Treatments of Porcine Nuclear Recipient Oocytes and Somatic Cell Nuclear Transfer-Generated Embryos with Various Reactive Oxygen Species Scavengers Lead to Improvements of Their Quality Parameters and Developmental Competences by Mitigating Oxidative Stress-Related Impacts

Abstract

This study investigated the antioxidant effects of β-cryptoxanthin (BCX), hesperetin (HES), and icariin (ICA), and their effects on in vitro maturation of porcine oocytes and subsequent embryonic development of somatic cell nuclear transfer (SCNT). Treatment with 1 μM BCX (BCX-1) increased the developmental rate of porcine oocytes more than treatment with 100 μM HES (HES-100) or 5 μM ICA (ICA-5). The glutathione level and mRNA expression of antioxidant genes (NFE2L2, SOD1, and SOD2) were more increased in the BCX-1 group than in the HES-100 and ICA-5 groups, while the reactive oxygen species level was more decreased. Moreover, BCX improved the developmental capacity and quality of SCNT embryos. The total cell number, apoptotic cell rate, and development-related gene expression were modulated in the BCX-1 group to enhance embryonic development of SCNT. These results show that the antioxidant effects of BCX enhance in vitro maturation of porcine oocytes and subsequent embryonic development of SCNT.

Introduction

Somatic cell nuclear transfer (SCNT) is a valuable technique for cloning livestock. Transgenic pigs (Grupen, 2014), sheep (Wilmut et al., 1997), cattle (Kim et al., 2011), and mice (Wakayama et al., 1998) have been produced by SCNT, and an enhanced green fluorescent protein-expressing pig (Kawarasaki et al., 2009) and recombinant lactoferrin-expressing cow (Yang et al., 2008) have also been produced by SCNT.

Pigs have similar anatomical and physiological characteristics as humans and are appropriate to produce animal models for interspecies transplantation (Whyte and Prather, 2011), and human diseases such as cardiovascular disease, cancer, diabetes, and Alzheimer's disease (Perleberg et al., 2018). Although SCNT-mediated assisted reproductive technologies (ARTs) have been successfully used to create and multiply cloned pigs and other mammalian species, there are still biotechnological and biological problems related to relatively or extremely low efficacy noticed for SCNT-based generation of cloned specimens, which limits, to a high extent, the applicability of somatic cell cloning to biomedical and transgenic research (Eun et al., 2022; Rao et al., 2021; Samiec et al., 2022).

It is beyond any doubt that the requirement of improving the efficacy of SCNT-based ARTs can only be achieved by thoroughly identifying the molecular and epigenetic factors affecting the propagation of nuclear-transferred oocytes and corresponding cloned embryos (Samiec and Skrzyszowska, 2021; Zhang et al., 2021). Among the aforementioned factors, one of the most important seems to be a molecular suitability of nuclear donor cells (NDCs) for somatic cell cloning, which is considerably biased by the type and origin of NDCs as well as the strategies utilized for the ex vivo synchronization of their mitotic cycle at the G0/G1 stages (Lee et al., 2019; Opiela et al., 2017; Zhang et al., 2018).

A pivotal role is also played by the molecular quality of in vitro cultured nuclear recipient oocytes, which is dependent on the correct completion and coordination of processes of their meiotic, cytoplasmic, and epigenomic maturation (Gorczyca et al., 2022; Gupta et al., 2019; Yin et al., 2021). Furthermore, the effectiveness of creating cloned embryos is determined by the approaches used to artificially activate the SCNT-derived oocytes (de Macedo et al., 2019; Ongaratto et al., 2020; Samiec et al., 2012). Finally, both the capabilities of donor cell nuclei to epigenetically reprogram their transcriptomic landscapes (Jeong et al., 2021; Wiater et al., 2021; Zhai et al., 2022) and intergenomic communication between nuclear and mitochondrial compartments (Samiec, 2005; Samiec and Skrzyszowska, 2021; Takeda, 2019; Yin et al., 2019) appear to have significant impacts on the developmental competences of cloned embryos.

It is worth highlighting that both effectiveness of propagating somatic cell-cloned embryos and their quality are largely dependent on the in vitro culture (IVC) conditions specified for NDCs, nuclear recipient oocytes, and nuclear-transferred embryos due to paramount significance of extracorporeal environment-related factors for frequency of occurrence of such processes as oxidative stress and apoptotic cell death (Fang et al., 2022a; Martinez et al., 2017). Therefore, it is a great importance to maximize the efficiency of SCNT by changing several elements such as hormones, growth factors, and antioxidants, as well as culture conditions (Huang et al., 2011; Hyun et al., 2016; Liang et al., 2017; Pyeon et al., 2022).

β-cryptoxanthin (BCX) is a carotenoid abundant in fruits such as tangerines and peaches, and is a precursor of vitamin A, including antioxidant effects, which scavenges free radicals and suppresses lipid peroxidation (Burri et al., 2016; Fu et al., 2010; Miller et al., 1996). This vitamin has several useful functions, including antioxidant effects and roles in cell-to-cell communication (Burri et al., 2016). Previous studies have shown that BCX promotes oocyte maturation and improves in vitro development (Park et al., 2018). Hesperetin (HES) is a flavonoid found in fruits such as oranges and grapes (De Souza et al., 2016; Hwang et al., 2012). This compound has several beneficial effects such as antioxidant and anti-inflammatory effects (Sarian et al., 2017).

HES functions antioxidant effects and improves oocyte nuclear and cytoplasmic maturation and the embryo development in vitro, by reducing the reactive oxygen species (ROS) level (Kim et al., 2019; Shoorei et al., 2019). Icariin (ICA) is a chemical compound classified as a prenylated flavonol glycoside, a type of flavonoid. It is the 8-prenyl derivative of kaempferol 3,7-O-diglucoside. Flavonoid glycosides, which are found in nature, have many pharmacological activities, including antioxidant and inflammatory effect, and antitumor effects (Liu et al., 2020). ICA protects porcine oocytes from age-related damage in vitro (Yoon et al., 2021).

This study compared the developmental capacity in BCX, HES and ICA of porcine oocytes during in vitro maturation (IVM), the antioxidative effects of BCX, HES, and ICA of SCNT embryos during IVC, and the developmental capacity of SCNT embryos. We examined the developmental rate and ROS level of SCNT embryo, as well as subsequent embryo developmental competence and blastocyst quality.

Materials and Methods

Chemicals and reagents

All chemicals and reagents were purchased from Merck (Merck Millipore, Darmstadt, Germany), unless stated otherwise. The oocytes, embryos, and the somatic cells were cultured in a CO₂ incubator (38.8°C, atmosphere of 5% CO₂ and 95% air).

Oocyte collection and IVM

Prepubertal porcine ovaries were collected from a local slaughterhouse and transported to the laboratory in saline supplemented with 75 μg/mL penicillin G (P0142.0100; Duchefa Biochemie) and 50 μg/mL streptomycin sulfate (S0148.0050; Duchefa Biochemie) within 2 hours at 30°C–33°C. Cumulus-oocyte complexes (COCs) measuring 2–8 mm in diameter were aspirated from ovarian follicles using an 18-gauge needle attached to a disposable 10 mL syringe. COCs were washed in tissue culture medium (TCM)-199–HEPES containing 0.1% (w/v) bovine serum albumin (BSA; A7888).

Thereafter, groups of 15 COCs were matured in 50 μL of TCM-199 (31100-035; Gibco, Grand Island, NY) containing Earle's salts, 0.57 mM cysteine, 10 ng/mL epidermal growth factor, 0.5 μg/mL follicle-stimulating hormone, 0.5 μg/mL luteinizing hormone, and 10% (v/v) porcine follicular fluid under mineral oil for 44 hours. COCs were cultured in IVM medium containing 1% DMSO, 1 μM BCX (0317S; Extrasynthese), 100 μM HES (H4125), or 5 μM ICA (H4125).

PA and IVC

Following 44 hours of maturation, cumulus cells were removed by pipetting in the presence of 1 mg/mL hyaluronidase for 2–3 minutes. Oocytes were parthenogenetically activated with 5 μM Ca²⁺ ionomycin (CI; 10634) for 5 minutes. After 4 hours of culture in porcine zygote medium (PZM)-5 containing 7.5 μg/mL cytochalasin B (CB; C6762), embryos were washed thrice in PZM-5 containing 0.4% (w/v) BSA and cultured in the same medium for 7 days. Oocytes and embryos were washed in Dulbecco's phosphate-buffered saline (DPBS) and either fixed in 4.0% (w/v) paraformaldehyde for 20 minutes and stored at 4°C or snap-frozen in liquid nitrogen and stored at −90°C, depending on the experiment. Experiments were independently repeated six times.

SCNT and IVC

Following 36 hours of maturation, cumulus cells were removed by gently pipetting in the presence of 1 mg/mL hyaluronidase for 2–3 minutes. The recipient's first polar body and nucleus were extracted in HEPES-buffered TCM-199 containing 0.4% (w/v) BSA and 7.5 μg/mL CB using a 20 μm glass pipette under an Oosight Imaging System (Cambridge Research & Instrumentation, Inc.). Donor fibroblasts for SCNT originated from Jeju black. Cells were cultured in Dulbecco's modified Eagle's medium (DMEM; 11995-065, Gibco, Grand Island, NY) containing 10% fetal bovine serum (FBS; SH30084.03, HyClone, Logan, UT), 0.1 mM b-mercaptoethanol (21985-023; Gibco), and 1% penicillin/streptomycin (15140-22; Gibco). Cells at passage 10–12 were cultured for 2–3 days until they reached confluency and expanded by passage. The donor cell was inserted into the perivitelline space surrounding the cytoplasm.

Karyoplast–cytoplast complexes were fused in fusion medium containing 0.3 M D-mannitol, 0.5 mM HEPES (H3375), 0.05% (w/v) fatty acid-free BSA (FAF-BSA; A8806), 0.05 mM CaCl₂ (C5670), and 0.1 mM MgSO₄ (M7506). Inserted donor cells were aligned to the negative electrode in a fusion chamber (Nepa Gene) and exposed to a direct current of 105 V/cm for 60 μsec. After fusion, reconstructed embryos were activated in the presence of 7.5 μg/mL CB for 4 hours and then transferred to PZM-5 supplemented with 0.4% (w/v) FAF-BSA containing or lacking 1 μM BCX. The percentages of cleaved embryos and blastocysts were recorded on days 2 and 7, respectively. Each experiment was independently repeated four times.

Measurement of intracellular ROS and glutathione levels

Dichlorohydrofluorescein diacetate (DCHFDA) and CellTracker™ Blue 4-chloromethyl-6,8-difluoro-7-hydroxycoumarin (CMF₂HC) were used to determine the intracellular levels of ROS and glutathione (GSH), respectively. Cumulus cells were removed from COCs by pipetting in the presence of 0.1% (w/v) hyaluronidase. Denuded oocytes were incubated in DPBS containing 50 μM DCHFDA or 100 μM CellTracker Blue CMF₂HC in the dark for 20 minutes. Thereafter, oocytes were washed more than five times with DPBS containing 0.1% (w/v) BSA to completely remove excess dye and immediately analyzed by epifluorescence microscopy (Olympus, Tokyo, Japan). The ROS level was determined using excitation and emission wavelengths of 450–490 nm and 515–565 nm, respectively.

The excitation and emission wavelengths of CellTracker Blue CMF₂HC are 371 and 464 nm, respectively. Grayscale images were acquired with a digital camera (Nikon, Tokyo, Japan) attached to the microscope, and mean grayscale values were calculated using ImageJ software (NIH, Bethesda, MD). Background fluorescence values were subtracted from the final values before statistical analysis. The experiment was independently repeated four times with 10 oocytes per experiment.

Terminal deoxynucleotidyl transferase dUTP nick-end labeling assay and Hoechst staining

At 7 days after SCNT, blastocysts were fixed, washed with PBS containing 0.1% BSA, and then incubated with 0.1% Triton X-100 at 38.8°C for 30 minutes. Blastocysts were incubated with fluorescein-conjugated dUTP and terminal deoxynucleotidyl transferase (In Situ Cell Death Detection Kit; Roche, Manheim, Germany) in the dark for 1 hour at 38.8°C. Mitotic and apoptotic cells were scored. Nuclei were stained with Hoechst 33342 (1 μg/mL) for 30 minutes, and embryos were washed with PBS containing 0.1% BSA. Blastocysts were mounted onto glass slides and examined under an inverted Olympus IX-71 fluorescence microscope. The experiment was independently repeated six times with 5–18 blastocysts per experiment.

mRNA extraction and complementary DNA synthesis

mRNA was isolated from more than three biological replicates, with 10–20 blastocysts per replicate, using a Dynabeads mRNA Direct Kit (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. mRNA was collected in 10 μL of elution buffer provided with the kit. Eluted RNA was reverse transcribed into complementary DNA using an oligo (dT) 20 primer and SuperScript III reverse transcriptase (Invitrogen) according to the manufacturer's instructions.

Real-time RT-PCR

The protocol used was basically the same as that described previously (Lee et al., 2012). Real-time RT-PCR was performed using the primer sets listed in Table 1 and a StepOnePlus Real-time PCR System (Applied Biosystems, Warrington, United Kingdom) with a final reaction volume of 20 μL containing SYBR Green PCR Master Mix (Applied Biosystems). The PCR conditions were as follows: 10 minutes at 95°C, followed by 39 cycles of 15 seconds at 95°C and 60 seconds at 54°C or 60°C. Samples were then cooled to 12°C. Relative gene expression levels were analyzed by the $2^{- Δ Δ c t}$ method (Livak and Schmittgen, 2001) after normalization against the expression level of a housekeeping gene (ACTB). The experiment was independently repeated five times.

Table 1.

Primers Used for Quantitative Polymerase Chain Reaction

Gene	GenBank accession number	Primer sequence	Annealing temperature (°C)	Product size (bp)
ACTB	AY550069.1	F: AGATCATGTTCGAGACCTTC R: GTCAGGATCTTCATGGGTAGT	54	220
NFE2L2	Gu991000.1	F: TGGAGTGTACACGTTTCTGT R: GTGTCTGTGATCTTGTCCAG	54	99
SOD1	GU944822.1	F: GTGTTAGTAACGGGAACCAT R: GGATTCAGGATTGAAGTGAG	54	173
SOD2	NM_214127.2	F: AGACCTGATTACCTGAAAGC R: CTTGATGTACTCGGTGTGAG	54	110
SOX2	EU503117	F: GCCCTGCAGTACAACTCCAT R: GCTGATCATGTCCCGTAGGT	60	216
NANOG	DQ447201.1	F: GAACTTTCCAACATCCTGAA R: TTTCTGCCACCTCTTACATT	55	87
POU5F1	NM_001113060	F: AGTGAGAGGCAACCTGGAGA R: TCGTTGCGAATAGTCACTGC	60	166
BCL2L1	NM_214285.1	F: GTTGACTTTCTCTCCTACAAG R: CTCAGTTCTGTTCTCTTCCAC	60	196
BIRC5	NM_214141	F: CCTGGCAGCTCTACCTCAAG R: GAAAGCACAACCGGATGAAT	60	233
CASP3	NM_214131	F: GAGGCAGACTTCTTGTATGC R: CATGGACACAATACATGGAA	55	236
FAS	AJ001202.1	F: GAGAGACAGAGGAAGACGAG R: CTGTTCAGCTGTATCTTTGG	54	194

F, forward; R, reverse.

Statistical analysis

All experimental data were analyzed using the general linear model procedure within the Statistical Analysis System software (SAS User's Guide 1985; Statistical Analysis System, Inc., Cary, NC). The paired Tukey's multiple range test was used to determine significant differences. p-Values <0.05 were considered significant.

Results

Comparison of the developmental rate in BCX, HES, and ICA of porcine oocytes during IVM

We investigated the effects of BCX, HES, and ICA treatment during IVM of porcine oocytes. The maturation efficiency of porcine oocytes incubated in IVM medium containing 1 μM BCX, 100 μM HES, or 5 μM ICA (BCX-1, HES-100, or ICA-5, respectively) was investigated (Table 2). The percentage of surviving oocytes at the metaphase II (MII) stage was highest in the BCX-1 group and was significantly higher (p < 0.05) in the BCX-1 and ICA-5 groups than in the control group (control, 83.5% ± 1.9%; BCX-1, 94.6% ± 2.3%; HES-100, 85.1% ± 2.1%; and ICA-5, 88.2% ± 2.8%).

Table 2.

Effects of β-Cryptoxanthin, Hesperetin, and Icariin Treatment on IVM of Porcine Oocytes

Treatment group	No. of GV oocyte	No. (%) of
Treatment group	No. of GV oocyte	MⅡ oocyte	Cleavage	Blastocyst
Control	200	167 (83.5 ± 1.9)^a	103 (61.6 ± 2.3)^a	26 (25.2 ± 2.1)^a
BCX-1	203	192 (94.6 ± 2.3)^c	144 (75.0 ± 3.1)^c	51 (35.4 ± 2.4)^c
HES-100	202	172 (85.1 ± 2.1)^ab	115 (66.8 ± 2.5)^b	35 (30.4 ± 2.5)^b
ICA-5	204	180 (88.2 ± 2.8)^b	124 (68.8 ± 2.8)^b	39 (31.4 ± 1.2)^b

a–c

p < 0.05.

GV, germinal vesicle.

After PA, the percentage of cleavage was highest in BCX-1 group and was significantly higher (p < 0.05) in the BCX-1, HES-100, and ICA-5 groups than in the control group (control, 61.6% ± 2.3%; BCX-1, 75.0% ± 3.1%; HES-100, 66.8% ± 2.5%; and ICA-5, 68.8% ± 2.8%). The percentage of blastocysts was highest in the BCX-1 group and was significantly higher (p < 0.05) in the BCX-1, HES-100, and ICA-5 groups than in the control group (control, 25.2% ± 2.1%; BCX-1, 35.4% ± 2.4%; HES-100, 30.4% ± 2.5%; and ICA-5, 31.4% ± 1.2%).

Comparison of the antioxidative effects of BCX, HES, and ICA on cleavage after SCNT

We measured the ROS and GSH levels to investigate the antioxidative effects of the three antioxidants during IVC of cleaved SCNT embryos (Fig. 1A). The fluorescence intensity of DCFHDA was lowest in the BCX-1 group and was significantly higher (p < 0.05) in the control group than in HES-100 and ICA-5 groups (control, 60.1 ± 1.8 pixels/oocyte; BCX-1, 42.5 ± 2.0 pixels/oocyte; HES-100, 51.6 ± 2.3 pixels/oocyte; and ICA-5, 49.8 ± 1.4 pixels/oocyte). The fluorescence intensity of CMF₂HC was highest in the BCX-1 group and was significantly lower (p < 0.05) in the control group than in HES-100 and ICA-5 groups (control, 80.8 ± 2.5 pixels/oocyte; BCX-1, 95.6 ± 2.8 pixels/oocyte; HES-100, 82.5 ± 3.1 pixels/oocyte; and ICA-5, 88.5 ± 3.4 pixels/oocyte).

FIG. 1.

Effects of BCX, HES, and ICA treatment on porcine embryos after SCNT. (A) Images of oocytes stained with DCFHDA (a, b, c, d) and CMF₂HC (e, f, g, h). (a), (b), (c), and (d) ROS staining; (e), (f), (g), and (h) GSH staining; (a) and (e) control group; (b) and (f) BCX-1 group; (c) and (g) HES-100 group; (d) and (h) ICA-5 group. Quantification of fluorescence intensities of DCFHDA and CMF₂HC. Scale bar, 100 μm. (B) Relative expression of antioxidant (NFE2L2, SOD1, and SOD2) genes at the MⅡ stage. ACTB served as the internal control gene. Oocytes were analyzed at the MⅡ stage. Values are presented as mean ± standard error of the mean of independent experiments (^a–cp < 0.05). DCFHDA, ROS, reactive oxygen species; SCNT, somatic cell nuclear transfer; BCX, β-cryptoxanthin; HES, hesperetin; ICA, icariin.

In addition, we investigated the effects of these antioxidants on mRNA expression of antioxidant genes nuclear factor erythroid 2-like 2 (NFE2L2), superoxide dismutase 1 (SOD1), and superoxide dismutase 2 (SOD2). The mRNA levels were normalized against those in the control group (Fig. 1B). mRNA expression of NFE2L2 was significantly higher (p < 0.05) in the BCX-1 group than in the control, HES-100, and ICA-5 groups, and was lowest in the control group. mRNA expression of SOD1 and SOD2 was significantly higher (p < 0.05) in BCX-1 and HES-100 groups than in the control group, and was lowest in the control group. Based on results, subsequent experiments investigated whether BCX-1 improves the development and quality of SCNT embryos.

BCX enhances the developmental rate of porcine embryos of SCNT

We determined the blastocyst formation rate after SCNT to examine the effects of BCX treatment on embryonic development (Fig. 2). The percentage of cleavage was significantly higher (p < 0.05) in the BCX-1 group than in the control group (control, 31.8% ± 4.3% and BCX-1, 38.5% ± 2.5%). The percentage of blastocysts was significantly higher (p < 0.05) in the BCX-1 group than in the control group (control, 20.5% ± 1.2% and BCX-1, 29.4% ± 1.8%).

FIG. 2.

Effect of BCX treatment on the development rate of SCNT embryo. The percentages of oocytes with PB extrusion, cleavaged embryos, and blastocysts after SCNT are shown. Values are presented as mean ± standard error of the mean of independent experiments (^a,bp < 0.05). PB, polar body.

BCX improves the developmental quality of SCNT embryos

We evaluated the quality of embryos derived from BCX-treated oocytes to determine the effect of BCX on IVC after SCNT (Fig. 3). The total cell number per blastocyst was significantly higher (p < 0.05) in the BCX-1 group than in the control group (control, 81.3 ± 5.8 and BCX-1, 95.1 ± 5.6, Fig. 3A). The percentage of apoptotic cells was significantly lower (p < 0.005) in the BCX-1 group than in the control group (control, 5.5% ± 0.6% and BCX-1, 2.1% ± 0.4%, Fig. 3A). In addition, we investigated the effects of BCX on mRNA expression of blastocyst development-related genes (SOX2, NANOG, and POU5F1), anti-apoptosis-related genes (BCL2L1 and BIRC5), and pro-apoptosis-related genes (CASP3 and FAS) (Fig. 3B).

FIG. 3.

Effect of treatment of porcine oocytes with BCX on subsequent embryo quality after SCNT. (A) Total cell number per blastocyst. Percentage of apoptotic cells in blastocysts. Blastocysts were analyzed on day 7. (B) Relative mRNA expression of development (SOX2, NANOG, and POU5F1) and apoptosis (BCL2L1, BIRC5, CASP3, and FAS) genes in porcine embryos at blastocyst stage. Blastocysts were analyzed on day 7. Values are presented as mean ± standard error of the mean of independent experiments (^a,bp < 0.05).

Discussion

In a previous study, the scavenging ability of BCX, HES, and ICA to reduce DPPH free radicals was determined by measuring the decrease in absorbance. The result showed that scavenging ability was dependent on antioxidant concentration (Kim et al., 2019; Park et al., 2022; Park et al., 2018; Yoon et al., 2021). Therefore, this study compared the effects of antioxidants 1 μM BCX, 100 μM HES, and 5 μM ICA on cleavage embryo of SCNT. We used BCX subsequent experiments because of the greatest antioxidant effects among them. Treatment with BCX during IVC of porcine embryos improved the development and quality of SCNT embryos.

BCX most enhanced the developmental capacity of PA embryo in BCX, HES, and ICA during IVM. The efficiency of IVM must be improved because oocyte maturation is important for cellular metabolism during meiosis (Rak and Rustin, 2014; Yuan et al., 2013). Several studies have shown that supplementation of various antioxidants promotes oocyte maturation and improves development in vitro (Rakha et al., 2022). BCX most enhanced the antioxidative effects of SCNT embryo in BCX, HES, and ICA during IVC. Although these three compounds have an antioxidant capacity, the reducing power and H₂O₂-scavenging activity of BCX are two to four times higher than those of HES and ICA. Antioxidants can prevent cell damage caused by free radicals, which are unstable molecules, and induce cell apoptosis (Gao et al., 2021) and protect cells against free radicals that promote heart disease, cancer, and other diseases (Ha et al., 2017; Lobo et al., 2010).

Intracellular oxidative and antioxidative activities are primarily determined by ROS and GSH, respectively. ROS naturally form during metabolic processes (Rodríguez-Nuevo et al., 2022), but external oxygen and an inefficient antioxidant system increase ROS generation in vitro (Yeom and Kim, 2015), whereas GSH is a cofactor of glutathione peroxidase and glutathione-S-transferase, and plays an important role in protecting cellular lipids, proteins, and nucleic acids against OS, which can cause mitochondrial dysfunction and apoptosis (Chen et al., 2019; Mesalam et al., 2020; Pompella et al., 2003). To prevent ROS in oocytes for IVP, many studies showed the effects of various antioxidants (Bae et al., 2012; Fang et al., 2022b; Tripathi et al., 2023).

This study showed that treatment with BCX affected the ROS and GSH levels more than others (Fig. 1A), and increased mRNA expression of the antioxidant genes SOD1, SOD2, and NFE2L2 (Fig. 1B). The main function of SOD1 is to catalyze the conversion of superoxide radicals into molecular oxygen and hydrogen peroxide (Eleutherio et al., 2021). SOD2 is the first line of defense against superoxide produced as a byproduct of oxidative phosphorylation (Li et al., 1995). Therefore, enhancement of SOD1 and SOD2 expression is a good indicator of antioxidant activity. NFE2L2 maintains mitochondrial redox homeostasis by upregulating antioxidant genes (Ryoo and Kwak, 2018) and plays an important role in defense (Liu et al., 2022).

Activated NFE2L2 promotes expression of antioxidants SOD1 and SOD2 (Dong et al., 2008). Our results suggest that BCX prevents OS in oocytes more than others by decreasing the level of ROS, augmenting the level of GSH, and increasing expression of SOD1 and SOD2.

Some studies suggested that significantly early cleaving embryos become good-quality blastocysts, leading to significantly higher pregnancy, implantation, and birth rates. A difference in development to the morula or blastocyst stage can be first detected as a difference in the time point at which a zygote cleaved to progress to the 2-cell stage (Fenwick et al., 2002; Isom et al., 2012; Lundin et al., 2001; Van Soom et al., 1997; Yaacobi-Artzi et al., 2022). Likewise, a high percentage of cleaved embryos showed a high percentage of blastocysts.

Also, we investigated the number of total and apoptotic cells, as well as expression of genes involved in apoptosis and development. Treatment with BCX-1 increased the total cell number per blastocyst and reduced the percentage of apoptotic cells (Fig. 3A), and regulated expression of development- and apoptosis-related genes. Apoptosis, associated with cellular stress and cell death, supports embryo survival under normal conditions by selectively eliminating cells with nuclear and chromosomal abnormalities (Miao et al., 2019).

In a recent study, BCX supplementation downregulates proapoptotic genes and improves developmental competence in porcine oocytes (Park et al., 2018). The cell number has been used to determine embryo viability, and increased cell numbers are associated with advanced embryo development (Luna et al., 2008; Papaioannou and Ebert, 1988; Tian et al., 2022). We examined expression of development-related (SOX2, NANOG, and POU5F1) and apoptosis-related (BCL2L1, BIRC5, CASP3, and FAS) genes. Other studies showed that SOX2, NANOG, and POU5F1 contribute to the activation of zygotic genes during the maternal-to-zygote transition (Lee et al., 2013), and POU5F1 and SOX2 function in all the main embryonic regulatory pathways (Leichsenring et al., 2013; Zhou et al., 2019).

Antiapoptotic members of the BLC-2 family regulate proapoptotic proteins (Marques et al., 2007). BIRC5, expressed during embryonic and fetal development, belongs to the inhibitor of apoptosis family and is involved in regulation of the mitotic spindle, especially at G2/M phase (Ambrosini et al., 1997). FAS activates caspase-3, functioned in apoptosis associated with chromatin condensation and DNA fragmentation by stimulating denitrosylation of thiol in its active site (Eskandari and Eaves, 2022; Mannick et al., 1999). After SCNT, BCX increased the expression of development-related and antiapoptosis genes, and decreased the expression of proapoptotic genes (Fig. 3B).

In conclusion, results showed that BCX was the best antioxidant to enhance porcine oocyte maturation and subsequent embryo development. Supplementation of IVC medium with BCX decreased the ROS level in oocytes and increased the blastocyst formation rate and expression of development-related genes. BCX can be used as readily available substitutes for antioxidants during IVC to generate higher quality SCNT embryos. BCX may be a good supplement during porcine oocyte culture.

Footnotes

Authors' Contribution

Conceptualization, S.-H.O., S.-E.L., and S.-P.P.; methodology, S.-H.O.; validation, S.-P.P.; formal analysis, D.-H.H., E.-S.L., H.-B.L., J.-W.Y., S.-H.K., and E.-Y.K.; resources S.-P.P. and S.-H.O.; data curation S.-H.O. and S.-E.L.; visualization, S.-H.O. and E.-Y.K.; writing-original draft, S.-H.O. and S.-E.L.; writing-review and editing, S.-H.O. and S.-E.L.; supervision, S.-P.P.; project administration, S.-H.O. and S.-E.L. All authors have read and agreed to the published version of the article.

Author Disclosure Statement

The authors declare they have no conflicting financial interests.

Funding Information

This work was supported by a grant (715003-07) from the Research Center for Production Management and Technical Development for High Quality Livestock Products through the Agriculture, Food and Rural Affairs Convergence Technologies Program for Educating Creative Global Leaders, Ministry of Agriculture, Food and Rural Affairs, Korea.

References

Ambrosini

, Adida

, Altieri

DC.

A novel anti-apoptosis gene, survivin, expressed in cancer and lymphoma. Nat Med, 1997; 3(8):917–921.

Bae

H-K

, Kim

J-Y

, Hwang

I-S

, et al. Inhibition of reactive oxygen species generation by antioxidant treatments during bovine somatic cell nuclear transfer. Reprod Dev Biol, 2012; 36(2):115–120.

Burri

, La Frano

, Zhu

Absorption, metabolism, and functions of β-cryptoxanthin. Nutr Rev, 2016; 74(2):69–82.

Chen

, Deng

, Huang

, et al. p-Coumaric-acid-containing adenostemma lavenia ameliorates acute lung injury by activating AMPK/Nrf2/HO-1 signaling and improving the anti-oxidant response. Am J Chin Med, 2019; 47(7):1483–1506; doi: 10.1142/S0192415X19500769

de Macedo

, Glanzner

, Rissi

, et al. A fast and reliable protocol for activation of porcine oocytes. Theriogenology, 2019; 123:22–29; doi: 10.1016/j.theriogenology.2018.09.021

De Souza

, De

Franco ÉPD

, De Araújo

MEMB

, et al. Characterization of the antioxidant activity of aglycone and glycosylated derivatives of hesperetin: An in vitro and in vivo study. J Mol Recognit, 2016; 29(2):80–87.

Dong

, Sulik

, Chen

S-Y.

Nrf2-mediated transcriptional induction of antioxidant response in mouse embryos exposed to ethanol in vivo: Implications for the prevention of fetal alcohol spectrum disorders. Antioxid Redox Signal, 2008; 10(12):2023–2033.

Eleutherio

ECA

, Magalhães

RSS

, de Araújo Brasil

, et al. SOD1, more than just an antioxidant. Arch Biochem Biophys, 2021; 697:108701.

Eskandari

, Eaves

CJ.

Paradoxical roles of caspase-3 in regulating cell survival, proliferation, and tumorigenesis. J Cell Biol, 2022; 221(6):e202201159; doi: 10.1083/jcb.202201159

10.

Eun

, Hwang

, Kim

, et al. Generation of reproductive transgenic pigs of a CRISPR-Cas9-based oncogene-inducible system by somatic cell nuclear transfer. Biotechnol J, 2022; 17(7):e2100434; doi: 10.1002/biot.202100434

11.

Fang

, Tanga

, Bang

, et al. Vitamin C enhances porcine cloned embryo development and improves the derivation of embryonic stem-like cells. Reprod Biol, 2022a;22(2):100632.

12.

Fang

, Tanga

, Bang

, et al. Vitamin C enhances porcine cloned embryo development and improves the derivation of embryonic stem-like cells. Reprod Biol, 2022b;22(2):100632; doi: 10.1016/j.repbio.2022.100632

13.

Fenwick

, Platteau

, Murdoch

, et al. Time from insemination to first cleavage predicts developmental competence of human preimplantation embryos in vitro. Hum Reprod, 2002; 17(2):407–412.

14.

, Xie

, Fan

, et al. Effect of esterification with fatty acid of β-cryptoxanthin on its thermal stability and antioxidant activity by chemiluminescence method. Food Chem, 2010; 122(3):602–609.

15.

Gao

, Yu

, Li

, et al. Antioxidant activity and anti-apoptotic effect of the small molecule procyanidin B1 in early mouse embryonic development produced by somatic cell nuclear transfer. Molecules, 2021; 26(20):6150.

16.

Gorczyca

, Wartalski

, Romek

, et al. The molecular quality and mitochondrial activity of porcine cumulus-oocyte complexes are affected by their exposure to three endocrine-active compounds under 3D in vitro maturation conditions. Int J Mol Sci, 2022; 23(9):4572; doi: 10.3390/ijms23094572

17.

Grupen

CG.

The evolution of porcine embryo in vitro production. Theriogenology, 2014; 81(1):24–37; doi: 10.1016/j.theriogenology.2013.09.022

18.

Gupta

, Heo

, Kim

, et al. 5-Azacytidine improves the meiotic maturation and subsequent in vitro development of pig oocytes. Anim Reprod Sci, 2019; 208:106118; doi: 10.1016/j.anireprosci.2019.106118

19.

, Jung

, Kim

, et al. Anti-cancer activity of myricetin against human papillary thyroid cancer cells involves mitochondrial dysfunction-mediated apoptosis. Biomed Pharmacother, 2017; 91:378–384; doi: 10.1016/j.biopha.2017.04.100

20.

Huang

, Tang

, Xie

, et al. Vitamin C enhances in vitro and in vivo development of porcine somatic cell nuclear transfer embryos. Biochem Biophys Res Commun, 2011; 411(2):397–401.

21.

Hwang

S-L

, Lin

J-A

, Shih

P-H

, et al. Pro-cellular survival and neuroprotection of citrus flavonoid: The actions of hesperetin in PC12 cells. Food Funct, 2012; 3(10):1082–1090.

22.

Hyun

, Lee

S-E

, Son

Y-J

, et al. Cell synchronization by rapamycin improves the developmental competence of porcine SCNT embryos. Cell Reprogramming (Formerly” Cloning and Stem Cells”), 2016; 18(3):195–205.

23.

Isom

, Li

, Whitworth

, et al. Timing of first embryonic cleavage is a positive indicator of the in vitro developmental potential of porcine embryos derived from in vitro fertilization, somatic cell nuclear transfer and parthenogenesis. Mol Reprod Dev, 2012; 79(3):197–207.

24.

Jeong

, Yang

, Park

, et al. Combined chaetocin/trichostatin A treatment improves the epigenetic modification and developmental competence of porcine somatic cell nuclear transfer embryos. Front Cell Dev Biol, 2021; 9:709574; doi: 10.3389/fcell.2021.709574

25.

Kawarasaki

, Uchiyama

, Hirao

, et al. Profile of new green fluorescent protein transgenic Jinhua pigs as an imaging source. J Biomed Optics, 2009; 14(5):054017.

26.

Kim

E-Y

, Park

M-J

, Kim

J-Y

, et al. Production of cloned Jeju black cattle (Korean Cattle) from SCNT embryo using vitrification, one-step dilution and direct transfer technique. Reprod Dev Biol, 2011; 35(1):77–83.

27.

Kim

, Lee

, Park

, et al. Antioxidant hesperetin improves the quality of porcine oocytes during aging in vitro. Mol Reprod Dev, 2019; 86(1):32–41.

28.

Lee

, Lee

, et al. Comparative study of the developmental competence of cloned pig embryos derived from spermatogonial stem cells and fetal fibroblasts. Reprod Domest Anim, 2019; 54(9):1258–1264; doi: 10.1111/rda.13507

29.

Lee

, Bonneau

, Takacs

, et al. Nanog, Pou5f1 and SoxB1 activate zygotic gene expression during the maternal-to-zygotic transition. Nature, 2013; 503(7476):360–364.

30.

Lee

, Sun

, Choi

, et al. mTOR is required for asymmetric division through small GTPases in mouse oocytes. Mol Reprod Dev, 2012; 79(5):356–366; doi: 10.1002/mrd.22035

31.

Leichsenring

, Maes

, Mössner

, et al. Pou5f1 transcription factor controls zygotic gene activation in vertebrates. Science, 2013; 341(6149):1005–1009.

32.

, Huang

T-T

, Carlson

, et al. Dilated cardiomyopathy and neonatal lethality in mutant mice lacking manganese superoxide dismutase. Nat Genet, 1995; 11(4):376–381.

33.

Liang

, Jin

Y-X

, Yuan

, et al. Melatonin enhances the developmental competence of porcine somatic cell nuclear transfer embryos by preventing DNA damage induced by oxidative stress. Sci Reports, 2017; 7(1):1–13.

34.

Liu

, Kang

, Tang

Signaling pathways and defense mechanisms of ferroptosis. FEBS J, 2022; 289(22):7038–7050.

35.

Liu

, Liu

, Sun

, et al. Icariin protects hippocampal neurons from endoplasmic reticulum stress and NF-κB mediated apoptosis in fetal rat hippocampal neurons and asthma rats. Front Pharmacol, 2020; 10:1660.

36.

Lobo

, Patil

, Phatak

, et al. Free radicals, antioxidants and functional foods: Impact on human health. Pharmacognosy Rev, 2010; 4(8):118.

37.

Luna

, Copperman

, Duke

, et al. Human blastocyst morphological quality is significantly improved in embryos classified as fast on day 3 (>or = 10 cells), bringing into question current embryological dogma. Fertil Steril, 2008; 89(2):358–363; doi: 10.1016/j.fertnstert.2007.03.030

38.

Lundin

, Bergh

, Hardarson

Early embryo cleavage is a strong indicator of embryo quality in human IVF. Hum Reprod, 2001; 16(12):2652–2657.

39.

Mannick

, Hausladen

, Liu

, et al. Fas-induced caspase denitrosylation. Science, 1999; 284(5414):651–654.

40.

Marques

, Nicacio

, de Oliveira

, et al. In vitro maturation of pig oocytes with different media, hormone and meiosis inhibitors. Anim Reprod Sci, 2007; 97(3–4):375–381.

41.

Martinez

, Nohalez

, Ceron

, et al. Peroxidized mineral oil increases the oxidant status of culture media and inhibits in vitro porcine embryo development. Theriogenology, 2017; 103:17–23; doi: 10.1016/j.theriogenology.2017.07.028

42.

Mesalam

, El-Sheikh

, Joo

, et al. Induction of oxidative stress and mitochondrial dysfunction by juglone affects the development of bovine oocytes. Int J Mol Sci, 2020; 22(1):168; doi: 10.3390/ijms22010168

43.

Miao

, Liu

, et al. Lysosomal dysfunction disturbs porcine oocyte maturation and developmental capacity by disorganizing chromosome/cytoskeleton and activating autophagy/apoptosis. Theriogenology, 2019; 140:44–51; doi: 10.1016/j.theriogenology.2019.08.019

44.

Miller

, Sampson

, Candeias

, et al. Antioxidant activities of carotenes and xanthophylls. FEBS Lett, 1996; 384(3):240–242.

45.

Ongaratto

, Rodriguez-Villamil

, Bertolini

, et al. Influence of oocyte selection, activation with a zinc chelator and inhibition of histone deacetylases on cloned porcine embryo and chemically activated oocytes development. Zygote, 2020; 28(4):286–290; doi: 10.1017/S0967199419000856

46.

Opiela

, Samiec

, Romanek

In vitro development and cytological quality of inter-species (porcine—>bovine) cloned embryos are affected by trichostatin A-dependent epigenomic modulation of adult mesenchymal stem cells. Theriogenology, 2017; 97:27–33; doi: 10.1016/j.theriogenology.2017.04.022

47.

Papaioannou

, Ebert

The preimplantation pig embryo: Cell number and allocation to trophectoderm and inner cell mass of the blastocyst in vivo and in vitro. Development, 1988; 102(4):793–803.

48.

Park

C-O

, Lee

S-E

, Yoon

J-W

, et al. Comparison of three antioxidants in chemical and biological assays on porcine oocytes during ageing in vitro. Zygote, 2022; 30(4):561–570.

49.

Park

Y-G

, Lee

S-E

, Son

Y-J

, et al. Antioxidant β-cryptoxanthin enhances porcine oocyte maturation and subsequent embryo development in vitro. Reprod Fertil Dev, 2018; 30(9):1204–1213.

50.

Perleberg

, Kind

, Schnieke

Genetically engineered pigs as models for human disease. Dis Models Mech, 2018; 11(1):dmm030783.

51.

Pompella

, Visvikis

, Paolicchi

, et al. The changing faces of glutathione, a cellular protagonist. Biochem Pharmacol, 2003; 66(8):1499–1503.

52.

Pyeon

D-B

, Lee

S-E

, Yoon

J-W

, et al. Comparison of the improving embryo development effects of Sasa quelpaertensis Nakai extract, p-coumaric acid, and myricetin on porcine oocytes according to their antioxidant capacities. Theriogenology, 2022; 185:97–108.

53.

Rak

, Rustin

Supernumerary subunits NDUFA3, NDUFA5 and NDUFA12 are required for the formation of the extramembrane arm of human mitochondrial complex I. FEBS Lett, 2014; 588(9):1832–1838.

54.

Rakha

, Elmetwally

, El-Sheikh Ali

, et al. Importance of antioxidant supplementation during in vitro maturation of mammalian oocytes. Vet Sci, 2022; 9(8):439.

55.

Rao

, Hosny

, Kumbha

, et al. HLA-G1(+) Expression in GGTA1KO Pigs Suppresses Human and Monkey Anti-Pig T, B and NK Cell Responses. Front Immunol, 2021; 12:730545; doi: 10.3389/fimmu.2021.730545

56.

Rodríguez-Nuevo

, Torres-Sanchez

, Duran

, et al. Oocytes maintain ROS-free mitochondrial metabolism by suppressing complex I. Nature, 2022; 607(7920):756–761.

57.

Ryoo

I-G

, Kwak

M-K.

Regulatory crosstalk between the oxidative stress-related transcription factor Nfe2l2/Nrf2 and mitochondria. Toxicol Appl Pharmacol, 2018; 359:24–33.

58.

Samiec

The effect of mitochondrial genome on architectural remodeling and epigenetic reprogramming of donor cell nuclei in mammalian nuclear transfer-derived embryos. J Anim Feed Sci, 2005; 14(3):393–422; doi: 10.22358/jafs/67034/2005

59.

Samiec

, Skrzyszowska

Extranuclear inheritance of mitochondrial genome and epigenetic reprogrammability of chromosomal telomeres in somatic cell cloning of mammals. Int J Mol Sci, 2021; 22(6):3099; doi: 10.3390/ijms22063099

60.

Samiec

, Skrzyszowska

, Lipinski

Pseudophysiological transcomplementary activation of reconstructed oocytes as a highly efficient method used for producing nuclear-transferred pig embryos originating from transgenic foetal fibroblast cells. Pol J Vet Sci, 2012; 15(3):509–516; doi: 10.2478/v10181-012-0078-3

61.

Samiec

, Wiater

, Wartalski

, et al. The relative abundances of human leukocyte antigen-E, alpha-galactosidase A and alpha-Gal antigenic determinants are biased by trichostatin A-dependent epigenetic transformation of triple-transgenic Pig-derived dermal fibroblast cells. Int J Mol Sci, 2022; 23(18):10296; doi: 10.3390/ijms231810296

62.

Sarian

, Ahmed

, Mat So'ad

, et al. Antioxidant and antidiabetic effects of flavonoids: A structure-activity relationship based study. Biomed Res Int, 2017; 2017:8386065; doi: 10.1155/2017/8386065

63.

Shoorei

, Banimohammad

, Kebria

, et al. Hesperidin improves the follicular development in 3D culture of isolated preantral ovarian follicles of mice. Exp Biol Med, 2019; 244(5):352–361.

64.

Takeda

Functional consequences of mitochondrial mismatch in reconstituted embryos and offspring. J Reprod Dev, 2019; 65(6):485–489; doi: 10.1262/jrd.2019-089

65.

Tian

, Xia

, Liu

, et al. Increased blastomere number is associated with higher live birth rate in day 3 embryo transfer. BMC Pregnancy Childbirth, 2022; 22(1):1–9.

66.

Tripathi

, Nandi

, Gupta

, et al. Antioxidants supplementation improves the quality of in vitro produced ovine embryos with amendments in key development gene expressions. Theriogenology, 2023; 201:41–52.

67.

Van Soom

, Ysebaert

, de Kruif

Relationship between timing of development, morula morphology, and cell allocation to inner cell mass and trophectoderm in in vitro-produced bovine embryos. Mol Reprod Dev, 1997; 47(1):47–56.

68.

Wakayama

, Perry

, Zuccotti

, et al. Full-term development of mice from enucleated oocytes injected with cumulus cell nuclei. Nature, 1998; 394(6691):369–374.

69.

Whyte

, Prather

RS.

Genetic modifications of pigs for medicine and agriculture. Mol Reprod Dev, 2011; 78(10-11):879–891.

70.

Wiater

, Samiec

, Skrzyszowska

, et al. Trichostatin A-assisted epigenomic modulation affects the expression profiles of not only recombinant human alpha1,2-fucosyltransferase and alpha-galactosidase A enzymes but also Galalpha1—>3Gal epitopes in porcine bi-transgenic adult cutaneous fibroblast cells. Int J Mol Sci, 2021; 22(3):1386; doi: 10.3390/ijms22031386

71.

Wilmut

, Schnieke

, McWhir

, et al. Viable offspring derived from fetal and adult mammalian cells. Nature, 1997; 385(6619):810–813.

72.

Yaacobi-Artzi

, Kalo

, Roth

Association between the morphokinetics of in-vitro-derived bovine embryos and the transcriptomic profile of the derived blastocysts. PLoS One, 2022; 17(10):e0276642.

73.

Yang

, Wang

, Gong

, et al. Cattle mammary bioreactor generated by a novel procedure of transgenic cloning for large-scale production of functional human lactoferrin. PLoS One, 2008; 3(10):e3453.

74.

Yeom

, Kim

The Sasa quelpaertensis Leaf Extract Inhibits the Dextran Sulfate Sodium-induced Mouse Colitis Through Modulation of Antioxidant Enzyme Expression. J Cancer Prev, 2015; 20(2):136–146; doi: 10.15430/JCP.2015.20.2.136

75.

Yin

, Wang

, Xiang

, et al. Dynamic characteristics of the mitochondrial genome in SCNT pigs. Biol Chem, 2019; 400(5):613–623; doi: 10.1515/hsz-2018-0273

76.

Yin

, Sun

, Cui

, et al. Tannin supplementation improves oocyte cytoplasmic maturation and subsequent embryo development in pigs. Antioxidants (Basel), 2021; 10(10):1594; doi: 10.3390/antiox10101594

77.

Yoon

J-W

, Lee

S-E

, Park

Y-G

, et al. The antioxidant icariin protects porcine oocytes from age-related damage in vitro. Anim Biosci, 2021; 34(4):546.

78.

Yuan

H-X

, Xiong

, Guan

K-L.

Nutrient sensing, metabolism, and cell growth control. Mol Cell, 2013; 49(3):379–387.

79.

Zhai

, Yu

, An

, et al. Profiling the transcriptomic signatures and identifying the patterns of zygotic genome activation - a comparative analysis between early porcine embryos and their counterparts in other three mammalian species. BMC Genomics, 2022; 23(1):772; doi: 10.1186/s12864-022-09015-4

80.

Zhang

, Gao

, Liu

Advance in the role of epigenetic reprogramming in somatic cell nuclear transfer-mediated embryonic development. Stem Cells Int, 2021; 2021:6681337; doi: 10.1155/2021/6681337

81.

Zhang

, Qu

, Ma

, et al. Tauroursodeoxycholic acid (TUDCA) alleviates endoplasmic reticulum stress of nuclear donor cells under serum starvation. PLoS One, 2018; 13(5):e0196785; doi: 10.1371/journal.pone.0196785

82.

Zhou

, Wildt

, Keefer

, et al. Combinations of Growth Factors Regulating LIF/STAT3, WNT, and FGF2 pathways sustain pluripotency-related proteins in cat embryonic cells. Stem Cells Dev, 2019; 28(5):329–340; doi: 10.1089/scd.2018.0109