Genetic Manipulation by Zinc-Finger Nucleases in Rat-Induced Pluripotent Stem Cells

Abstract

Induced pluripotent stem cells (iPSCs) have an extensive application in regenerative medicine, pharmaceutical discovery, and basic research. With the recent derivation of rat iPSCs, it is now feasible to apply genetic manipulation in this species. But such tools do not yet exist for many rat strains, especially for disease model rat. The Sprague Dawley (SD) rat is an inbred disease model for hypertension, nephropathy, pulmonary hypertension, depression, and alcohol consumption. In this study, the SD rat iPSCs were generated using lentiviral method. The p53 gene was targeted in rat iPSCs using homologous recombination mediated by P53 zinc-finger nucleases (ZFNs). Our results showed that these rat iPSCs were pluripotent status. P53 gene was targeted successfully with high efficiency by coelectroporating the donor targeting vectors and p53 ZFN vector to these rat iPSCs. Southern blotting analysis confirmed the correct homologous recombination in rat iPSCs. At the same time, our results demonstrated that the P53 dependent function was abolished in p53-targeted iPSCs. This report also demonstrated that iPS technology, combined with homologous recombination mediated by ZFN, was suitable to develop human disease model in rat and other species.

Introduction

Mouse embryonic stem cells (ESCs) have constituted powerful tools to explore gene functions in human diseases by producing mouse models since 1981 (Evans and Kaufman, 1981). In 2006, induced pluripotent stem cells (iPSCs) were generated by four transcription factors (Oct3/4, Sox2, c-Myc, and Klf4). Like mouse ESCs, they expressed alkaline phosphatase (AKP), can generate chimeric mice, and had potential of germline transmission (Okita et al., 2007; Takahashi and Yamanaka, 2006). Subsequent studies demonstrated that human (Dimos et al., 2008; Huangfu et al., 2008; Kim et al., 2009; Lowry et al., 2009; Park et al., 2008; Takahashi et al., 2007), mouse (Takahashi et al., 2006), rat (Li et al., 2009; Liao et al., 2009), and rabbit (Honda et al., 2010) iPSCs could be produced using different reprogramming methods. In 2008, rat ESCs were established using two or three kinds of kinase inhibitors (Buehr et al., 2008; Li et al., 2008). Shortly after establishment of rat ESCs, iPSCs were successfully established through retroviral or lent-viral introduction of transcription factors (Hamanaka et al., 2011). It was shown that rat iPSCs could differentiate into all three germ layers, produce chimeric rat, and even had potential of germline transmission. However, to date, not much of genetic manipulation in rat iPSCs has been reported.

The laboratory rats are used as valuable models for human diseases and for preclinical drug studies and development of cell therapeutics. However, the utility of the rat as a genetic disease model has historically been limited because of a lack of basic tools for site directed genetic manipulation, including the generation of pluripotent stem cells. To accelerate discovery of genetic determinants of disease, we set out to generate rat iPSCs and try to perform genetic manipulation in rat iPSCs.

Since the derivation of the first rat iPSCs by other groups, no subsequent reports have described successful gene targeting. The lack of effective genetic manipulation in rat iPSCs is the main reason. Recently, site-specific zinc-finger nucleases (ZFNs) have been used to target endogenous genes in human cells (Carroll, 2008; Hockemeyer et al., 2009; Urnov et al., 2005). The genomic lesions created by ZFNs are repaired by homology-directed repair. This “knockin” technique has been successfully applied to genetic modification, including zebra fish, plants, mouse, and rat embryos (Cai et al., 2009; Doyon et al., 2008; Meng et al., 2008; Shukla et al., 2009). Thus, enabling this type of engineering in rat iPSCs could increase the efficiency of homologous gene targeting and accelerate the study of disease genetic determinants.

In this study, rat iPSCs from the Sprague Dawley (SD) somatic cells were generated and successfully demonstrated that the iPSCs were pluripotency status. Subsequently, to evaluate the potential of these novel rat iPSC lines for introducing targeted mutations in the rat iPS genome, we have tested their capacity for gene targeting and demonstrated the utility of ZFNs to knock in a selection gene into the rat P53 homologous region. Finally, we demonstrated the utility of ZFNs to enhance homologous targeting of neo gene into rat homologous region to the p53 gene in rat iPSCs.

Materials and Methods

Ethics and animals

The study was approved by Institutional Review Board and Ethics Committee of the Nanchang Institute of Medical Sciences. After inhalation anesthesia for surgical exposure of nonobese diabetic (NOD)/severe combined immune deficient (SCID) mice testis, 5 × 10⁶ single cells were injected into testis. After 4–8 weeks, tumor was formed. The mice were killed by cervical dislocation method for hematoxylin-eosin (HE) staining.

Cell culture

Rat and mouse embryonic fibroblast (EF) cells were prepared from e14.5 embryos cultured in Dulbecco's modified Eagle's medium containing 1% nonessential amino acid, 10% fetal calf serum (SH30118.02; HyClone), 2 mM l-glutamine, and 0.1 mM 2-mercaptoethanol. Rat iPSCs were maintained on mitomycin C treated mouse embryonic fibroblasts (Kunmingbai) in N₂B₂₇ medium (12752010; Invitrogen) supplemented with 100 U/mL rat leukemia inhibitory factor (LIF) (ESGRO Millipore, Bedford, MA), 3 mM CHIR99021 (Axon Medchem, Groningen, The Netherlands), and 1 mM PD0325901 (Stemgent, Cambridge, MA). Rat iPSCs were isolated into single cells using trypsin and transferred into new wells with a mouse EF feeder cells at 3 or 4 days.

The construction of lentiviral vector and generation of rat iPSCs

The cDNAs of rat Oct4, Sox2, and Klf4 were inserted into a doxycycline-inducible system lentiviral vector. To establish rat iPSCs, SD EF cells were transferred to six-well plates with cell density of 5 × 10⁵ cells/well 1 day before transfection. The next day (Day 0) SD EF cells were transduced with this lentiviral vector. Transduced EF cells were isolated and replated onto mouse feeder layers (1:10) in mouse EF medium 2 days later. Generated colonies were picked up and mechanically dissociated at Day 10. Dissociated rat iPSCs were replated into new mouse feeder cells for expanding.

AKP staining and immunostaining

Rat iPSCs were fixed for AKP staining and immunostaining described as Li et al. (2013).

Genotyping and karyotyping

Genotyping was performed by polymerase chain reaction (PCR) using ear DNA. Primer sequences for microsatellite analysis were as follows: D14Rat23: F: TCGGAGGGAGTGACACATAA, R: TGTCCCTCAGTTCAGAATACCC; D14Rat7: F: CATGGTCTTTGTGGCACTTG, R: TGAAGCTTAATCCTGCTATGCA. Rat iPSCs were cultured for karyotyping as described in published article (Yang et al., 2016).

Southern blotting

The DNA with long fragment was obtained from targeted rat iPSCs. The DNA was digested with EspI, electrophoresed, and then transferred to a nylon membrane (Amersham Biosciences, United Kingdom), After the DNA membrane was fixed, the Southern blot hybridization was performed according to the manufacturer's instruction (Roche). Hybridization signals were analyzed by an auto image analyzer.

Western blot analysis

Protein extracted from 5 × 10⁶ rat iPSCs was separated by routine methods and transferred to nitrocellulose membrane. After blockage with 5% milk, the membrane was probed with a monoclonal antibody against p53 (1:1000, MAB1355; R&D Systems).

Bisulfite sequencing

Bisulfite sequencing was referred to methods described by Hamanaka et al. (2011). PCR primers of Oct4 bisulfite sequencing were listed (Supplementary Table S1; Supplementary Data are available online at www.liebertpub.com/cell).

Teratoma formation

About 5 × 10⁶ single cells were injected into each testis of 6–10-week-old NOD/SCID mice. After 4–8 weeks, mice were killed and processed for hematoxylin/eosin staining.

ZFN constructs and targeting plasmids

The ZFNs were performed by Sigma-Aldrich Company. ZFN plasmids and ZFN-encoding mRNA for the rat p53 gene were purchased from Sigma-Aldrich. The ZFN pair was TTCTCCAGTCTTCCTCCAG. The rat 53 targeting vector consists of the 813 bp 5′ P53 homology arm and the 809 bp 3′ homology arm with flanking an adenoviral splice acceptor sequence, followed by the 3890 bp β-Galactosidase coding region.

Embryonic body formation

After SD iPSCs were dissociated into single cells using Accutase, 5 × 10⁵ iPSCs at day 3 or 4 were cultured in embryonic body (EB) media without inhibitor. After 6 days of incubation, the total cells were counted after dissociation with Accutase.

Cell proliferation

Cells from untargeted and targeted P53 iPSCs were detached by trypsin and counted using a hemocytometer. 1.0 × 10⁴ single cells were seeded at 4.0 × 10⁵/cm² on feeders. After culturing 3 and 5 days in rat iPSC medium, the untargeted and targeted P53 iPSCs were harvested and counted.

Real-time PCR analysis

Total RNA was extracted from 1 × 10⁶ iPSCs. Four microliter aliquot of the total RNA was reverse-transcribed using the RevertAid™ First Strand cDNA Synthesis Kit (Fermentas, Lithuania). Primers for Real-time RT-PCR were shown in the list (Supplementary Table S1). Real-time RT-PCR was performed using the LightCycler FastStart Master DNA SYBR Green I Kit (Roche, Germany). Using the 2−ΔΔCt method and 95% accepted confidence interval, the relative change was calculated.

Statistical analysis

All results are shown as the mean ± SD. Student's tests were performed for analysis. p ≤ 0.05 was considered significant.

Results

Generation of rat iPSCs from rat embryonic fibroblasts

The rat iPSCs were reprogrammed from rat EF using a lentiviral vector carrying three rat reprogramming factors (Oct4, Klf4, and Sox2). The time schedule for rat iPSC induction is summarized (Fig. 1A). The SD EF cells were replated at 5000 cells/well at day −1 and transduced at day 0. Infected rat EFs (Fig. 1B) were plated onto treated mouse EF and cultured with serum-free medium (N2B27/F12) with rat LIF on day 2. On day 7, 2i or 3i was added to the medium. On day 10, we grew them in 2i or 3i medium with valproic acid for 4 days. ES-like colonies appeared from day 13 and were of typical dome shape (Fig. 1C). Colonies were picked up expanded in N2B27/F12 medium containing rat LIF, 2i or 3i. These rat iPSCs could be sustained for over 20 passages with normal karyotype and morphology. All ES-like colonies displayed AKP positive, indicating that generated rat iPSCs were pluripotent (data not shown).

FIG. 1.

The generation of rat iPSCs from rat embryonic fibroblasts (EFs). (A) The scheduler of virus-mediated reprogramming in rat EF cells in 2i or 3i culture system. (B) The morphology of SD rat EF cells after virus transfection. (C) The typical rat iPS colonies after day 13. SD, Sprague Dawley.

The generated rat iPSCs have the similar characteristics of rat ESCs

The rat iPSCs displayed typical ES cell-like morphology. The cell immunofluorescence staining showed that the rat iPSCs were positive for SSEA-1, Oct4, Nanog, and Sox2 (Fig. 2A and Supplementary Fig. S1). Furthermore, like mouse ESCs, rat iPSCs displayed X chromosome inactivation (Fig. 2B), indicating that rat iPSCs exhibited a unique epigenetic feature of ESCs. Unmethylated status of Oct4 expression in the distal enhancer is reportedly a feature of pluripotency (Fouse et al., 2008). To analyze DNA methylation status in rat iPSCs, we analyzed the distal enhancer of Oct4 in rat iPSCs, ESCs, and EF cells by bisulfite sequencing. In rat ESCs and iPSCs, the distal enhancer of Oct4 was largely unmethylated (Fig. 2C, D). By contrast, in rat EFs, the Oct4 enhancer was highly methylated (Fig. 2E). All the above mentioned results confirmed that these rat iPSCs had basic features of ESCs in gene expression and epigenetic status.

FIG. 2.

Rat iPSCs showed the characteristics of rat ESCs. (A) All colonies were stained positive for Oct-4, Nanog, SSEA-1, and Sox2. (B) Immunofluorescence for me₃H₃K₂₇ (red) in undifferentiated SD iPSCs showed diffuse staining (Upper), while differentiated rat EF cells exhibit a prominent H3k27me3 unclear body (Down). Scale bars represent 25 μm. (C) Bisulfite genomic sequencing of the distal enhancer region of Oct3/4 in rat iPSCs, rat ESCs (D), and EF cells (E). Blank and Black circles indicate unmethylated and methylated CpGs, respectively. ESC, embryonic stem cell; iPSC, induced pluripotent stem cell.

Differentiation experiments in vivo and in vitro showed the pluripotent status of rat iPSCs

To evaluate the differentiation potential of rat iPSCs in vitro, the rat iPSCs were suspended for culture and formed well-shaped EBs. Ten-day-old EBs were replated for culture in N2B27 without inhibitors. Some cell types appeared in 15 days. Immunofluorescent assay using antibodies against smooth muscle antigen (mesoderm, right), β-tubulin (ectoderm, middle), and feta-protein (endoderm, left) showed differentiation to three germ layers in vitro (Fig. 3A–C).

FIG. 3.

Differentiation of rat iPSCs to three germ layers in vivo and in vitro. (A) After 15 days of growth in plate, the differentiation cells displayed feta-protein (endoderm; left), (B) β-tubulin (ectoderm; middle), and (C) smooth muscle antigen (mesoderm; right). (D) Histochemical analysis indicated the existence of tissues from all three germ layers, such as pigment retinal epithelium (ectoderm), epidermal tissues (ectoderm), cartilage (mesodermal), adipose tissue (mesoderm), intestines (endoderm), and muscle (mesoderm).

To test the differentiation potential of rat iPSCs in vivo, rat iPSCs were injected into NOD/SCID for teratoma formation. The teratomas were produced 4 weeks after injection. Histochemical analysis indicated the existence of tissues from all three germ layers (Fig. 3D–F). Our results showed that rat iPSCs at either early (P7) or late (P20) passages had the same potential for differentiation. There were not any discernible differences among different rat iPSC lines in the ability to form teratoma.

Targeting of the P53 gene by homologous recombination mediated by ZFNs in rat iPSCs

Gene targeting by homologous recombination in rat ESCs has been proven effective in our former experiments. But the efficiency of homologous recombination is very low. A few reports have described that ZFNs had been used to target endogenous genes in mammalian embryos and cells (Cui et al., 2011; Meyer et al., 2010; Zambrowicz et al., 1997). To evaluate the power of p53 ZFN-induced homologous recombination and explore whether ZFNs can increase the efficiency of homologous recombination in rat iPSCs, the p53 ZFNs were transfected into SD iPSCs at various dosages along with a circular plasmid targeting vector harboring a splice acceptor, β-galactosidase/neomycin phosphotransferase fusion gene sequence, polyadenylation signal (p53-SA-βGeo-ptA), and flanking short 813- and 809-bp homology arms to the sequenced BN rat genome locus (Fig. 4A). G418-resistant iPSC clones were only obtained from experiments where the ZFNs were cotransfected (Table 1).

FIG. 4.

The homologous recombination mediated by ZFN in rat iPSCs. (A) Diagram of ZFN-assisted targeting of the p53 locus in rat iPSCs. (B) Southern blotting analysis of p53+/+, p53+/−, and p53−/− gene-targeted SD iPSCs using 5, and 3, probes. For Southern blot analysis with 5, or 3, probes, genomic DNA from rat iPSCs was digested with EspI. The expected sizes of wild-type and P53 gene-targeted bands with different probes are shown. ZFN, zinc-finger nuclease.

Table 1.

Gene Targeting of the P53 Locus in Rat-Induced Pluripotent Stem Cells with Zinc-Finger Nuclease Assisted or Without

Cell lines	Cell no.	P53 vector (μg)	ZFN pair	G418 ^R	Targeted
SD-iPS-2-P12	6.5 × 10⁶	10	2 μg	70	100% (11/11)
SD-iPS-2-P12	6.5 × 10⁶	10	No	7	0 (7/7)
SD-iPS-2-P15	6.0 × 10⁶	10	2 μg	160	83.3% (10/12)
SD-iPS-2-P15	6.0 × 10⁶	10	No	8	0 (6/6)
SD-iPS-2-P15	6.0 × 10⁶	20	2 μg	188	90% (10/11)
SD-iPS-2-P15	6.0 × 10⁶	20	No	12	0 (4/4)
SD-iPS-2-P18	7.1 × 10⁶	20	4 μg	195	91.7% (11/12)
SD-iPS-2-P18	7.1 × 10⁶	20	No	3	0 (3/3)

ZFN, zinc-finger nuclease.

Clones were expanded and analyzed by PCR for their p53 genotype using primers specific to the genome outside the homology arm sequence and the SA-βGeo-ptA insert to show that more than 75% of individual G418-resistant clones were correctly targeted in three experiments, confirmed by Sanger sequencing and uniform β-galactosidase staining (data not shown). The remaining clones did not amplify, suggesting random integration of the selection gene. No difference was observed with different ratios or amounts of ZFNs and targeting vector in the transfection. P53 genotype was performed in G418-resistant iPSC clones. Twelve iPSC clones transfected with p53 vector alone exhibited only the 6.3-kb Esp I wild-type band. The cotransfection of P53 vector with ZFN plasmids strongly enhanced recombination at p53 locus, such that 11 of 12 analyzed clones exhibited the predicted Esp I fragment derived from a targeted allele. One iPSC clone exhibited only the targeted band (4.94 kb) and likely represented the targeting of both P53 alleles (Fig. 4B).

These results showed that ZFNs can markedly improve the efficiency of homologous gene targeting in rat iPSCs using targeting vectors with short homology arms. To identify whether or not the pluripotency was kept in the targeted clones, we evaluated the differentiation capacity of the p53 targeted clones. These results showed that the p53 targeted clones had the similar gene expression pattern with the parental cell lines (Supplementary Fig. S2). We also tested the proliferation ability between untargeted and targeted iPSCs. The results showed that the untargeted and targeted iPSCs had similar cell proliferation ability (Fig. 5). To prove whether genetic stability was kept in the P53 targeted iPSCs, the karyotype was performed. In all analyzed metaphase, most cells kept normal karyotype although about 15% cell karyotype is abnormal (Table 2; see Discussion section).

FIG. 5.

Growth characteristics of untargeted and targeted iPSCs. The untargeted and targeted iPSCs had similar population growth rate.

Table 2.

The Karyotype of p53 Targeted Induced Pluripotent Stem Cell Subclones

Cell lines	Subclone	Passage	Karyotype ^a (%)	Metaphase counted
Rat-iPS-2	1	12	83.3	24
Rat-iPS-2	3	18	76.7	30
Rat-iPS-2	5	8	85.7	21
Rat-iPS-2	8	24	74.1	27
Rat-iPS-2	13	22	88.4	29
Rat-iPS-2	17	13	92	25
Rat-iPS-2	25	9	89.4	38

Percentage of metaphase containing euploid chromosome number of 42.

Compared to the recent demonstration of chromosome instability in rat ESCs after routine homologous recombination, we acquired higher percentage of normal karyotype cells after selection and gene targeting. Our results showed that, using homologous recombination mediated by ZFN, the rat iPSCs were amenable to gene targeting with pluripotent states and normal karyotype.

P53 dependent function in ESCs is abolished in p53^−/− rat iPSCs

P53 gene plays an important role in self-renewal, DNA-damage responses, and genetic stability of pluripotent stem cells (Lin et al., 2005; Xu, 2005; Yang et al., 2008). The p53 function is different in different mammalian pluripotent stem cells (Sancar et al., 2004; Song et al., 2007). Until now, the p53 function is not clear in rat pluripotent stem cells. The generation of p53^−/− rat iPSCs provides us one valuable cell model to explore the roles of p53 in DNA-damage responses and genetic stability in rat pluripotent stem cells. Before attempting to verify the issues, we first explored whether or not that P53 gene has the same biological effect in rat iPSCs and ESCs. The P53 was activated in rat iPSCs and ESCs by DNA damage induced by ultraviolet (UV) light. As it was reported in mouse ESCs (Mitsui et al., 2003), these types of DNA damage markedly increased P53 protein levels at 5 hours after treatment (Fig. 6A), indicating that the biological function of p53 gene in rat iPSCs was same as in rat ESCs. Different from what is in p53^+/+ rat iPSCs, p53-dependent induction of p21 and Mdm2 was abolished in p53^−/− rat iPSCs after DNA damage (Fig. 6B, C).

FIG. 6.

The function of p53 in ESCs is abolished in p53−/− rat iPSCs (A) Induction of P53 protein level in rat ESCs and iPSCs after 60 UV J M-2 UV radiations. The induction of gene expression of P21 (B), Mdm2 (C), and Nanog (D) in rat ESCs, iPSCs, and P53−/− rat iPSCs. The mRNA levels of each gene were determined by quantitative real-time polymerase chain reaction and standardized by the mRNA level of beta-actin.

In all, these data indicated that p53 was induced and active in rat iPSCs after DNA damage. Nanog was an important protein of DNA-damage response and self-renewal in ESCs (Mitsui et al., 2003). The expression of Nanog is suppressed directly by p53 in mouse ESCs after DNA damage (Zwaka, 2003). In our experiments, Nanog expression was also reduced in wild-type rat iPSCs after DNA damage, indicating an evolutionarily conserved role of p53 in mammalian pluripotent stem cells (Fig. 6D).

Discussion

In this study, we established hypertension disease-model rat iPSCs (SD) using a lentiviral vector with three factors (Oct4, Klf4, and Sox2) and demonstrated ZFN-mediated p53 knockin with high efficiency. Established SD rat iPSCs had the characteristic of rat ESCs, of the expression of pluripotency genes, self-renewal, and the differentiation potential into derivatives of all three germ layers. Very importantly, in the targeted P53 rat iPSCs, P53 dependent function was abolished as it happened in mouse and rat ESCs, indicating that the function of P53 in rat iPSCs is similar to mouse ESCs as described before (Song et al., 2007).

We successfully generated rat iPSCs from rat SD strain. It is a main contribution of this study. One factor can be key points to affect the generation of rat iPSCs. One is the density of feeder cells. In our study, the efficiency of clone formation is higher on high density (7.5 × 10⁴/cm²) than on low-density feeder cells (2.5 × 10⁴/cm²). The SD iPSCs can be derived efficiently from ICR, DR4, and SD feeder cells.

Genetic manipulation in rat iPSCs has been proven amenable in our article. The efficiency of homologous recombination mediated by ZFN was higher than normal homologous recombination efficiency which was published from mouse, rat, and human ESCs (Doetschman et al., 1987). However, we failed to generate germline competent chimeras from our p53^−/− iPSCs in our experiments. Genetic change and chromosomal abnormality that occurred in selection and passage may be main reasons. We karyotyped targeted rat iPSC-A cell line culture and found evidences of abnormal karyotype, including duplication of chromosomes 1, 12, 14, and 17, losses of chromosomes 3 and 15, and complex chromosomal rearrangement. From our understanding, modification of culture conditions, high efficient homologous recombination, low selection pressure, and short selection and passage time will benefit to genetic stability and full pluripotency for successful germline transmission.

In our studies, ZFN-mediated p53 gene targeting was achieved by site-specific integration of neo gene whose expression can be selected. The P53 dependent function is abolished in targeted rat iPSCs. Moreover, donor plasmids with short targeting arms were transduced with ZFN. It resulted in high targeting efficiencies and without construction of isogenic targeting vectors. Although it is possible that some genes were not targeted by ZFNs, the precise design helps to target most of the genes. Thus, the approach described in this article should be useful in developing human disease model to explore gene function.

Footnotes

Acknowledgment

The authors thank Dr. Jun Li for his valuable discussion and comments on the studies and preparation of the article.

Author Disclosure Statement

The authors declare that no conflicting financial interests exist.

References

Buehr

, Meek

, Blair

, Yang

, Ure

, and Silva

(2008). Capture of authentic embryonic stem cells from rat blastocysts. Cell, 135, 1287–1298.

Cai

C.Q.

, Doyon

, Ainley

W.M.

, Miller

J.C.

, Dekelver

R.C.

, and Moehle

E.A.

(2009). Targeted transgene integration in plant cells using designed zinc finger nucleases. Plant Mol. Biol., l69, 699–709.

Carroll

(2008). Progress and prospects: zinc-finger nucleases as gene therapy agents. Gene Ther. 15, 1463–1468.

Cui

, Ji

, Fisher

D.A.

, Wu

, Briner

D.M.

, and Weinstein

E.J.

(2011). Targeted integration in rat and mouse embryos with zinc-finger nucleases. Nat. Biotechnol., 29, 64–67.

Dimos

J.T.

, Rodolfa

K.T.

, Niakan

K.K.

, Weisenthal

L.M.

, Mitsumoto

, and Chung

(2008). Induced pluripotent stem cells generated from patients with ALS can be differentiated into motor neurons. Science, 321, 1218–1221.

Doetschman

, Gregg

R.G.

, Maeda

, Hooper

M.L.

, Melton

D.W.

, and Thompson

S.S.

(1987). Targeted correction of a mutant HPRT gene in mouse embryonic stem cells. Nature, 330, 576–578.

Doyon

, McCammon

J.M.

, Miller

J.C.

, Faraji

, Ngo

, and Katibah

G.E.

(2008). Heritable targeted gene disruption in zebrafish using designed zinc-finger nucleases. Nat. Biotechnol., 26, 702–708.

Evans

M. J.

, and Kaufman

M. H.

(1981). Establishment in culture of pluripotential cells from mouse embryos. Nature, 292, 154–156.

Fouse

S.D.

, Shen

, Pellegrini

, Cole

, Meissner

, and Van Neste

(2008) Promoter CpG methylation contributes to ES cell gene regulation in parallel with Oct4/Nanog, PcG complex, and histone H3 K4/K27 trimethylation. Cell Stem Cell, 2, 160–169.

10.

Hamanaka

, Yamaguchi

, Kobayashi

, Kato-Itoh

, Yamazaki

, and Sato

(2011). Generation of germline-competent rat induced pluripotent stem cells. PLoS One, 6, e22008.

11.

Hockemeyer

, Soldner

, Beard

, Gao

, Mitalipova

, and DeKelver

R.C.

(2009). Efficient targeting of expressed and silent genes in human ESCs and iPSCs using zinc-finger nucleases. Nat. Biotechnol., 27, 851–857.

12.

Honda

, Hirose

, Hatori

, Matoba

, Miyoshi

, and Inoue

(2010). Generation of induced pluripotent stem cells in rabbits: potential experimental models for human regenerative medicine. J. Biol. Chem., 285, 31362–31369.

13.

Huangfu

, Osafune

, Maehr

, Guo

, Eijkelenboom

, and Chen

(2008). Induction of pluripotent stem cells from primary human fibroblasts with only Oct4 and Sox2. Nat. Biotechnol., 26, 1269–1275.

14.

Kim

, Kim

C.H.

, Moon

J.I.

, Chung

Y.G.

, Chang

M.Y.

, and Han

B.S.

(2009). Generation of human induced pluripotent stem cells by direct delivery of reprogramming proteins. Cell Stem Cell, 4, 472–476.

15.

, Tong

, Mehrian-Shai

, Jia

, Wu

, and Yan

(2008). Germline competent embryonic stem cells derived from rat blastocysts. Cell, 135, 1299–1310.

16.

, Wei

, Zhu

, Shi

, and Lin

(2009). Generation of rat and human induced pluripotent stem cells by combining genetic reprogramming and chemical inhibitors. Cell Stem Cell, 4, 16–19.

17.

Liao

, Cui

, Chen

, Ren

, Chen

, and Gao

(2009). Generation of induced pluripotent stem cell lines from adult rat cells. Cell Stem Cell, 4, 11–15.

18.

Lin

, Chao

, Saito

, Mazur

S.J.

, Murphy

M.E.

, and Appella

(2005). p53 induces differentiation of mouse embryonic stem cells by suppressing Nanog expression. Nat. Cell Biol., 7, 165–171.

19.

Lowry

W.E.

, Richter

, Yachechko

, Pyle

A.D.

, Tchieu

, and Sridharan

(2009). Generation of human induced pluripotent stem cells from dermal fibroblasts. Proc. Natl. Acad. Sci. U.S.A., 105, 2883–2888.

20.

Meng

, Noyes

M.B.

, Zhu

L.J

, Lawson

N.D.

, and Wolfe

S.A.

(2008). Targeted gene inactivation in zebrafish using engineered zinc-finger nucleases. Nat. Biotechnol., 26, 695–670.

21.

Meyer

, de Angelis

M.H.

, Wurst

, and Kühn

(2010). Gene targeting by homologous recombination in mouse zygotes mediated by zinc-finger nucleases. Proc. Natl. Acad. Sci. U.S.A., 107, 15022–15026.

22.

Mitsui

, Tokuzawa

, Itoh

, Segawa

, Murakami

, and Takahashi

(2003). The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell, 113, 631–642.

23.

Okita

, Ichisaka

, and Yamanaka

(2007). Generation of germline-competent induced pluripotent stem cells. Nature, 448, 313–317.

24.

Park

I.H.

, Zhao, West

J.A.

, Yabuuchi

, Huo

, and Ince

T.A.

(2008). Reprogramming of human somatic cells to pluripotency with defined factors. Nature, 451, 141–146.

25.

Sancar

, Lindsey-Boltz

L.A.

, Unsal-Kapmaz

, and Linn

(2004). Molecular mechanisms of mammalian DNA repair and the DNA damage checkpoints. Annu. Rev. Biochem., 73, 39–85.

26.

Shukla

V.K.

, Doyon

, Miller

J.C.

, DeKelver

R.C.

, Moehle

E.A.

, and Worden

S.E.

(2009). Precise genome modification in the crop species Zea mays using zinc-finger nucleases. Nature, 459, 437–441.

27.

Song

, Hollstein

, and Xu

(2007). p53 gain-of-function cancer mutants induce genetic instability by inactivating ATM. Nat. Cell Biol., 9, 573–580.

28.

Takahashi

, and Yamanaka

(2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell, 126, 663–676.

29.

Takahashi

, Tanabe

, Ohnuki

, Narita

, Ichisaka

, and Tomoda

(2007). Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell, 131, 861–872.

30.

Urnov

F.D.

, Miller

J.C.

, Lee

Y.L.

, Beausejour

C.M.

, Rock

J.M.

, and Augustus

(2005) Highly efficient endogenous human gene correction using designed zinc-finger nucleases. Nature, 435, 646–651.

31.

(2005). A new role for p53 in maintaining genetic stability in embryonic stem cells. Cell Cycle, 4, 363–364.

32.

Yang

, Ding

, Jiang

, Sun

, and Xu

(2016) Establishment and adipocyte differentiation of polycystic ovary syndrome-derived induced pluripotent stem cells. Cell Prolif. 49, 352–361.

33.

Yang

, Lin

, Tan

Y.Q.

, Zhou

, Deng

L.Y.

, and Cheng

D.H.

(2008). Tumor progression of culture-adapted human embryonic stem cells during long-term culture. Genes Chromosomes Cancer, 47, 665–679.

34.

Zambrowicz

B.P.

, Imamoto

, Fiering

, Herzenberg

L.A.

, Kerr

W.G.

, and Soriano

(1997). Disruption of overlapping transcripts in the ROSA beta geo 26 gene trap strain leads to widespread expression of beta-galactosidase in mouse embryos and hematopoietic cells. Proc. Natl. Acad. Sci U.S.A., 94, 3789–3794.

35.

Zwaka

T.P.

(2003). Thomson JA. Homologous recombination in human embryonic stem cells. Nat. Biotechnol., 21, 319–321.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.06 MB

0.04 MB

0.02 MB

Genetic Manipulation by Zinc-Finger Nucleases in Rat-Induced Pluripotent Stem Cells

Abstract

Abstract

Introduction

Materials and Methods

Ethics and animals

Cell culture

The construction of lentiviral vector and generation of rat iPSCs

AKP staining and immunostaining

Genotyping and karyotyping

Southern blotting

Western blot analysis

Bisulfite sequencing

Teratoma formation

ZFN constructs and targeting plasmids

Embryonic body formation

Cell proliferation

Real-time PCR analysis

Statistical analysis

Results

Generation of rat iPSCs from rat embryonic fibroblasts

The generated rat iPSCs have the similar characteristics of rat ESCs

Differentiation experiments in vivo and in vitro showed the pluripotent status of rat iPSCs

Targeting of the P53 gene by homologous recombination mediated by ZFNs in rat iPSCs

P53 dependent function in ESCs is abolished in p53−/− rat iPSCs

Discussion

Footnotes

Acknowledgment

Author Disclosure Statement

References

Supplementary Material

P53 dependent function in ESCs is abolished in p53^−/− rat iPSCs