate significant differences (p<0.05).

Correspondingly, DNMT1 mRNA expression of donor cells treated with TSA was significantly lower than the control without TSA treatment (p<0.05; Fig. 4). However, DNMT1 mRNA expression of groups B and C at the blastocyst stage were significantly lower than that of group A and the control (p<0.05). Our results suggest that TSA possibly prevented the decreasing tendency of EGFP expression during reprogramming development of porcine cloned embryos, but DNA hypomethylation induced by modification of histone acetylation of donor cells treated with TSA was significantly effective in enhancing EGFP expression of the embryos.

Discussion

Transgenic cloned animals have played a pivotal role in research for genetics, biomedicine, physiology, and agriculture. Particularly, transgenic cloned pigs are of great value for transgenic research, disease modeling, and human xenotransplantation. However, abnormal transgene expression level and low cloning efficiency are major limitations to producing transgenic animals. Recently, investigations have focused on the ability of HDAC inhibitors to improve SCNT efficiency, although the effects of HDAC inhibitors varied with treatment duration, concentration, species (Bui et al., 2007; Himaki et al., 2010; Lee et al., 2011; Li et al., 2008b; Shi et al., 2008; Zhao et al., 2009), and the type used. Results of many experiments have indicated that acetylation status played a very important role in the process of reprogramming and affected the development of SCNT embryos (Dai et al., 2010; Das et al., 2010; Ding et al., 2008; Li et al., 2008a).

We found that reconstructed embryos with TSA treatment exhibited a significantly higher level of AcH3K9 at the two-cell stage than those of the untreated reconstructed embryos. However, SCNT embryos derived from donor cells with TSA treatment exhibited similar low AcH3K9 levels compared with untreated two-cell stage SCNT embryos. Furthermore, the relative mRNA level of HDAC1 is in agreement with the results of AcH3K9 levels from the above experiment. Our results are similar to the high levels of AcH4K8 and AcH4K16 seen in porcine two-cell stage SCNT embryos treated with TSA (Cervera et al., 2009; Li et al., 2008b; Yamanaka et al., 2009). Cervera et al. (2009) observed that the initial AcH4K8 signal of the donor cell nucleus decreased after its transfer to the enucleated oocyte, and they proposed that the presence of TSA after nuclear transfer would significantly increase AcH4K8 levels from the pronuclear stage to the two-cell stage. Our results confirmed that donor cells treated with TSA cannot increase the level of AcH3K9 at the two-cell stage in porcine SCNT embryos, supporting the idea that effects of TSA on the acetylation status improved the development of SCNT embryos during a specific period of time after SCNT (Cervera et al., 2009; Li et al., 2008b).

EGFP driven under a cytomegalovirus (CMV) promoter is often a good marker for studying transgene expression in porcine transgenic models, but the expression pattern and mechanism of action of the EGFP gene from transgenic donor cells to SCNT blastocysts have not been evaluated systemically. Although the histone acetylation status of transgenic donor cells is related to favorable results, the effects on porcine cloning efficiency remain unclear.

In this study, we describe how TSA improved EGFP gene expression in porcine SCNT blastocysts and the developmental potential of porcine transgenic SCNT embryos. To elucidate the mechanism of pluripotency and early embryonic development caused by TSA exposure, the expression levels of the pluripotency-related gene POU5F1 and anti-apoptotic gene BCL2 were investigated. POU5F1 is a regulator of pluripotency expressed during cleavage stages. It has been reported that HDAC inhibitors could increase POU5F1 expression at the blastocyst stage, which may help the development of the SCNT embryo (Liu et al., 2012; Su et al., 2011). Similarly, we found significant up-regulated expression of POU5F1 at the four-cell and blastocyst stages through the reconstructed embryos treated with TSA in the present study. However, Cervera et al. (2009) reported that TSA does not affect POU5F1 expression, and the results may be due to a combination of in vitro culture, protocol of TSA treatment and SCNT procedure.

Apoptosis is another criterion for evaluation of blastocyst quality because it eliminates cells with nuclear or chromosomal abnormalities. BCL2 is considered to be an anti-apoptotic gene. Our results suggest that reconstructed embryos treated with TSA also support anti-apoptotic programming, as shown by the expression of BCL2. Previous reports have confirmed that nuclear reorganization of centromeric/pericentromeric sequences is often abnormal in SCNT embryos and is improved by TSA treatment (Maalouf et al., 2009). Hence, modification of gene expression, for example, in a pluripotency-related gene (POU5F1) and an anti-apoptotic gene (BCL2) in SCNT embryos treated with a HDAC inhibitor may hold the key to success in mammalian somatic cell nuclear reprogramming.

In addition to histone acetylation, DNA methylation is another key epigenetic factor that modifies the chromatin structure and regulates embryonic gene expression in somatic nuclear reprogramming (Breton et al., 2010; Jeon et al., 2008; Nolen et al., 2005). TSA treatment not only modifies histone acetylation but also rescues silenced transgenes by inducing histone hyperacetylation and DNA hypomethylation of the promoter region of in vitro stable transgenic cells (Kong et al., 2011). Therefore, we further investigated whether TSA treatment affects EGFP expression in somatic nuclear reprogramming by inducing DNA hypomethylation from porcine donor cells to blastocysts, and the expression of EGFP mRNA and DNMT1 mRNA were analyzed. It was found that TSA could significantly increase EGFP mRNA expression in donors and SCNT blastocysts compared with the control and did inhibit the decreasing tendency of EGFP mRNA expression from donor cells to blastocysts, which accordingly prevents the methylation of SCNT embryos effectively (Fig. 4).

These results suggested that transgene expression could decrease rapidly accompanied by a high level of methylation in somatic cell nuclear reprogramming. Previous reports have confirmed that eight CpG sites of the CMV promoter were regulated by methylation (Krishnan et al., 2006); CMV promoter-controlled transgenes could be activated by TSA (Choi et al., 2005). Our data on donor cells and reconstructed embryos treated with TSA support those results in somatic nuclear reprogramming. Interestingly, donor cells treated with TSA seemed to be more effective in maintaining EGFP expression in SCNT embryos. In addition, although EGFP mRNA expression differs significantly, no differences of DNMT1 mRNA expression were observed in blastocysts from either donor cells treated with TSA or the controls. The authors conclude that the methylation level of CMV promoter pre-regulated by TSA in the donor genome is not easy to change during reprogramming. This is in agreement with the observation that the epigenetic alteration of somatic cell nuclei with TSA treatment is unyielding to reprogramming during preimplantation development (Wee et al., 2007). Transgene expression of donor cells preregulated by TSA may be an important time point to prevent transgene decline in the production of transgenic animals.

In summary, our results indicate that TSA-modified acetylation status of reconstructed embryos enhanced the expression of anti-apoptosis and development-related genes and subsequently improved the developmental potential of porcine SCNT embryos in vitro. In addition, transgenic donor cells with DNA hypomethylation induced by TSA were more effective in preventing the decrease in EGFP expression in SCNT embryos. Therefore, both donor cells and reconstructed embryos treated with TSA not only prevented EGFP expression decrease but also improved development of porcine preimplantation SCNT embryos, which could provide an efficient means to produce transgenic cloned pigs.

Footnotes

Acknowledgments

The research was supported by the Research Fund for the Doctoral Program of the Ministry of Education of China (20120097120007 and 20130097110020), Natural Science Foundation of China (31201967), Natural Science Foundation (BK2012369) and PAPD of Jiangsu Province. We express our gratitude to Dr. Gary Anderson from the Department of Animal Science, University of California, Davis, for his comments and help with revision in English.

Author Disclosure Statement

The authors declare that no conflicting financial interests exist.

References

Bhaumik

S.R.

, Smith

, and Shilatifard

(2007). Covalent modifications of histones during development and disease pathogenesis. Nat. Struct. Mol. Biol., 14, 1008–1016.

, Di

, Qing-chang

, Hong

, Liang

, Zhen-hua

, and Zhong-qiu

(2011). Effect of trichostatin A on transfected donor cells and subsequent development of porcine cloned embryos. Zygote, 19, 237–243.

Breton

, Le Bourhis

, Audouard

, Vignon

, and Lelievre

J.M.

(2010). Nuclear profiles of H3 histones trimethylated on Lys27 in bovine (Bos taurus) embryos obtained after in vitro fertilization or somatic cell nuclear transfer. J. Reprod. Dev., 56, 379–388.

Bui

H.T.

, Van Thuan

, Kishigami

, Wakayama

, Hikichi

, Ohta

, Mizutani

, Yamaoka

, Wakayama

, and Miyano

(2007). Regulation of chromatin and chromosome morphology by histone H3 modifications in pig oocytes. Reproduction, 133, 371–382.

Cervera

R.P.

, Marti-Gutierrez

, Escorihuela

, Moreno

, and Stojkovic

(2009). Trichostatin A affects histone acetylation and gene expression in porcine somatic cell nucleus transfer embryos. Theriogenology, 72, 1097–1110.

Chan

A.W.

, Chong

K.Y.

, Martinovich

, Simerly

, and Schatten

(2001). Transgenic monkeys produced by retroviral gene transfer into mature oocytes. Science, 291, 309–312.

Choi

K.H.

, Basma

, Singh

, and Cheng

PW.

(2005). Activation of CMV promoter-controlled glycosyltransferase and beta-galactosidase glycogenes by butyrate, tricostatin A, and 5-aza-2′-deoxycytidine. Glycoconj. J., 22, 63–69.

Costa-Borges

, Santalo

, and Ibanez

(2010). Comparison between the effects of valproic acid and trichostatin A on the in vitro development, blastocyst quality, and full-term development of mouse somatic cell nuclear transfer embryos. Cell. Reprogram., 12, 437–446.

Dai

, Hao

, Hou

X.J.

, Hai

, Fan

, Yu

, Jouneau

, Wang

, and Zhou

(2010). Somatic nucleus reprogramming is significantly improved by m-carboxycinnamic acid bishydroxamide, a histone deacetylase inhibitor. J. Biol. Chem., 285, 31002–31010.

10.

Das

Z.C.

, Gupta

M.K.

, Uhm

S.J.

, and Lee

H.T.

(2010). Increasing histone acetylation of cloned embryos, but not donor cells, by sodium butyrate improves their in vitro development in pigs. Cell. Reprogram., 12, 95–104.

11.

Ding

, Wang

, Zhang

, Wang

, Guo

, and Zhang

(2008). Increased pre-implantation development of cloned bovine embryos treated with 5-aza-2′-deoxycytidine and trichostatin A. Theriogenology, 70, 622–630.

12.

Duncan

E.M.

, Muratore-Schroeder

T.L.

, Cook

R.G.

, Garcia

B.A.

, Shabanowitz

, and Allis

C.D.

(2008). Cathepsin L proteolytically processes histone H3 during mouse embryonic stem cell differentiation. Cell, 135, 284–294.

13.

Enright

B.P.

, Kubota

, Yang

, and Tian

X.C.

(2003). Epigenetic characteristics and development of embryos cloned from donor cells treated by trichostatin A or 5-aza-2′-deoxycytidine. Biol. Reprod., 69, 896–901.

14.

Esteller

, and Herman

J.G.

(2002). Cancer as an epigenetic disease: DNA methylation and chromatin alterations in human tumours. J. Pathol., 196, 1–7.

15.

Grassi

, Maccaroni

, Meyer

, Kaiser

, D'Ambrosio

, Pascale

, Grassi

, Kuhn

, Di Nardo

, Kandolf

, and Küpper

J.H.

(2003). Inhibitors of DNA methylation and histone deacetylation activate cytomegalovirus promoter-controlled reporter gene expression in human glioblastoma cell line U87. Carcinogenesis, 24, 1625–1635.

16.

Himaki

, Yokomine

T.A.

, Sato

, Takao

, Miyoshi

, and Yoshida

(2010). Effects of trichostatin A on in vitro development and transgene function in somatic cell nuclear transfer embryos derived from transgenic Clawn miniature pig cells. Anim. Sci. J., 81, 558–563.

17.

Houdebine

L.M.

(2000). Transgenic animal bioreactors. Transgenic Res., 9, 305–320.

18.

Hyun

, Lee

, Kim

, Lee

, Nam

, Jeong

, Kim

, Yeom

, Kang

, Han

, Lee

, and Hwang

(2003). Production of nuclear transfer-derived piglets using porcine fetal fibroblasts transfected with the enhanced green fluorescent protein. Biol. Reprod., 69, 1060–1068.

19.

Jafarpour

, Hosseini

S.M.

, Hajian

, Forouzanfar

, Ostadhosseini

, Abedi

, Gholami

, Ghaedi

, Gourabi

, Shahverdi

A.H.

, Vosough

A.D.

, and Nasr-Esfahani

M.H.

(2011). Somatic cell-induced hyperacetylation, but not hypomethylation, positively and reversibly affects the efficiency of in vitro cloned blastocyst production in cattle. Cell. Reprogram., 13, 483–493.

20.

Jenuwein

, and Allis

C.D.

(2001). Translating the histone code. Science, 293, 1074–1080.

21.

Jeon

B.G.

, Coppola

, Perrault

S.D.

, Rho

G.J.

, Betts

D.H.

, and King

W.A.

(2008). S-adenosylhomocysteine treatment of adult female fibroblasts alters X-chromosome inactivation and improves in vitro embryo development after somatic cell nuclear transfer. Reproduction, 135, 815–828.

22.

, Rui

, Lu

, Lin

, and Guo

(2010). Analysis of apoptosis and methyltransferase mRNA expression in porcine cloned embryos cultured in vitro. J. Assist. Reprod. Genet., 27, 49–59.

23.

Kishigami

, Mizutani

, Ohta

, Hikichi

, Thuan

N.V.

, Wakayama

, Bui

H.T.

, and Wakayama

(2006). Significant improvement of mouse cloning technique by treatment with trichostatin A after somatic nuclear transfer. Biochem. Biophys. Res. Commun., 340, 183–189.

24.

Kong

, Wu

, Wang

, Zhang

, Li

, Liu

, Mu

, and Liu

(2011). Effect of trichostatin A and 5-aza-2′-deoxycytidine on transgene reactivation and epigenetic modification in transgenic pig fibroblast cells. Mol. Cell. Biochem., 355, 157–165.

25.

Kouzarides

(2007). Chromatin modifications and their function. Cell, 128, 693–705.

26.

Krishnan

, Park

J.M.

, Cao

, Wang

, Paulmurugan

, Tseng

J.R.

, Gonzalgo

M.L.

, Gambhir

S.S.

, and Wu

J.C.

(2006). Effects of epigenetic modulation on reporter gene expression: Implications for stem cell imaging. FASEB J., 20, 106–108.

27.

Lai

, and Prather

R.S.

(2003). Production of cloned pigs by using somatic cells as donors. Cloning Stem Cells, 5, 233–241.

28.

Lee

J.S.

, Shukla

, Schneider

, Swanson

S.K.

, Washburn

M.P.

, Florens

, Bhaumik

S.R.

, and Shilatifard

(2007). Histone crosstalk between H2B monoubiquitination and H3 methylation mediated by COMPASS. Cell, 131, 1084–1096.

29.

Lee

M.J.

, Kim

S.W.

, Lee

H.G.

, Im

G.S.

, Yang

B.C.

, Kim

N.H.

, and Kim

D.H.

(2011). Trichostatin A promotes the development of bovine somatic cell nuclear transfer embryos. J. Reprod. Dev., 57, 34–42.

30.

, Huarte

, Zaratiegui

, Vaughn

M.W.

, Shi

, Martienssen

, and Cande

W.Z.

(2008a). Lid2 is required for coordinating H3K4 and H3K9 methylation of heterochromatin and euchromatin. Cell, 135, 272–283.

31.

, Svarcova

, Villemoes

, Kragh

P.M.

, Schmidt

, Bøgh

I.B.

, Zhang

, Du

, Lin

, Purup

, Xue

, Bolund

, Yang

, Maddox-Hyttel

, and Vajta

(2008b). High in vitro development after somatic cell nuclear transfer and trichostatin A treatment of reconstructed porcine embryos. Theriogenology, 70, 800–808.

32.

Liu

, Liu

, Gao

, Song

, Wen

, Guan

, Yin

, Ma

, Tang

, and Li

(2012). Embryonic development and gene expression of porcine SCNT embryos treated with sodium butyrate. J. Exp. Zool. B Mol. Dev/ Evol., 318, 224–234.

33.

Luo

B.P.

, Ju

S.Q.

, Wang

, and Rui

(2013). A possible strategy to produce pigs resistant to porcine reproductive and respiratory syndrome virus. Antiviral Res., 99, 158–164.

34.

Maalouf

W.E.

, Liu

, Brochard

, Renard

J.P.

, Debey

, Beaujean

, and Zink

(2009). Trichostatin A treatment of cloned mouse embryos improves constitutive heterochromatin remodeling as well as developmental potential to term. BMC Dev. Biol., 9, 11.

35.

Migliaccio

A.R.

, Bengra

, Ling

, Pi

, Li

, Zeng

, Keskintepe

, Whitney

, Sanchez

, Migliaccio

, and Tuan

(2000). Stable and unstable transgene integration sites in the human genome: Extinction of the green fluorescent protein transgene in K562 cells. Gene, 256, 197–214.

36.

Miranda

T.B.

, and Jones

P.A.

(2007). DNA methylation: The nuts and bolts of repression. J. Cell. Physiol., 213, 384–390.

37.

Nolen

L.D.

, Gao

, Han

, Mann

M.R.

, Gie Chung

, Otte

A.P.

, Bartolomei

M.S.

, and Latham

(2005). X chromosome reactivation and regulation in cloned embryos. Dev. Biol., 279, 525–540.

38.

Park

K.W.

, Cheong

H.T.

, Lai

, Im

G.S.

, Kühholzer

, Bonk

, Samuel

, Rieke

, Day

B.N.

, Murphy

C.N.

, Carter

D.B.

, and Prather

R.S.

(2001). Production of nuclear transfer-derived swine that express the enhanceed green fluorescent protein. Anim. Biotechnol., 12, 173–181.

39.

Shi

L.H.

, Ai

J.S.

, Ouyang

Y.C.

, Huang

J.C.

, Lei

Z.L.

, Wang

, Yin

, Han

Z.M.

, Sun

Q.Y.

, and Chen

D.Y.

(2008). Trichostatin A and nuclear reprogramming of cloned rabbit embryos. J. Anim. Sci., 86, 1106–1113.

40.

Shi

, Hoeflich

, Flaswinkel

, Stojkovic

, Wolf

, and Zakhartchenko

(2003). Induction of a senescent-like phenotype does not confer the ability of bovine immortal cells to support the development of nuclear transfer embryos. Biol. Reprod., 69, 301–309.

41.

, Wang

, Li

, Wu

, Quan

, Liu

, Guo

, and Zhang

(2011). Oxamflatin significantly improves nuclear reprogramming, blastocyst quality, and in vitro development of bovine SCNT embryos. PLoS One, 6, e23805.

42.

Swindle

C.S.

, and Klug

C.A.

(2002). Mechanisms that regulate silencing of gene expression from retroviral vectors. J. Hematother. Stem Cell Res., 11, 449–456.

43.

Takada

, Iida

, Awaji

, Itoh

, Takahashi

, Shibui

, Yoshida

, Sugano

, and Tsujimoto

(1997). Selective production of transgenic mice using green fluorescent protein as a marker. Nat. Biotechnol., 15, 458–461.

44.

Wee

, Shim

J.J.

, Koo

D.B.

, Chae

J.I.

, Lee

K.K.

, and Han

Y.M.

(2007). Epigenetic alteration of the donor cells does not recapitulate the reprogramming of DNA methylation in cloned embryos. Reproduction, 134, 781–787.

45.

, Rui

, Dai

, Zhang

, Ju

, Xie

, Lu

, and Zheng

(2006). Effects of cryopreservation on the developmental competence, ultrastructure and cytoskeletal structure of porcine oocytes. Mol. Reprod. Dev., 73, 1454–1462.

46.

Yamanaka

, Sugimura

, Wakai

, Kawahara

, and Sato

(2009). Acetylation level of histone H3 in early embryonic stages affects subsequent development of miniature pig somatic cell nuclear transfer embryos. J. Reprod. Dev., 55, 638–644.

47.

Yamauchi

, Doe

, Ajduk

, and Ward

M.A.

(2007). Genomic DNA damage in mouse transgenesis. Biol. Reprod., 77, 803–812.

48.

Yoshioka

, Suzuki

, Tanaka

, Anas

I.M.

, and Iwamura

(2002). Birth of piglets derived from porcine zygotes cultured in a chemically defined medium. Biol. Reprod., 66, 112–119.

49.

Zhang

, Li

, Villemoes

, Pedersen

A.M.

, Purup

, and Vajta

(2007). An epigenetic modifier results in improved in vitro blastocyst production after somatic cell nuclear transfer. Cloning Stem Cells, 9, 357–363.

50.

Zhao

, Ross

J.W.

, Hao

, Spate

L.D.

, Walters

E.M.

, Samuel

M.S.

, Rieke

, Murphy

C.N.

, and Prather

R.S.

(2009). Significant improvement in cloning efficiency of an inbred miniature pig by histone deacetylase inhibitor treatment after somatic cell nuclear transfer. Biol. Reprod., 81, 525–530.