NOTCH Signaling Is Essential for Maturation,Self-Renewal,and Tri-Differentiation of In Vitro Derived Human Neural Stem Cells

Abstract

Although neural stem cells (NSCs) have potential applications in treating neurological disorders, much still needs to be understood about the differentiation biology for their successful clinical translation. In this study, we aimed at deriving NSCs from human umbilical cord blood-derived mesenchymal stem cells (hUCB-MSCs) and explored the role of Notch signaling in the differentiation process. The hUCB-MSCs were characterized as per guidelines of the International Society of Cellular Therapy. NSCs were successfully generated from hUCB-MSCs by using epidermal and fibroblast growth factors under serum-free conditions. The expression of NSC markers (Nestin and Musashi-1) in the neurospheres generated from hUCB-MSCs in the presence or absence of N-[N-(3,5-difluorophenacetyl)-l-alanyl]-S-phenylglycine t-butyl ester (DAPT; Notch inhibitor) was immuno-phenotypically characterized by using immunofluorescence. DAPT showed significant (*p < 0.05) downregulated expression of the NSC markers—Nestin and SOX2—at different time points (6 hours, 12 hours, 24 hours, 36 hours, and 5 days) post-treatment. In addition, Mushashi-1 (NSC marker) expression in NSCs was also inhibited after DAPT treatment, which signifies that the process is Notch dependent. These data were further correlated with formation of a reduced average number of neurospheres derived from hUCB-MSCs (2 colonies vs. 11 colonies/field of view) in the presence of DAPT compared with the control (without DAPT). The expression of Notch target genes in NSC cultures (Notch intracellular domain [NICD], HES1, and HES5) was also significantly downregulated after DAPT treatment. In the presence of DAPT, the markers for neuronal (MAP2, NEFH); and glial (GFAP, GLUL, and MBP) lineages were significantly downregulated as seen via immunofluorescence and quantitative polymerase chain reaction, indicating the role of Notch in the tri-differentiation mechanism of NSCs as well. In addition, Notch signaling inhibition induced higher cell death during the lineage commitment of NSCs as measured 3 days (16.9% vs. 8.9%) and 6 days (42.9% vs. 20.8%) postinduction. These results suggest that the efficient derivation of NSCs and their subsequent lineage commitment from hUCB-MSCs requires the Notch signaling pathway.

Introduction

Neural stem cells (NSCs) have the potential to differentiate into neuronal (neurons) and non-neuronal/glial cells (astrocytes and oligodendrocytes) of the central nervous system (CNS) (Gage, 2000). In an adult brain, NSCs are localized primarily in two specific neurogenic niches: lateral ventricles of the forebrain (subventricular zone [SVZ]) and dentate gyrus of the hippocampus (subgranular zone [SGZ]) (Lois and Alvarez-Buylla, 1993). Although both regions have a heterogeneous population of neural stem and progenitor cells, the number of NSCs residing in these regions are very less for clinical use (Jakel et al., 2004). In the developing mammalian nervous system, differentiation of NSCs is guided by various signaling cues that give rise to neurogenesis and gliogenesis.

During adult brain development, neurogenesis precedes gliogenesis. Notch signaling has a profound effect on CNS development and regulates the commitment of NSCs toward neuronal and glial (astrocytes and oligodendrocytes) phenotype (Alexson et al., 2006; Louvi and Artavanis-Tsakonas, 2006). Notch receptor is a type-1 single-pass transmembrane receptor, consisting of an extracellular domain with multiple epidermal growth factor (EGF)-like repeats (14–36 in number) and various intracellular domains such as juxtamembrane domain; Rbp-associated molecule domain; nuclear localization signal domain; ankyrin repeats; transactivation domain; and proline, glutamic acid, serine, and threonine degradation domain (Andersson et al., 2011). Notch interaction with its cell-bound ligand proteins (such as Delta and Serrate) activates a metalloprotease called ADAM metallopeptidase domain 10, which cleaves the Notch extracellular domain, leading to endocytosis (Hansson et al., 2010; Nichols et al., 2007).

Further, γ-secretase cleaves the remaining portion of the Notch receptor called the Notch intracellular domain (NICD), which is then translocated into the nucleus. The interaction of NICD with the DNA-binding protein CSL (CBF1, suppressor of hairless, Lag-1) regulates the expression of HES family proteins (HES1 and HES5) (Kopan and Ilagan, 2009; Ohtsuka et al., 2001). The HES proteins actually control the expression of proneural and glial-specific genes, thereby regulating the fate of NSCs (Fu et al., 2008; Hermann et al., 2004). However, the role of the Notch pathway in the in vitro conversion of human mesenchymal stem cells (MSCs) to NSCs has not yet been deciphered in any of the published reports. Therefore, it is important to understand the underlying differentiation mechanism of human MSCs to NSCs before attempting their clinical-grade production.

The clinical importance of NSCs is well defined by their cellular functions, which include: (1) ability to regenerate new neural/glial tissue due to their tri-potential differentiation capability, (2) self-renewal and ability to maintain its basic “stem” properties, and (3) potential to integrate into the host neural tissue without disturbing the normal function. These characteristics of NSCs make them suitable to treat various CNS diseases. Even though NSCs have promising benefits in use toward neural transplantation therapies, the sources for NSCs isolation are very limited.

In addition, using allogenic cells for transplantation can result in graft rejection and also raise high ethical concerns. Therefore, the recuperative potencies of NSCs necessitate an unhindered supply of NSCs to endure the current neurological deficits. Embryonic stem cells and pluripotent stem cells have limited use in generating NSCs and subsequent clinical applications because of their teratoma-forming ability, ethical concerns, and significant immune rejection (Cao et al., 2009; Kooreman and Wu, 2010). Hence, a pronounced proportion of current research has been concentrating on MSC-derived NSCs (Fu et al., 2008; Hermann et al., 2004).

MSCs are multipotent, fibroblast-like morphological cells that can be easily isolated from various autologous adult tissues such as bone marrow, umbilical cord, adipose tissue etc., with no ethical concerns and zero immune rejection (autologous) (Caminal et al., 2016). Due to their ability to differentiate into various cell types, including neural cells, adipocytes, chondrocytes, osteocytes, cardiac cells, oligodendrocytes, hepatocytes, etc. (Venkatesh and Sen, 2017), MSCs are considered an ideal cell source for the treatment of various diseases. MSC-derived NSCs might possibly aid in the elimination of fetal neural tissue transplantation therapies and can overcome the ethical aspects of fetal tissue isolation and their associated side-effects such as dyskinesia and related problems (Politis, 2010).

Henceforth, this study is focused on delineating the role of Notch signaling in NSC generation from human umbilical cord blood-derived MSCs (hUCB-MSCs) and in their subsequent tri-differentiation capability by using the γ-secretase inhibitor N-[N-(3,5-difluorophenacetyl)-l-alanyl]-S-phenylglycine t-butyl ester (DAPT).

Materials and Methods

MSC culture and maintenance

hUCB-MSCs were purchased from PromoCell GmbH (Heidelberg, Germany; two batches) and Himedia (India; two batches) (n = 4). Cells were expanded in α-minimal essential medium (α-MEM; Gibco) +10% fetal bovine serum (FBS) with 1% penicillin-streptomycin and incubated at 37°C in 5% CO₂ with 95% relative humidity (Lark Equipment, Inc, India). Media were changed every 3rd day and at 80%–90% confluence, the cells were trypsinized by using 0.25% Trpsin/EDTA (1 × ). The same culturing conditions were maintained for all subsequent passages.

The mesodermal lineage differentiation capacity of human MSCs was carried out by following published protocol (Jaiswal et al., 1997). The flow cytometric analysis of MSCs was carried out by using human MSC marker analysis kit (BD Stemflow™) (Positive markers CD73, CD90, and CD105 and negative markers CD45, CD34, CD11b, CD19, and HLA-DR) as per the guidelines of the International Society of Cellular Therapy (ISCT) (Dominici et al., 2006). All experiments were conducted with MSC passage numbers between 2 and 4.

In vitro generation of NSCs

MSCs were seeded at a density of 2.5 × 10⁵ cells/cm² onto low cell-binding Hydrocell™ six-well plates (Nunc, Thermo Scientific). The NSC defined media (NDM) were prepared as per the modified protocol of Hermann et al. (2004). Briefly, the NDM contained serum-free P4-8F as a neural basal medium and different combinations of growth factors, each of which was supplemented with 20 ng/mL EGF and fibroblast growth factor (FGF) (Sigma-Aldrich) as described in Table 1. It was found that the combination of EGF and FGF was able to produce the maximum number of neurospheres more efficiently than by using the factors by themselves. The generated spheres were harvested on the 4th day post-induction (Yang et al., 2015a). Derivation of single-celled NSCs was carried out by treatment with StemPro^® Accutase^® cell dissociation reagent (Life Technologies, USA).

Table 1.

Optimization of Neural Stem Cell-Differentiation Medium

Combinations	EGF (μL)	FGF (μL)	P4-8F medium (μL)	Total volume (μL)
P4-8F+EGF	40	0	1960	2000
P4-8F+FGF	0	40	1960	2000
P4-8F+EGF+FGF	40	40	1920	2000

EGF, epidermal growth factor; FGF, fibroblast growth factor.

Morphological and molecular characterization of in vitro derived NSCs

Leishman staining

Leishman solution (0.15% [w/v]) was used to stain the hUCB-MSC-derived NSCs for counting the number of neurospheres per field under a phase-contrast microscope.

Scanning electron microscopy

The generated neurospheres were harvested from low-attachment binding plates to 30 mm dishes and cultured overnight with the same induction medium for their adherence. Then, neurospheres were fixed on a cover slip with 3% glutaraldehyde in phosphate-buffered saline (PBS), pH 7.4 at room temperature for 15 minutes. The coverslips were rinsed three times with PBS and were then post-fixed with 1% Osmium tetraoxide for 30 minutes. The cover slips were dehydrated by using ethanol series of 30%–100% for 45 seconds each and dried in a critical point dryer. The cover slips were cut to a size of 1 cm², mounted on holders with two-sided adhesive tape, and sputter coated with 1–2 nm gold/palladium (Au/Pd). The images were observed under a field emission scanning electron microscope (EVO ZEISS, Germany) (Venkatesh et al., 2015).

Confocal laser scanning microscopy

Cultured hUCB-MSCs grown in NDM onto low cell-binding Hydrocell six-well plates (to form neurospheres) with and without DAPT were harvested on the 4th day and were fixed with 4% paraformaldehyde for 20 minutes at room temperature. The spheres were then rinsed with PBS and permeabilized with 0.5% Triton X-100 for 10 minutes followed by washing with PBS for three times. The cover slips were blocked with 1% bovine serum albumin for 30 minutes to prevent non-specific binding of antibodies.

The slides were then incubated with primary monoclonal antibodies at the following dilutions: rabbit anti-human Nestin, 1:200 (SP103; Abcam, Cambridge, UK) and rabbit anti-human Mushashi-1, 1:1000 (D46A8-XP; Cell Signaling Technology, Danvers, MA) for 1 hour at room temperature and rinsed in PBS-Tween-20. These slides were further incubated with Alexa Fluor^® 488 anti-rabbit secondary antibody at 1:250 dilution (Cell Signaling Technology). Confocal microscopy of spheres was performed with an Olympus FLUOVIEW FV1000 confocal laser scanning microscope (CLSM) (Olympus Optical Co. Ltd., Tokyo, Japan). Confocal images were collected from Olympus FLUOVIEW Ver.3.1b software at 10× objectives by using standard DAPI, and Alexa Fluor 488 wavelengths.

Reverse-transcriptase–polymerase chain reaction and quantitative polymerase chain reaction

The neurospheres were harvested at different time points (6 hours, 12 hours, 24 hours, 36 hours, and 5 days) in a 15 mL sterile centrifuge tube and washed with PBS, pH 7.4. Then, the spheres were detached into single-celled NSCs by using StemPro Accutase cell dissociation reagent. Total RNA was isolated from hUCB-MSC-derived NSCs and tri-differentiated culture by using RNAiso Plus kit (Takara Bio, Kyoto, Japan) according to the manufacturer's protocol. The quality and quantity of the isolated total RNA was determined by using a NanoDrop 2000c spectrophotometer (ThermoFisher Scientific, USA). One microgram of cDNA was synthesized by using the High-Capacity cDNA Reverse Transcription Kit (ThermoFisher Scientific, USA) using the following program: 25°C for 10 minutes, 37°C for 120 minutes, 85°C for 5 minutes, and hold at 4°C.

The reaction mixture just described was used as a template in reverse-transcriptase–polymerase chain reaction (RT-PCR)/quantitative PCR (qPCR) to know the expression of NSC markers (Nestin & SOX2) and tri-lineage markers (GFAP, GLUL, MBP, MAP2, and NEFH) using the primers as mentioned in Table 2. RT-PCR was carried out by using the Takara PCR gradient system (Takara Bio) for 95°C for 10 minutes, 95°C for 30 seconds, 50°C for 45 seconds, 72°C for 30 seconds, and for 26 cycles. The amplicons were resolved in 2% agarose gel electrophoresis, and results were recorded with a gel documentation system (ChemiDoc-It^2® Imager; UVP, LLC, Upland, CA). qPCR for expression of the tri-differentiation genes was carried out by using ABI quant studio detection system, and reaction assays were performed by using SYBR Taq-II supermix (Takara Bio). The qPCR data were normalized to the endogenous control β-actin, and expression levels were calculated by using the ΔΔCt method (Venkatesh et al., 2013, 2015).

Table 2.

Primers Used for Real-Time Polymerase Chain Reaction and Reverse-Transcriptase–Polymerase Chain Reaction

Cell types	Gene	NCBI gene ID	Forward primer	Reverse primer	Amplicon size (bp)
NSCs	Nestin	NM_006617.1	CTAGAGGAGGCAGGTGGTCT	CAAGGTGAAGGGGCATCACT	179
	SOX2	NM_003106.3	AGTCTCCAAGCGACGAAAAA	TTTCACGTTTGCAACTGTCC	189
	HES1	NM_005524.3	CGGACATTCTGGAAATGACA	TACTTCCCCAGCACACTTGG	97
	HES5	NM_001010926.3	CTCAGCCCCAAAGAGAAAAA	GACAGCCATCTCCAGGATGT	168
Astrocytes	GFAP	NM_002055.4	GAGCAGGAGGAGCGGCAC	TAGGTGGCGATCTCGATGTCC	164
Astrocytes	GLUL	NM_002065.6	AAGAGTTGCCTGAGTGGAATTTC	AGCTTGTTAGGGTCCTTACGG	124
Oligodendrocytes	MBP	NM_001025100.1	CACGCAGGCAAACGAGAATTA	CTGAGGTTGTCCGTGAAAGTT	112
Neurons	MAP2	NM_002374.3	CGAAGCGCCAATGGATTCC	TGAACTATCCTTGCAGACACCT	161
Neurons	NEFH	NM_021076.3	CCGTCATCAGGCCGACATT	GTTTTCTGTAAGCGGCTATCTCT	161

NSCs, neural stem cells.

Tri-potential capacity of NSCs

Tri-differentiation of NSCs into neural and glial lineages was carried out as published earlier (Fu et al., 2008). Briefly, NSCs were plated on sterile glass coverslips in individual plates of 30 mm petri plates in DMEM supplemented with 1% FBS, 25 μg/mL insulin, 100 μg/mL transferrin, 20 nM progesterone, 60 nM putrescine, and 30 nM sodium selenite. The medium was changed on the 4th day of the experiment. The expression of tri-lineage markers GFAP/GLUL (astrocytes), MBP (oligodendrocytes), and MAP2/NEFH (neurons) for neurons was carried out by using qPCR/RT-PCR as well as confocal microscopy as described earlier.

Notch inhibition

Role of DAPT in neurosphere formation from hUCB-MSCs: colony-forming units

The hUCB-MSCs were seeded in NDM with and without DAPT (10 μM) at a seeding density of 50 × 10³ cells/well in 30 mm petri plates. After 4 days, the neurospheres were counted manually (13 fields/per dish) and stained with Leishman stain (0.15%). The average number of colonies that are formed in the neurosphere formation assay is reported with bar graphs.

Propidium iodide: cell death assay

To determine the viability of differentiated cells in the presence or absence of DAPT, propidium iodide (PI) staining followed by flow-cytometric quantification was carried out (ThermoFisher Scientific). Briefly, the tri-differentiated cells were harvested and washed in ice-cold PBS. Cells were centrifuged at 5000 rpm for 5 minutes, and the supernatant was then discarded. The pellet was resuspended in 0.5 mL of PBS, pH 7.4, and 5 μL of 100 μg/mL PI was added to each cell suspension. Cells were incubated at room temperature for 15 minutes. Four hundred microliters of 1× PBS was added after the incubation period and gently mixed. The stained cells were analyzed by flow cytometry, and the emitted fluorescence was measured at 530 nm.

Western blot

Total proteins were isolated from hUCB-MSC-derived NSC cultures grown for 4 days in the presence or absence of DAPT by using standard Lysis buffer by following the manufacturer's guidelines (Cell Signaling Technology). Protein concentrations were determined by using the Pierce™ BCA protein assay kit (Thermo Scientific). Ten micrograms of total proteins from cell lysate was subjected to electrophoresis in 10% sodium dodecyl sulfate-containing polyacrylamide gels for detection of cleaved Notch (NICD), HES1, and β-actin. After blotting to polyvinylidene fluoride membranes (GE Healthcare, UK), they were incubated for 1 hour with blocking buffer containing 5% non-fat dry milk in Tris-buffered saline, 0.1% Tween 20 (TBST); then, they were washed three times with TBST for 5 minutes.

The blots were then incubated with cleaved Notch (NICD) (1:2000), HES1 (1:2000), and β-actin (1:1000) (Cell Signaling Technology) rabbit anti-human primary antibodies overnight at 4°C diluted in 5% bovine serum albumin containing TBST according to the manufacturer's protocol (Cell Signaling Technology). After washing three times for 5 minutes each in TBST, blots were then incubated at room temperature for 1 hour with secondary anti-rabbit IgG-horseradish peroxidase (HRP)-conjugated antibody according to the manufacturer's protocol (Cell Signaling Technology). Proteins were then detected by using an enhanced chemi-luminescence substrate for HRP (Thermo Scientific) using a chemi-documentation analysis system (ChemiDoc-lt2 Imager; UVP, LLC).

Effect of DAPT in hUCB-MSC-derived NSC's tripotential differentiation

The expression of Nestin, Notch target genes (Hes1 and Hes5), and tri-lineage markers (GFAP, GLUL, MBP, MAP2, and NEFH) was carried out by using RT-PCR and qPCR methods, respectively, as described earlier. To examine the protein expression levels in the tri-differentiated culture treated with or without DAPT, immunofluorescence was done for GFAP, CNPase, and MAP2 as described earlier. The primary monoclonal antibodies (Cell Signaling Technology) at the following dilutions were used: rabbit anti-human GFAP, 1:200, rabbit anti-human CNPase, 1:100, and rabbit anti-human MAP2, 1:200 for 1 hour at room temperature; they were further incubated with Alexa Fluor 488 secondary conjugated antibody, 1:250. Confocal images were acquired by using Olympus FLUOVIEW FV1000 CLSM (Olympus Optical Co. Ltd.).

Statistical analysis

Statistical analysis was performed by using analysis of variance (ANOVA). *p > 0.05 was considered as level of significance with respect to the controls. GraphPad Prism 5.0 (GraphPad Software, San Diego, CA) was used to draw break-even bar graphs (www.graphpad.com/scientific-software/prism).

Results

Molecular characterization of human hUCB-MSCs

MSCs derived from hUCB were successfully grown as monolayers in α-MEM supplemented with 10% FBS (Fig. 1a). The capability of hUCB-MSCs to differentiate into mesodermal lineage (such as osetocytes and adipocytes) was confirmed by Alizarin red-S and Oil Red-O staining, respectively (Fig. 1b, c). Further, immunophenotyping of these cells was carried out by using fluorochrome-tagged CD markers via flow cytometry. The expression of MSC-characteristic antigenic features such as CD73, CD90, and CD105 was seen (positive markers) whereas that of hematopoietic markers and costimulatory molecules such as CD45, CD34, CD11b, CD19, and HLA-DR (negative marker cocktail) was absent, further confirming that these cells are of non-hematopoietic origin (Fig. 1d). Taken together, these results confirmed that the cultures were a homogenous population of MSCs.

FIG. 1.

Molecular and functional characterization of hUCB-MSCs. hUCB-MSCs were expanded in α-MEM supplemented with 10% FBS and 1% Penn/Strep. The confluent (∼80%) culture was characterized by following the guidelines of the International Society for Cellular Therapy (ISCT). (a) Phase-contrast images of adherent monolayer culture of hUCB-MSCs. (b) In vitro differentiated osteocytes using osteogenic defined medium and stained with Alizarin red-S stain (Ca²⁺-Alizarin complex depositions). (c) In vitro differentiated adipocytes stained with Oil Red O stain (oil droplets). (d) Positive markers (CD90, CD105, and CD73) and negative markers (CD45, CD34, CD11b, CD19, and HLA-DR) were analyzed through flow cytometry. Scale bar: 4.18 mm, magnification: 20 × . α-MEM, α-minimal essential medium; FBS, fetal bovine serum; hUCB-MSCs, human umbilical cord blood-derived mesenchymal stem cells. Color images available online at www.liebertpub.com/cell

In vitro derivation of NSCs from hUCB-MSCs and their morphological and functional characterization

The confirmed homogenous population of MSCs was used further for generation of NSCs. Neurospheres were successfully formed as early as 12 hours, with the neurosphere size increasing with time on incubation with the NDM (Fig. 2a–h). In concurrence with the findings of Hermann et al. (2004), we obtained high yields of neurospheres within a short period. The formation of neurosphere-like structures was further confirmed by Leishman staining and scanning electron microscopy (Fig. 3a, b). The NSCs were dissociated from the neurospheres into single cells by using accutase enzyme. Confocal microscopic analysis revealed the expression of Nestin and Musashi-1 in MSC-derived NSCs, thus confirming that the generated neurospheres consist of NSCs (Fig. 3c–h). These dissociated single-celled NSCs were able to form spheres with the same induction medium containing EGF and FGF, thus confirming their self-renewal capability for up to four to six passages as determined by neurosphere-colony-forming assay (Fig. 4a, c).

FIG. 2.

In vitro generation of neurospheres from hUCB-MSCs. Neurospheres were generated by using NSC-defined medium supplemented with EGF and FGF. (a) MSCs. (b–d) Neurospheres at 12, 24, and 36 hours postinduction. (e) hUCB-MSCs plated in induction media at t = 0 hour. (f–h) Ability of the hUCB-MSCs to form spheres at the mentioned time intervals. Scale bar: 4.18 mm; magnification: 20 × . FGF, fibroblast growth factor.

FIG. 3.

Morphological and molecular characterization of hUCB-MSCs-derived neurospheres. The generated neurospheres were morphologically characterized by using Leishman stain and scanning electron microscope and immunofluorescence. (a) Leishman stain of neurospheres (scale bar 4.18 mm; magnification: 20 × ). (b) Electron microscopic visualization of neurospheres (scale bar: 20 μm; magnification:1.0k × ). (c–e) Fluorescence images of Nestin-positive NSCs. (f–h) Fluorescence images of Mushashi-1-positive NSCs (scale bar: 100 μm; magnification: 20 × ). NSCs, neural stem cells. Color images available online at www.liebertpub.com/cell

FIG. 4.

Role of Notch signaling in neurosphere generation from hUCB-MSCs. A significantly reduced number of NSC colonies was derived (2 vs. 11 colonies on average from 13 fields) from DAPT-treated hUCB-MSCs cultures. Phase-contrast image of hUCB-MSCs-derived NSCs, (a) without DAPT, (b) with DAPT. Leishman staining images of hUCB-MSCs-derived NSCs, (c) without DAPT (d) with DAPT. (e) Graphical representation of the average number of neurospheres counted from a total of 13 different fields of view. (f) Expression of HES1 and HES5 in the hUCB-MSCs-derived NSCs grown for 3 days in the presence or absence of DAPT. (g) Western blot analysis of cleaved Notch (NICD) and HES1 in hUCB-MSCs-derived NSCs grown for 4 days in the presence or absence of DAPT. (h) qPCR data showing significant (*p > 0.05) reduction of Notch target genes, HES1 and HES2. (i) Electrophoretogram showing nestin and SOX2 expression at different time points (6 hours, 12 hours, 24 hours, 36 hours, and 5 days) in hUCB-MSCs-derived NSCs in the presence or absence of DAPT. (j) qPCR expression analysis of nestin and SOX2 at the different time points (6 hours, 12 hours, 24 hours, 36 hours, and 5 days). *p < 0.05 compared with the respective untreated controls. (k, l) Confocal fluorescent images of hUCB-MSCs-derived neurospheres showing a significant reduction of Nestin (j) and Mushashi (k) expression on treatment with DAPT (scale bar 4.18 mm; magnification: a–e: 20 × ; j, k: 20 × , scale bar: 100 μm). DAPT, N-[N-(3,5-difluorophenacetyl)-l-alanyl]-S-phenylglycine t-butyl ester; qPCR, quantitative polymerase chain reaction. Color images available online at www.liebertpub.com/cell

Further, the functionality of in vitro generated NSCs from hUCB-MSCs was confirmed through their tri-lineage differentiation capability. The in vitro derived NSCs were plated in a cocktail medium supplemented with insulin (25 μg/mL), transferrin (100 μg/mL), progesterone (20 nM), putrescine (60 μM), and sodium selenite (30 nM). The round morphological cells from spheres were seen to be migrated out from the sphere center and differentiated into bipolar-/tripolar-shaped (neuro/glial-like) cells. Phase-contrast imaging and SEM analysis confirmed the migratory property of tri-differentiated cells from the neurosphere centers (Fig. 5a). To further confirm the neuronal and glial differentiation, the cultures were examined for expression of neuronal (MAP2 and NEFH) and glial (GFAP, GLUL, and MBP) markers through qPCR and RT-PCR (Fig. 5b), which showed positive for all the lineages.

FIG. 5.

Role of Notch signaling in the tripotential differentiation ability of NSCs derived from hUCB-MSCs. Tri-potential differentiation ability of generated NSCs was studied by using defined media in the presence or absence of DAPT, (a) Phase-contrast images of tri-differentiated cultures (electron microscopic image of migrated neuronal and glial cells from the neurospheres scale bar: 20 μm magnification; scale bar: 20 μm magnification: 1.0k × ) (b) Relative expression levels of tri-lineage markers in the presence or absence of DAPT determined by using qPCR and RT-PCR. For qPCR, the control (without DAPT) is normalized to one for all the gene expressions (β-actin was used as the internal control). Phase-contrast images of tri-lineage cultures without (c) and with (d) DAPT, scale bar: 4.18 mm magnification 20 × . Flow cytometric analysis of PI-positive cells after 3 days (e, f) and 5 days (g, h) in differentiation medium, (e, g) without DAPT (f, h) with DAPT. RT-PCR, reverse-transcriptase–polymerase chain reaction.

Role of Notch1 in “hUCB-MSC to NSC” differentiation and the tripotential differentiation ability of the generated NSCs

To define the role of Notch signaling pathway in NSC maturation, self-renewal, and its tri-potential differentiation (astrocytes, oligodendrocytes, and neuronal lineages) ability, the hUCB-MSCs were treated with or without the specific γ-secretase inhibitor, DAPT. DAPT significantly (*p > 0.05) reduced the numbers of formed neurospheres. On an average, only ∼2 spheres were observed in each field; whereas in the absence of DAPT, ∼11 spheres were observed per field (averaged from total of 13 fields) after 4 days of incubation. In addition, in the presence of DAPT, more number of MSCs was found to be adhered to the dishes instead of forming neurospheres. This explains that ∼81% of MSCs' differentiation capability to NSCs was inhibited with a concentration of 10 μM DAPT (Fig. 4a–e).

The expressions of NSC makers Nestin and SOX2 were also downregulated on treatment with DAPT at each of the different time points from 6 hours, 12 hours, 24 hours, 36 hours, and 5 days as determined via both RT-PCR and qPCR. Interestingly, the expression of SOX2 was not observed in MSCs when compared with EGF and FGF primed MSCs (Fig. 4i). These results confirm the differentiation of NSCs from MSCs. The significant downregulation of Nestin, SOX2, and Mushashi-1 expression in DAPT-treated cultures highlights the importance of Notch in conversion of hUCB-MSCs to NSCs (Fig. 4j and Supplementary Fig. S1; Supplementary Data are available online at www.liebertpub.com/cell).

In addition, Mushashi-1 expression was not observed in the generated neurospheres from hUCB-MSCs cultured in the presence of DAPT (Fig. 4k). We also verified the Notch inhibiting capability of DAPT by looking at the expression of Notch target genes (HES1 and HES5), where significant (*p > 0.05) downregulation (∼3.5-fold) of HES1 and HES5 genes was observed, as seen from RT-PCR and qPCR (Fig. 4f, h). Western blot analysis revealed both cleaved Notch (NICD) and HES1 expression to be significantly downregulated after DAPT treatment, which signifies the role of Notch in the differentiation of hUCB-MSCs to NSCs. DAPT also inhibited the tri-differentiation capability of the hUCB-MSC-derived NSCs as seen from the phase-contrast images taken after 6 days of differentiation (Fig. 5c, d). Increased concentrations of DAPT from 1 to 10 μM showed enhanced neuronal differentiation from NSCs; however, even at a high dose of 10 μM, it was significantly less than the control (without DAPT) NSCs (Supplementary Fig. S2).

DAPT-treated cells showed significantly reduced differentiation as evident from the lack of well-defined neuronal phenotype and protrusions when compared with the untreated control (Fig. 5c, d). This finding was substantiated by the significantly reduced expression of both neuronal (MAP2 and NEFH) and glial markers (GFAP, GLUL, and MBP), as evident from RT-PCR and qPCR data (Fig. 5b). Immunofluorescence study further showed significant downregulation of the tri-lineage markers after differentiation of hUCB-MSC-derived NSCs in the presence of DAPT compared with the control (no DAPT).

In addition, both spheres and migrated cells were found to lack surviving capability from as early as the 3rd day in DAPT-treated cultures. The cell death was assessed with PI staining by using flow cytometry at two different time points of 3 and 6 days postinduction of differentiation. At both the time points, ∼50% more cell death was seen in cells with DAPT treatment when compared with the untreated control as indicated by PI-positive cell populations (Fig. 5e–h). Taken together, these results indicate that Notch signaling plays a vital role in both hUCB-MSC-derived NSC proliferation and its tri-differentiation ability.

Discussion

In this study, we have used hUCB-MSCs for in vitro generation of NSCs. Initially, the obtained MSCs were fully characterized by their surface CD markers (positive for CD73, CD90, and CD105 and negative for CD45, CD34, CD11b, CD19, and HLA-DR) and their mesodermal lineage differentiation (osteocytes and adipocytes), which confirmed the presence of a homogenous population of MSCs without any cross-contamination with hematopoietic progenitor cells (Fig. 1). NSCs were generated successfully by priming the MSCs with a combination of both growth factors such as EGF and FGF in serum-free medium (P4-8F). The morphological characterization of sphere formation was confirmed through the phase-contrast and electron microscopic techniques.

The molecular expression of NSC-specific markers (Nestin and Musashi-1) was confirmed through immunofluoroscence by using confocal microscopy (Figs. 2 and 3). MSCs also showed nestin expression, which is supported by various published reports (Xie et al., 2015; Yang et al., 2015b); however, the role of nestin marker in MSCs has not yet been determined.

NSCs are neural stem/progenitor cells that can self-renew and are able to give rise to the same potent stem cells, and this is the one of the main characteristic features of NSCs that was confirmed with neurosphere-colony-forming assay. The generated spheres were effectively dissociated into single-celled cells (NSCs), after which they were again able to form new spheres in the same induction medium, thus explaining their self-renewal property (Doe, 2008; Shi et al., 2008). To elucidate the role of the Notch signaling mechanism during hUCB-MSC to NSC conversion, we have used a specific γ-secretase inhibitor known as DAPT. The frequency of sphere formation was reduced from ∼11 to 2 per field (20 × magnification) in the presence of DAPT. Also, on treatment with DAPT, the Notch target genes (HES1 and HES5) were significantly downregulated (∼3.5-folds). Significant downregulation of NICD and HES1 in DAPT-treated NSC cultures also highlights the importance of the Notch pathway in the conversion of hUCB-MSC to NSC.

SOX2 is a very important and prominent marker of NSCs. It is a transcription factor from the SOXB1 family that is widely used in the identification of NSCs both in vivo and in vitro. SOX2-expressing cells are generally detected in the postnatal neurogenic niches SVZ and SGZ, and such SOX2 expression denotes cell functionality as similar to NSCs (Ellis et al., 2004; Pevny and Nicolis, 2010; Suh et al., 2007). SOX2 is known to be involved in the maintenance of pluripotent network of NSCs during embryogenesis (Ahmed et al., 2009; Zhang and Cui, 2014). The expression of SOX2 in NSCs explains its self-renewability and tri-differentiation capabilities both in in vitro and in vivo conditions (Barraud et al., 2005; Ellis et al., 2004; Ferri et al., 2004). In this study, the expression of Nestin and SOX2 in the derived NSCs confirms the successful differentiation of MSCs to NSCs.

The role of Notch signaling in the induction of NSC markers (Nestin and SOX2) from EGF and FGF primed MSCs was examined by using the specific Notch inhibitor, DAPT. Significant downregulation of Nestin and SOX2 at different time points (such as 6 hours, 12 hours, 24 hours, 36 hours, and 5 days) of DAPT treatment accentuates the role of Notch signaling in the conversion of MSCs to NSCs (Fig. 4). Interestingly, expression of SOX2 was not observed in the MSCs (without EGF and FGF priming). Immuno-phenotyping studies also described the significant downregulation of NSC markers, Nestin and Mushashi-1 on Notch inhibition compared with the respective controls (without DAPT) (Fig. 4 and Supplementary Fig. S1), indicating that Notch can also regulate the proliferation and self-renewal of NSCs (MacNicol et al., 2015). Altogether, the findings suggest that Notch signaling is essential for the transdifferentiation of MSCs into NSCs.

The Notch signaling pathway is an important determinant of NSC fate and has multiple roles in the regulation of NSC differentiation (Alexson et al., 2006; Grandbarbe et al., 2003; Morrison et al., 2000). To create neurogenic (neurons) and gliogenic (astrocytes and oligodendrocytes) differentiation, the hUCB-MSC-derived NSCs were seeded on to adherent plates and incubated with the tri-lineage cocktail medium. Subsequently, the cells in the spheres migrated away from the center and formed simple bipolar-/tripolar- (neuro and glial phenotype) shaped cells. To investigate the role of the Notch signaling pathway in the tripotential differentiation ability of hUCB-MSC-derived NSCs, the cells were treated with DAPT for 6 days. The various concentrations of DAPT—1, 2.5, and 10 μM caused a reduction of NSC growth and proliferation and its switch-over to neuronal fate.

Detectable neuronal differentiation (MAP2⁺ cells) was observed only at 10 μM, which, however, was significantly low when compared with the control (without DAPT) (Supplementary Fig. S2). Nelson et al. demonstrated that the inhibition of Notch signaling in chick retinal explants (embryonic day 4.5) with the treatment of 10 μM DAPT for 48 hours could increase neuronal differentiation greater than the control (without DAPT) (Nelson et al., 2006, 2007). The same study also describes that >10 μM of DAPT completely inhibited the retinal growth in the culture system. In this study, the expression of both neural (MAP2 and NEFH) and glial markers (GFAP, GLUL, and MBP) was significantly reduced in the continuous presence of 10 μM DAPT for 6 days (Figs. 5 and 6) (Cai et al., 2008).

FIG. 6.

Immunofluorescence images of tri-differentiated NSCs derived from hUCB-MSCs by using confocal microscopy. Representative fluorescent images of GFAP, CNPase, and MAP2 expression (arrows pointing in a, b, and c respectively) in tri-differentiated NSCs at 7 days postinduction, (a–c) without DAPT. (d–f) with DAPT (scale bar: 50 μm; magnification 20 × ). Color images available online at www.liebertpub.com/cell

The role of mature neuronal and glial markers in the in vitro derived NSCs is still unknown; however, these results corroborate with that of human neural stem/progenitor cells as described earlier (Oikari et al., 2016). In addition to this poor differentiation ability, Notch inhibition also resulted in reduced viability of the cells as seen from % PI-positive cells through flow cytometry (Fig. 5). Taken together, these results indicate that active Notch signaling is essential for propagation and differentiation of NSCs. In one study, Imayoshi et al. described the significance of Notch signaling in adult mice that lacks the expression of Rbpj^−/−; it is the DNA-binding protein that transcriptionally regulates Notch signaling (Castel et al., 2013). In adult mice brain lacking Rbpj, neurogenesis as well as gliogenesis was found to be totally lost after 3 months (Imayoshi et al., 2010).

Thus, the present results describe the role of Notch signaling in NSC formation and its tri-differentiation. To our knowledge, this study shows for the first time the importance of Notch signaling for the generation, maintenance, and differentiation ability of NSCs derived from human hUCB-MSCs.

Conclusion

This study concludes that Notch signaling represents an important determinant for trans-differentiation of hUCB-MSCs to NSCs and also for the derived NSCs' self-renewal and tri-differentiation ability. Inhibition of Notch signaling using specific γ-secretase inhibitor DAPT showed a significant reduction in sphere formation from hUCB-MSCs-derived NSCs along with poor cell viability. DAPT treatment also inhibited neuronal and glial differentiation of hUCB-MSCs-derived NSCs. It infers that the Notch signaling pathway is essential both for derivation of NSCs from hUCB-MSCs and for the derived NSCs' self renewal and tri-differentiation capability.

Footnotes

Acknowledgment

The authors would like to thank the Centre for Stem Cell Research (CSCR), Christian Medical College, Vellore, India, for providing access to flow cytometry and fluorescence microscopes. K.V. is supported by a National Post Doctoral Fellowship (N-PDF) (File No: PDF/2016/003652/LS) from Science and Engineering Research Board (SERB), Department of Science and Technology, Government of India. E.T.B. is supported by an INSPIRE fellowship for doctoral studies from the Department of Science and Technology (IF150287), Government of India. D.S. is supported by a “Fast Track Young Scientist” grant (YSS/2014/000027) from Science and Engineering Research Board (SERB), Department of Science and Technology, Government of India. This work was also supported by a start-up fund from VIT University.

Authors' Contributions

K.V., L.V.K.R., S.A., M.M., E.T.B., and J.P.B. conducted experiments. K.V. also analyzed data and wrote the article. D.S. designed the experiments, analyzed data, and wrote the article.

Author Disclosure Statement

The authors declare that no conflicting financial interests exist.

References

Ahmed

, Gan

H.T.

, Lam

C.S.

, Poonepalli

, Ramasamy

, Tay

, Tham

, and Yu

Y.H.

(2009). Transcription factors and neural stem cell self-renewal, growth and differentiation. Cell Adh. Migr., 3, 412–424.

Alexson

T.O.

, Hitoshi

, Coles

B.L.

, Bernstein

, and van der Kooy

(2006). Notch signaling is required to maintain all neural stem cell populations—Irrespective of spatial or temporal niche. Dev. Neurosci., 28, 34–48.

Andersson

E.R.

, Sandberg

, and Lendahl

(2011). Notch signaling: Simplicity in design, versatility in function. Development, 138, 3593–3612.

Barraud

, Thompson

, Kirik

, Bjorklund

, and Parmar

(2005). Isolation and characterization of neural precursor cells from the Sox1-GFP reporter mouse. Eur. J. Neurosci, 22, 1555–1569.

Cai

L.Z.

, Lin

, Hu

J.S.

, and Zheng

Z.H.

(2008). [Effects of gamma-secretase inhibitor N-(3, 5-difluorophenacetyl-L-alanyl)-S-phenylglycine t-butyl ester on proliferation and differentiation of neural stem cells]. Zhonghua Yi Xue Za Zhi, 88, 480–483.

Caminal

, Velez

, Rabanal

R.M.

, Vivas

, Batlle-Morera

, Aguirre

, Barquinero

, Garcia

, and Vives

(2016). A reproducible method for the isolation and expansion of ovine mesenchymal stromal cells from bone marrow for use in regenerative medicine preclinical studies. J. Tissue. Eng. Regen. Med. [Epub ahead of print]; DOI:10.1002/term.2254.

Cao

, Li

, Lee

, Liu

, Chen

, Wang

, Cai

, Chen

, and Wu

J.C.

(2009). Noninvasive de novo imaging of human embryonic stem cell-derived teratoma formation. Cancer Res. 69, 2709–2713.

Castel

, Mourikis

, Bartels

S.J.

, Brinkman

A.B.

, Tajbakhsh

, and Stunnenberg

H.G.

(2013). Dynamic binding of RBPJ is determined by Notch signaling status. Genes Dev. 27, 1059–1071.

Doe

C.Q.

(2008). Neural stem cells: Balancing self-renewal with differentiation. Development, 135, 1575–1587.

10.

Dominici

, Le Blanc

, Mueller

, Slaper-Cortenbach

, Marini

, Krause

, Deans

, Keating

, Prockop

, and Horwitz

(2006). Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy, 8, 315–317.

11.

Ellis

, Fagan

B.M.

, Magness

S.T.

, Hutton

, Taranova

, Hayashi

, McMahon

, Rao

, and Pevny

(2004). SOX2, a persistent marker for multipotential neural stem cells derived from embryonic stem cells, the embryo or the adult. Dev. Neurosci., 26, 148–165.

12.

Ferri

A.L.

, Cavallaro

, Braida

, Di Cristofano

, Canta

, Vezzani

, Ottolenghi

, Pandolfi

P.P.

, Sala

, DeBiasi

, and Nicolis

S.K.

(2004). Sox2 deficiency causes neurodegeneration and impaired neurogenesis in the adult mouse brain. Development, 131, 3805–3819.

13.

, Zhu

, Huang

, Lee

T.D.

, Forman

S.J.

, and Shih

C.C.

(2008). Derivation of neural stem cells from mesenchymal stem cells: Evidence for a bipotential stem cell population. Stem Cells Dev. 17, 1109–1121.

14.

Gage

F.H.

(2000). Mammalian neural stem cells. Science, 287, 1433–1438.

15.

Grandbarbe

, Bouissac

, Rand

, Hrabe de Angelis

, Artavanis-Tsakonas

, and Mohier

(2003). Delta-Notch signaling controls the generation of neurons/glia from neural stem cells in a stepwise process. Development, 130, 1391–1402.

16.

Hansson

E.M.

, Lanner

, Das

, Mutvei

, Marklund

, Ericson

, Farnebo

, Stumm

, Stenmark

, Andersson

E.R.

, and Lendahl

(2010). Control of Notch-ligand endocytosis by ligand-receptor interaction. J. Cell Sci., 123, 2931–2942.

17.

Hermann

, Gastl

, Liebau

, Popa

M.O.

, Fiedler

, Boehm

B.O.

, Maisel

, Lerche

, Schwarz

, Brenner

, and Storch

(2004). Efficient generation of neural stem cell-like cells from adult human bone marrow stromal cells. J. Cell Sci., 117, 4411–4422.

18.

Imayoshi

, Sakamoto

, Yamaguchi

, Mori

, and Kageyama

(2010). Essential roles of Notch signaling in maintenance of neural stem cells in developing and adult brains. J. Neurosci., 30, 3489–3498.

19.

Jaiswal

, Haynesworth

S.E.

, Caplan

A.I.

, and Bruder

S.P.

(1997). Osteogenic differentiation of purified, culture-expanded human mesenchymal stem cells in vitro. J. Cell. Biochem., 64, 295–312.

20.

Jakel

R.J.

, Schneider

B.L.

, and Svendsen

C.N.

(2004). Using human neural stem cells to model neurological disease. Nat. Rev. Genet., 5, 136–144.

21.

Kooreman

N.G.

, and Wu

J.C.

(2010). Tumorigenicity of pluripotent stem cells: Biological insights from molecular imaging. J. R. Soc. Interface, 7 Suppl 6, S753–S763.

22.

Kopan

, and Ilagan

M.X.

(2009). The canonical Notch signaling pathway: Unfolding the activation mechanism. Cell, 137, 216–233.

23.

Lois

, and Alvarez-Buylla

(1993). Proliferating subventricular zone cells in the adult mammalian forebrain can differentiate into neurons and glia. Proc. Natl. Acad. Sci. U. S. A., 90, 2074–2077.

24.

Louvi

, and Artavanis-Tsakonas

(2006). Notch signalling in vertebrate neural development. Nat. Rev. Neurosci., 7, 93–102.

25.

MacNicol

A.M.

, Hardy

L.L.

, Spencer

H.J.

, and MacNicol

M.C.

(2015). Neural stem and progenitor cell fate transition requires regulation of Musashi1 function. BMC Dev. Biol., 15, 15.

26.

Morrison

S.J.

, Perez

S.E.

, Qiao

, Verdi

J.M.

, Hicks

, Weinmaster

, and Anderson

D.J.

(2000). Transient Notch activation initiates an irreversible switch from neurogenesis to gliogenesis by neural crest stem cells. Cell, 101, 499–510.

27.

Nelson

B.R.

, Gumuscu

, Hartman

B.H.

, and Reh

T.A.

(2006). Notch activity is downregulated just prior to retinal ganglion cell differentiation. Dev. Neurosci., 28, 128–141.

28.

Nelson

B.R.

, Hartman

B.H.

, Georgi

S.A.

, Lan

M.S.

, and Reh

T.A.

(2007). Transient inactivation of Notch signaling synchronizes differentiation of neural progenitor cells. Dev. Biol., 304, 479–498.

29.

Nichols

J.T.

, Miyamoto

, Olsen

S.L.

, D'Souza

, Yao

, and Weinmaster

(2007). DSL ligand endocytosis physically dissociates Notch1 heterodimers before activating proteolysis can occur. J. Cell. Biol., 176, 445–458.

30.

Ohtsuka

, Sakamoto

, Guillemot

, and Kageyama

(2001). Roles of the basic helix-loop-helix genes Hes1 and Hes5 in expansion of neural stem cells of the developing brain. J. Biol. Chem., 276, 30467–30474.

31.

Oikari

L.E.

, Okolicsanyi

R.K.

, Griffiths

L.R.

, and Haupt

L.M.

(2016). Data defining markers of human neural stem cell lineage potential. Data Brief, 7, 206–215.

32.

Pevny

L.H.

, and Nicolis

S.K.

(2010). Sox2 roles in neural stem cells. Int. J. Biochem. Cell. Biol., 42, 421–424.

33.

Politis

(2010). Dyskinesias after neural transplantation in Parkinson's disease: What do we know and what is next?. BMC Med. 8, 80.

34.

Shi

, Sun

, Zhao

, and Stewart

(2008). Neural stem cell self-renewal. Crit. Rev. Oncol. Hematol., 65, 43–53.

35.

Suh

, Consiglio

, Ray

, Sawai

, D'Amour

K.A.

, and Gage

F.H.

(2007). In vivo fate analysis reveals the multipotent and self-renewal capacities of Sox2+ neural stem cells in the adult hippocampus. Cell Stem Cell, 1, 515–528.

36.

Venkatesh

, and Sen

(2017). Mesenchymal stem cells as a source of dopaminergic neurons: A potential cell based therapy for Parkinson's disease. Curr. Stem Cell Res. Ther., 12, 326–347.

37.

Venkatesh

, Srikanth

, Vengamma

, Chandrasekhar

, Prasad

B.C.

, and Sarma

P.V.

(2015). In vitro transdifferentiation of human cultured CD34+ stem cells into oligodendrocyte precursors using thyroid hormones. Neurosci. Lett., 588, 36–41.

38.

Venkatesh

, Srikanth

, Vengamma

, Chandrasekhar

, Sanjeevkumar

, Mouleshwara Prasad

B.C.

, and Sarma

P.V.

(2013). In vitro differentiation of cultured human CD34+ cells into astrocytes. Neurol. India, 61, 383–388.

39.

Xie

, Zeng

, Hu

, and Chen

(2015). Characterization of Nestin, a selective marker for bone marrow derived mesenchymal stem cells. Stem Cells Int., 2015, 762098.

40.

Yang

, Liu

, Tang

, Hu

, Zhang

, Pan

, Dong

, Zhang

, and Tang

(2015a). Generation of neurospheres from human adipose-derived stem cells. Biomed. Res. Int., 2015, 743714.

41.

Yang

, Pang

, Hu

, Lv

, He

, An

, Tang

, and Deng

(2015b). Nestin positive bone marrow derived cells responded to injury mobilize into peripheral circulation and participate in skin defect healing. PLoS One, 10, e0143368.

42.

Zhang

, and Cui

(2014). Sox2, a key factor in the regulation of pluripotency and neural differentiation. World J. Stem Cells, 6, 305–311.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.07 MB

0.17 MB