Overexpression of MBD3 Improves Reprogramming of Cloned Pig Embryos

Abstract

Methyl-CpG-binding domain protein 3 (MBD3) is a core component of the nucleosome remodeling and deacetylase (NuRD) complex, which is crucial for pluripotent stem cell differentiation and embryonic development. MBD3 was shown to play important roles in transcription factor-induced somatic cell reprogramming. Expression level of MBD3 was demonstrated to be higher in somatic cell nuclear transfer-generated cloned pig embryos than in fertilization-derived porcine embryos. However, the functions of MBD3 in nuclear transfer-mediated somatic cell reprogramming are unknown. In this study, MBD3 was overexpressed in cloned pig embryos, and the effects of MBD3 overexpression on gene transcription, DNA methylation, and in vitro developmental competence of cloned pig embryos were analyzed. Results indicated that overexpression of MBD3 in cloned pig embryos not only increased blastocyst rate and number of cells per blastocyst but also upregulated mRNA expression levels and decreased the DNA methylation of NANOG, OCT4, and LINE1 genes to the levels close to those in in vivo fertilization-produced pig embryos. These findings suggest that overexpression of MBD3 improves reprogramming of cloned pig embryos.

Introduction

The pig somatic cell nuclear transfer (SCNT) technique has valuable applications in the swine industry, human biomedicine, and life science (Pratt et al., 2006; Wolf et al., 2014; Zeyland et al., 2015; Zhao et al., 2010). However, this technique currently only has a success rate of ∼1% (number of born cloned piglets/number of transferred cloned embryos) (Li et al., 2018). The extremely low efficiency of the pig SCNT approach is believed to be caused by erroneous epigenetic reprogramming of the somatic cells in cloned embryos (Li et al., 2018; Niemann, 2016; Zhao et al., 2010).

Methyl-CpG-binding domain protein 3 (MBD3) is an essential component of the nucleosome remodeling and deacetylase (NuRD) complex, which acts as a vital epigenetic regulator of pluripotent stem cell (PSC) differentiation and embryonic development by coupling histone deacetylation and demethylation, nucleosome mobilization, and transcription factor recruitment (Allen et al., 2013; Hu and Wade, 2012; Kaji et al., 2009; McDonel et al., 2009; Zhang et al., 1999, 2018).

MBD3 is crucial for embryogenesis because knockout of MBD3 resulted in death of mouse embryos after implantation (Hendrich et al., 2001; Kaji et al., 2007). MBD3 also has important functions in the establishment or maintenance of pluripotency as MBD3-null embryonic stem cells were severely compromised in lineage commitment and failed to differentiate (Kaji et al., 2006; Reynolds et al., 2012a, 2012b).

Moreover, MBD3 plays vital roles in the induction of induced PSCs (iPSCs). Knockdown of MBD3 increased the efficiency of conversing mouse embryonic fibroblasts (MEFs) to iPSCs under OSKM (Oct4/Sox2/Klf4/cMyc) induction by ∼5- (Rais et al., 2013) and 10-fold (Luo et al., 2013). Nevertheless, overexpression of MBD3 and NANOG increased the efficiency of producing iPSCs from MEF-derived preiPSCs with MKO (cMyc/Klf4/Oct4) induction by up to 30-fold (dos Santos et al., 2014). Overexpression of MBD3 also improved the rate of reprogramming mouse neural progenitor cells to iPSCs following OSKM treatment by approximately five times (Zhang et al., 2016). These studies indicated that under different reprogramming contexts, MBD3 plays different yet important roles in transcription factor-induced somatic cell reprogramming.

However, the functions of MBD3 in nuclear transfer-mediated somatic cell reprogramming are unknown. Given that MBD3 expression level was shown to be lower in pig SCNT embryos than in fertilization-derived porcine embryos (Zhou et al., 2014), MBD3 may also play roles in reprogramming of cloned pig embryos. In the present study, the effects of MBD3 overexpression on developmental rate, gene expression, and DNA methylation of pig SCNT embryos were investigated after confirming that MBD3 transcription level is lower in cloned pig embryos than in fertilization-generated porcine embryos.

Materials and Methods

Ethics statement

This study was conducted in strict accordance with “The Instructive Notions with Respect to Caring for Laboratory Animals” issued by the Ministry of Science and Technology of China. The animal experimental protocol was approved by the Institutional Animal Care and Use Committee of South China Agricultural University. All efforts were made to minimize animal suffering.

Preparation of embryos

Cloned embryos and in vitro fertilization (IVF)-derived embryos were prepared as previously described (Shi et al., 2015). Sows showing signs of spontaneous estrus were artificially inseminated thrice with an interval of 12 hours between each insemination. Inseminated sows were anesthetized at 144 hours after the last insemination, and their uteri were exposed by surgery. In vivo fertilization (IVV)-generated blastocysts were flushed out from the uterine horns of sows.

Analysis of gene expression by relative and absolute quantitative polymerase chain reaction

Total RNA was extracted from the embryos or cells using the AllPrep DNA/RNA Micro Kit (Qiagen). cDNA was synthesized by using the QuantiTect Reverse Transcription Kit (Qiagen). Real-time quantitative polymerase chain reaction (RT-qPCR) was performed using the QuantiFast SYBR Green PCR Kit (Qiagen) and ABI Prism 7700 PCR machine. All gene expression analysis experiments were conducted in triplicate. The specificity of the PCR reaction was confirmed through a single peak in the melting curve. GAPDH was used as housekeeping gene to normalize gene expression. The relative gene expression was calculated from the average Ct values using the 2^−ΔΔCt method. Information of primers used for qPCR is shown in Table 1.

Table 1.

Information of Primers Used for Quantitative Polymerase Chain Reaction

Gene	Primer sequences (5′ to 3′)	Amplicon length (bp)
OCT4	F: GAGAGGCAACCTGGAGAGCA	104
OCT4	R: CGCGGACCACATCCTTCTCT	104
NANOG	F: AGGACAGCCCTGATTCTTCCACAA	198
NANOG	R: AAAGTTCTTGCATCTGCTGGAGGC	198
LINE1	F: CCCAAACAGACCCACACCAAGAC	168
LINE1	R: CATTCCCTCCTGGCCTGTAGTGT	168
MBD3	F: TGATTTCCGGACGGGCAAGATG	117
MBD3	R: ACCGGGAGGGCTGTGTTCAAGTC	117
GAPDH (internal control)	F: ATTGCCAGCCGCGTCCCT	218
GAPDH (internal control)	R: CTTCCCGTTCTCCGCCTTGACTGTG	218

Absolute qPCR analysis was conducted following a previously reported method (Ball et al., 2013; Leong et al., 2007). pcDNA-MBD3 vector was used as the standard template. The standard template dilution series was prepared by five steps of sequential 10-fold dilutions with 4.36 × 10⁸ copy of pcDNA-MBD3 vector as the starting copy number. Then standard template dilution series was amplified by qPCR using SYBR Select Master Mix and the QuantStudio™ 7 Flex Real-Time PCR System (Thermo Fisher Scientific, MA).

The standard curve was plotted according to the Ct values of the diluted standard templates and the logarithm of the corresponding template copy number. The resulting standard curve formula was as follows: y = −0.2715x + 11.385 (y represents log10 of copy number, and x represents Ct value). The R² was 0.996. The Ct value of tested sample was put into the standard curve formula to calculate the corresponding mRNA copy number.

Construction of plasmid

A DNA fragment containing the Kozak sequence fused to the coding sequences of porcine MBD3 gene (GenBank acc. no. XM_003122994.2) was synthesized and inserted between the NheI and XhoI sites at the multiple cloning sites of pcDNA3.1+ vector (Invitrogen; Thermo Fisher Scientific, Inc.) to generate pcDNA-MBD3 vector.

Injection of plasmid into cloned embryos

Plasmid was microinjected into the cytoplasm of one-cell-stage cloned embryos at a concentration of 10 ng/μL, and the injection volume was ∼10 pL per embryo.

Analysis of in vitro developmental indexes of cloned embryos

The cleavage and blastocyst rates of cultured embryos were assessed at 24 and 168 hours postactivation, respectively. The total cell number of blastocysts was counted 168 hours postactivation by staining the embryos with 1 mg/mL Hoechst33342 and viewing cell nuclei under a fluorescence microscope.

Analysis of DNA methylation by bisulfite-specific PCR (BS-PCR)

The promoter sequences of NANOG and LINE1 were submitted to the website (www.urogene.org/methprimer2/) for CpG island search and PCR amplification primer design. Twenty of one-cell-stage embryos, 20 of four-cell-stage embryos, 15 of eight-cell-stage embryos and 10 of morula stage embryos were, respectively, mixed as one sample for measuring the promoter DNA methylation degree at each tested embryonic stage by bisulfite-specific PCR (BS-PCR). BS-PCR was performed following our previous description (Zeng et al., 2016). Information of primers used for BS-PCR is shown in Table 2.

Table 2.

Information of primers used for Bisulfite-Specific Polymerase Chain Reaction

Gene	Primer sequences (5′ to 3′)	Amplicon length (bp)	CpG no.
LINE1	F: TTTGGGAGGTTTTTAAATTATTTGA	195	6
LINE1	R: TATTCTATAAAAACCCACCCCTTCT	195	6
NANOG	F: AATAAGTTTGAATTGGAGATTTAAAG	263	18
NANOG	R: ATCTCCTCCAAATATTAAAAATATCA	263	18

Statistical analysis

Chi-square analysis was performed to compare cleavage and blastocyst rates between the two groups of embryos. One-way analysis of variance (ANOVA) post hoc multiple comparison [least significant different (LSD) method] analysis in SPSS 17.0 software was used to compare differences in gene expression levels among different groups. Differences were considered significant at p < 0.05.

Results

Relative MBD3 mRNA levels in pig gametes, fibroblasts, preimplantation SCNT embryos, and fertilization-derived embryos

Adult fibroblasts, the nuclear donor cells for cloned pig embryos, contain a lower MBD3 mRNA level compared with porcine sperms and oocytes (Fig. 1). Cloned pig embryos also express a lower MBD3 mRNA level than IVF-produced pig embryos at the two-cell, eight-cell, morula, and blastocyst stages (Fig. 1A). These results are consistent with those reported by a previous study (Zhou et al., 2014) and led us to hypothesize that the decreased MBD3 expression level is related to the developmental defects in cloned pig embryos. Therefore, in the following experiments, a porcine MBD3 expression plasmid is constructed and injected into cloned pig embryos to investigate its effects on developmental rate, gene expression, and DNA methylation of injected SCNT embryos.

FIG. 1.

(A). Relative MBD3 mRNA levels in gametes, donor cells (fibroblasts), IVF, and SCNT preimplantation embryos. The relative MBD3 mRNA level of all tested samples was normalized to that of oocytes, which was defined as 1. Values of sperms, oocytes, and fibroblasts labeled with different uppercase letters differ from each other at p < 0.01. Values at the same embryonic stage labeled with different uppercase letters differ from each other at p < 0.01. (B). The MBD3 mRNA copy number in gametes and donor cells (fibroblasts). IVF, in vitro fertilization; MBD3, methyl-CpG-binding domain protein 3; NT, not tested; SCNT, somatic cell nuclear transfer.

Construction and validation of MBD3 expression vector in fibroblasts and SCNT embryos

A porcine MBD3 expression plasmid was constructed and named pcDNA-MBD3 (Fig. 2A). The backbone plasmid used for pcDNA-MBD3 construction was utilized as control and designated pcDNA-empty (Fig. 2B). Transfection of pcDNA-MBD3 vector into pig fibroblasts resulted in a much higher expression level of MBD3 than that from transfection of control plasmid (Fig. 2C). Injection of pcDNA-MBD3 plasmid into one-cell-stage cloned pig embryos resulted in higher MBD3 expression levels at the four- and eight-cell stages than those in control cloned embryos injected with pcDNA-empty plasmid (Fig. 2D).

FIG. 2.

Construction and validation of MBD3 expression vector in donor cells and SCNT embryos. (A) Map of pcDNA-MBD3 plasmid. (B) Map of pcDNA-empty plasmid. (C) MBD3 expression level in fibroblasts transfected with pcDNA-MBD3 plasmid and pcDNA-empty plasmid. (D) MBD3 expression level in cloned embryos injected with pcDNA-MBD3 plasmid and pcDNA-empty plasmid. Values at the same embryonic stage labeled with different uppercase letters differ from each other at p < 0.01.

Effects of MBD3 overexpression on developmental capacity of cloned embryos

As shown in Table 3, two in vitro developmental indexes, including blastocyst rate and number of cells per blastocyst, of cloned pig embryos injected with pcDNA-MBD3 vector were higher than those of SCNT embryos injected with control plasmid (20.3% vs. 7.4%, p < 0.05 and 48.5 ± 3.3 vs. 35.5 ± 3.2, p < 0.05).

Table 3.

Effects of MBD3 Overexpression on In Vitro Development of Porcine Somatic Cell Nuclear Transfer Embryos

Groups	No. of injected embryos (preparation no.)	No. of cleaved embryos (%)	No. of blastocysts (%)	No. of cells per blastocyst mean (±SEM) (stained embryo no.)
pcDNA-empty	148 (3)	107 (72.3)	11 (7.4)^b	35.5 ± 3.2^b (11)
pcDNA-MBD3	143 (3)	120 (83.9)	29 (20.3)^a	48.5 ± 3.3^a (29)

Values in the same column labeled with different lowercase letters differ from each other at p < 0.05.

MBD3, methyl-CpG-binding domain protein 3; SEM, standard error of the mean.

Effects of MBD3 overexpression on NANOG, OCT4, and LINE1 expression in cloned embryos

Given that MBD3 plays important roles in regulating pluripotency, the effects of MBD3 overexpression on the expression of two pluripotency genes, NANOG and OCT4, in cloned pig embryos were examined. The mRNA levels of NANOG and OCT4 in cloned embryos injected with pcDNA-MBD3 plasmid were higher than those in control SCNT embryos at the four-cell and morula stages and close to those in IVV embryos at the morula stage (Fig. 3A, B).

FIG. 3.

Effects of MBD3 overexpression on transcription levels of NANOG, OCT4, and LINE1 genes in SCNT preimplantation embryos. (A–C) NANOG, OCT4, and LINE1 expression levels in IVV embryos, SCNT embryos injected with pcDNA-MBD3 plasmid, and SCNT embryos injected with pcDNA-empty plasmid, respectively. Values at the same embryonic stage labeled with different uppercase and lowercase letters differ from each other at p < 0.01 and p < 0.05, respectively. IVV, in vivo fertilization.

mRNA abundance of the genome-wide distributed LINE1 gene was measured to investigate the effects of MBD3 overexpression on genomic activation of pig SCNT embryos. Results showed that LINE1 expression level in pcDNA-MBD3 plasmid-injected cloned embryos was higher than that in control SCNT embryos at the four-cell and morula stages and similar to that in IVV embryos at the morula stage (Fig. 3C). These findings indicate that overexpression of MBD3 in cloned embryos upregulates the expression levels of NANOG, OCT4, and LINE1 to the levels close to those in IVV embryos.

Effects of MBD3 expression on DNA methylation of NANOG and LINE1 promoters in cloned embryos

Given that MBD3 can trigger DNA demethylation (Cui et al., 2016), the promoter DNA methylation degree of NANOG and LINE1 genes was analyzed to examine whether the MBD3-induced upregulation of NANOG and LINE1 expression in cloned pig embryos is related to DNA demethylation. Results indicated that although the DNA methylation levels of NANOG and LINE1 promoters in pcDNA-MBD3 plasmid-injected cloned embryos were similar to those in control SCNT and IVV embryos at the morula stage, they were lower than those in control SCNT embryos at the four- and eight-cell stages (Fig. 4). These findings suggest that MBD3 enhances the expression of LINE1 and pluripotency genes by decreasing the DNA methylation level of their promoters.

FIG. 4.

Effects of MBD3 overexpression on DNA methylation of LINE-1 and NANOG promoters in SCNT preimplantation embryos. (A, B) NANOG and LINE1 promoter DNA methylation levels in IVV embryos, SCNT embryos injected with pcDNA-MBD3 plasmid, and SCNT embryos injected with pcDNA-empty plasmid, respectively. Filled (black) circles correspond to methylated Cs, unfilled (white) circles correspond to unmethylated Cs, and small vertical lines without a circle correspond to missing values. (C, D) NANOG and LINE1 promoter DNA methylation dynamics plot corresponding to upper plot A and B, respectively.

Discussion

In this study, we demonstrated that cloned pig embryos have a lower MBD3 expression level than IVF embryos during preimplantation stages. This finding is in agreement with that reported by a previous study (Zhou et al., 2014). The difference in MBD3 expression level between fibroblast-derived cloned embryos and gamete-generated IVF embryos might be related to the difference in MBD3 transcript levels between fibroblasts and gametes because fibroblasts have a lower MBD3 mRNA abundance than sperms and oocytes, as shown in the present study.

Our data indicate that the overexpression of MBD3 in pig SCNT embryos not only improves blastocyst rate but also increases the number of cells per blastocyst. The enhancement of developmental competence of cloned embryos overexpressing MBD3 could be due to the upregulation of NANOG and OCT4 expression. These two genes are crucial for the establishment and/or maintenance of pluripotency during mammalian embryo development (Miyanari and Torres-Padilla, 2010; Onichtchouk and Driever, 2016; Wu and Schöler, 2014). However, the expression levels of NANOG and OCT4 in cloned mammalian embryos are usually lower than those in fertilization-derived counterparts during preimplantation stages, and elevation of NANOG and OCT4 expression levels is associated with improvement of developmental efficiency in preimplantation cloned embryos (Cervera et al., 2009; Ji et al., 2013; Lee et al., 2014; Ma et al., 2014; Oh et al., 2012; Song et al., 2014; Xing et al., 2009).

Interestingly, the expression level of another MBD family member, methyl-CpG-binding protein 2 (MeCP2), was also found lower in cloned mouse embryos than in intracytoplasmic sperm injection-derived fertilized mouse embryos, and overexpression of MeCP2 in donor cells enhanced the developmental rate of cloned mouse embryos and the transcription level of NANOG and OCT4 (Wang et al., 2016). The increase in developmental potential of cloned embryos overexpressing MBD3 could also be due to the increased expression of LINE1, which is the most abundant retrotransposons in mammalian genomes. The expression of this repetitive element, LINE1, is crucial for the early development of mammalian embryos (Belan, 2013; Gifford et al., 2013; Spadafora, 2008, 2016).

The upregulation of NANOG, OCT4, and LINE1 transcription in cloned pig embryos overexpressing MBD3 seems to be related to DNA demethylation on their promoters, as demonstrated in this study. MBD3 has been shown to participate in DNA demethylation (Brown and Szyf, 2007; Cui et al., 2016). It enhances Tet2-mediated DNA demethylation by strengthening the binding affinity between Tet2 and the DNA target (Peng et al., 2016). MBD3 also colocalizes with DNMT1 during DNA maintenance methylation to protect against an excessive DNA methylation induced by DNMT1 (Cui and Irudayaraj, 2015). Therefore, the overexpression of MBD3 in cloned pig embryos promotes DNA demethylation on NANOG, OCT4, and LINE1 genes to enhance their expressions.

In conclusion, the overexpression of MBD3 enhances the in vitro developmental efficiency of cloned pig embryos by upregulating mRNA expression and decreasing DNA methylation of NANOG, OCT4, and LINE1 genes.

Footnotes

Acknowledgments

This study was supported by a grant from the National Natural Science Foundation of China (grant no. 31772554) and three grants from the Department of Science and Technology of Guangdong Province, China (grant nos. 2016B020233006, 2018B030314004, and 2016A020210074).

Author Disclosure Statement

The authors declare that no conflicting financial interests exist.

References

Allen

H.F.

, Wade

P.A.

, and Kutateladze

T.G.

(2013). The NuRD architecture. Cell. Mol. Life Sci. 70, 3513–3524.

Ball

H.C.

, Holmes

R.K.

, Londraville

R.L.

, Thewissen

J.G.

, and Duff

R.J.

(2013). in whales: Validation and measurement of mRNA expression by absolute quantitative real-time PCR. PLoS One 8, e54277.

Belan

(2013). LINEs of evidence: Noncanonical DNA replication as an epigenetic determinant. Biol Direct 8, 22.

Brown

S.E.

, and Szyf

(2007). Epigenetic programming of the rRNA promoter by MBD3. Mol. Cell. Biol. 27, 4938–4952.

Cervera

, Marti-Gutierrez

, Escorihuela

, Moreno

, and Stojkovic

(2009). Trichostatin A affects histone acetylation and gene expression in porcine somatic cell nucleus transfer embryos. Theriogenology, 72, 1097–1110.

Cui

, Duan

, Zhao

, Chen

, Sun

, Deng

, Zhang

, Du

, Chen

, and Gu

(2016). MBD3 mediates epigenetic regulation on EPAS1 promoter in cancer. Tumor Biol. 37, 13455–13467.

Cui

, and Irudayaraj

(2015). Dissecting the behavior and function of MBD3 in DNA methylation homeostasis by single-molecule spectroscopy and microscopy. Nucleic Acids Res. 43, 3046–3055.

dos Santos

R.L.

, Tosti

, Radzisheuskaya

, Caballero

I.M.

, Kaji

, Hendrich

, and Silva

J.C.

(2014). MBD3/NuRD facilitates induction of pluripotency in a context-dependent manner. Cell Stem Cell, 15, 102–110.

Gifford

W.D.

, Pfaff

S.L.

, and Macfarlan

T.S.

(2013). Transposable elements as genetic regulatory substrates in early development. Trends Cell Biol. 23, 218–226.

10.

Hendrich

, Guy

, Ramsahoye

, Wilson

V.A.

, and Bird

(2001). Closely related proteins MBD2 and MBD3 play distinctive but interacting roles in mouse development. Genes Dev. 15, 710–723.

11.

, and Wade

P.A.

(2012). NuRD and pluripotency: A complex balancing act. Cell Stem Cell, 10, 497–503.

12.

, Zhu

, Liu

, Song

, Huang

, Zhao

, Chen

, He

, Mo

, and Cong

(2013). Improvement of porcine cloning efficiency by trichostain A through early-stage induction of embryo apoptosis. Theriogenology, 79, 815–823.

13.

Kaji

, Caballero

I.M.

, MacLeod

, Nichols

, Wilson

V.A.

, and Hendrich

(2006). The NuRD component Mbd3 is required for pluripotency of embryonic stem cells. Nat. Cell. Biol. 8, 285–292.

14.

Kaji

, Nichols

, and Hendrich

(2007). Mbd3, a component of the NuRD co-repressor complex, is required for development of pluripotent cells. Development, 134, 1123–1132.

15.

Kaji

, Norrby

, Paca

, Mileikovsky

, Mohseni

, and Woltjen

(2009). Virus-free induction of pluripotency and subsequent excision of reprogramming factors. Nature, 458, 771–775.

16.

Lee

J.-H.

, Lee

W.-J.

, Jeon

R.-H.

, Lee

Y.-M.

, Jang

S.-J.

, Lee

S.-L.

, Jeon

B.-G.

, Ock

S.-A.

, King

W.A.

, and Rho

G.-J.

(2014). Development and gene expression of porcine cloned embryos derived from bone marrow stem cells with overexpressing Oct4 and Sox2. Cell. Reprogram. 16, 428–438.

17.

Leong

D.T.

, Gupta

, Bai

H.F.

, Wan

G.Q.

, Yoong

L.F.

, Too

H.P.

, Chew

F.T.

, and Hutmacher

D.W.

(2007). Absolute quantification of gene expression in biomaterials research using real-time PCR. Biomaterials, 28, 203–210.

18.

, Yue

, Ao

, Zhao

, Shi

, Zhao

, Zeng

, Cai

, Zheng

, and Yang

(2018). Maternal dietary supplementation of arginine increases the ratio of total cloned piglets born to total transferred cloned embryos by improving the pregnancy rate of recipient sows. Anim. Reprod. Sci. 196, 211–218.

19.

Luo

, Ling

, Xie

, Sun

, Zhou

, Zhu

, Shen

, Zong

, Lyu

, Zhao

, et al. (2013). NuRD blocks reprogramming of mouse somatic cells into pluripotent stem cells. Stem Cells, 31, 1278–1286.

20.

L.-B.

, He

X.-Y.

, Wang

F.-M.

, Cao

J.-W.

, and Cheng

(2014). The development and expression of pluripotency genes in embryos derived from nuclear transfer and in vitro fertilization. Zygote, 22, 540–548.

21.

McDonel

, Costello

, and Hendrich

(2009). Keeping things quiet: Roles of NuRD and Sin3 co-repressor complexes during mammalian development. Int. J. Biochem. Cell Biol. 41, 108–116.

22.

Miyanari

, and Torres-Padilla

M.-E.

(2010). Epigenetic regulation of reprogramming factors towards pluripotency in mouse preimplantation development. Curr. Opin. Endocrinol. Diabetes Obes. 17, 500–506.

23.

Niemann

(2016). Epigenetic reprogramming in mammalian species after SCNT-based cloning. Theriogenology, 86, 80–90.

24.

H.J.

, Lee

T.H.

, Lee

J.H.

, and Lee

B.C.

(2012). Trichostatin a improves preimplantation development of bovine cloned embryos and alters expression of epigenetic and pluripotency genes in cloned blastocysts. J. Veter. Med. Sci. 74, 1409–1415.

25.

Onichtchouk

, and Driever

(2016). Zygotic genome activators, developmental timing, and pluripotency. Curr. Top. Dev. Biol. 116, 273–297.

26.

Peng

, Li

, Xi

, Li

, Lv

, Zhang

, Zou

, Dong

, and Luo

(2016). MBD3L2 promotes Tet2 enzymatic activity for mediating 5-methylcytosine oxidation. J. Cell Sci. 129, 1059–1071.

27.

Pratt

S.L.

, Sherrer

E.S.

, Reeves

D.E.

, and Stice

S.L.

(2006). Factors influencing the commercialisation of cloning in the pork industry. Soc. Reprod. Fertil. Suppl. 62, 303–315.

28.

Rais

, Zviran

, Geula

, Gafni

, Chomsky

, Viukov

, Mansour

A.A.

, Caspi

, Krupalnik

, Zerbib

, et al. (2013). Deterministic direct reprogramming of somatic cells to pluripotency. Nature, 502, 65–70.

29.

Reynolds

, Latos

, Hynes-Allen

, Loos

, Leaford

, O'Shaughnessy

, Mosaku

, Signolet

, Brennecke

, Kalkan

, et al. (2012a). NuRD suppresses pluripotency gene expression to promote transcriptional heterogeneity and lineage commitment. Cell Stem Cell, 10, 583–594.

30.

Reynolds

, Salmon-Divon

, Dvinge

, Hynes-Allen

, Balasooriya

, Leaford

, Behrens

, Bertone

, and Hendrich

(2012b). NuRD-mediated deacetylation of H3K27 facilitates recruitment of Polycomb Repressive Complex 2 to direct gene repression. EMBO J. 31, 593–605.

31.

Shi

, Zhou

, Luo

, Mai

, Zeng

, He

, Liu

, Zeng

, Cai

, and Ji

(2015). Influence of embryo handling and transfer method on pig cloning efficiency. Anim. Reprod. Sci. 154, 121–127.

32.

Song

, Ji

, Zhao

, Nie

, He

, Chen

, and Cong

(2014). Ectopic expression of reprogramming factors enhances the development of cloned porcine embryos. Biotechnol. Lett. 36, 1953–1961.

33.

Spadafora

(2008). A reverse transcriptase-dependent mechanism plays central roles in fundamental biological processes. Syst. Biol. Reprod. Med. 54, 11–21.

34.

Spadafora

(2016). Soma to germline inheritance of extrachromosomal genetic information via a LINE-1 reverse transcriptase-based mechanism. BioEssays, 38, 726–733.

35.

Wang

Z.-D.

, Duan

, Zhang

Z.-H.

, Song

S.-H.

, Bai

G.-Y.

, Zhang

, Shen

X.-H.

, Shen

J.-L.

, and Lei

(2016). Methyl-CpG–binding protein 2 improves the development of mouse somatic cell nuclear transfer embryos. Cell. Reprogram. 18, 78–86.

36.

Wolf

, Braun-Reichhart

, Streckel

, and Renner

(2014). Genetically engineered pig models for diabetes research. Transgenic Res. 23, 27–38.

37.

, and Schöler

H.R.

(2014). Role of Oct4 in the early embryo development. Cell Regen. 3, 7.

38.

Xing

, Magnani

, Lee

, Wang

, Cabot

R.A.

, and Machaty

(2009). Gene expression and development of early pig embryos produced by serial nuclear transfer. Mol. Reprod. Dev. 76, 555–563.

39.

Zeng

, Li

, Cai

, Gao

, Jiang

, Liu

, Urschitz

, Moisyadi

, and Wu

(2016). Characterization of growth and reproduction performance, transgene integration, expression, and transmission patterns in transgenic pigs produced by piggyBac transposition-mediated gene transfer. Anim. Biotechnol. 27, 245–255.

40.

Zeyland

, Lipinski

, and Slomski

(2015). The current state of xenotransplantation. J. Appl. Genet. 56, 211–218.

41.

Zhang

, Zheng

, Sun

, Zhang

, Yan

, Chen

, and Jiang

(2016). MiR-134-Mbd3 axis regulates the induction of pluripotency. J. Cell. Mol. Med. 20, 1150–1158.

42.

Zhang

, Ng

H.H.

, Erdjument-Bromage

, Tempst

, Bird

, and Reinberg

(1999). Analysis of the NuRD subunits reveals a histone deacetylase core complex and a connection with DNA methylation. Genes Dev. 13, 1924–1935.

43.

Zhang

, Zhai

, Ma

, Zhang

, An

, Yu

, and Li

(2018). Down-regulation of H3K4me3 by MM-102 facilitates epigenetic reprogramming of porcine somatic cell nuclear transfer embryos. Cell. Physiol. Biochem. 45, 1529–1540.

44.

Zhao

, Whyte

, and Prather

R.S.

(2010). Effect of epigenetic regulation during swine embryogenesis and on cloning by nuclear transfer. Cell Tissue Res. 341, 13–21.

45.

Zhou

, Cao

, Wu

, Liu

, Tao

, Chen

, Song

, Han

, Li

, Fang

, et al. (2014). Dynamic changes of histone H3 lysine 27 acetylation in pre-implantational pig embryos derived from somatic cell nuclear transfer. Anim. Reprod. Sci. 148, 153–163.