Impact of Genetic Variations of the CYP1A1,GSTT1,and GSTM1 Genes on the Risk of Coronary Artery Disease

Abstract

Carcinogenic and toxic molecules produce DNA adducts that contribute to the development of atherosclerosis. Genetic polymorphisms of xenobiotic-detoxified enzymes, which control the level of DNA adducts, may affect both enzymatic activity and individual susceptibility to coronary artery disease (CAD). In this study we investigated the effects of genetic polymorphisms of the CYP1A1*2C, GSTT1, and GSTM1 enzymes on CAD risk in a Turkish population. Genotypes were determined for 132 CAD patients and 151 healthy controls by the polymerase chain reaction/restriction fragment length polymorphism method. There were no significant differences between patients and controls in terms of CYP1A1, GSTT1, and GSTM1 genotypes. Analysis of the possible interactions between the genotypes, after adjustment for the risk factors, demonstrated that individuals carrying CYP1A1 variant GSTT1 null genotypes had an 8.907-fold increased CAD risk compared to their wild status (p<0.05). We suggest that genetic polymorphisms of xenobiotic-metabolizing enzymes could play an important role in CAD. Therefore, CYP1A1 and GSTM1 polymorphisms should be considered as important parameters for the prediction of CAD.

Introduction

A therosclerosis, the main cause of cardiovascular disease, is one of the major reasons of death in the general population (Ross, 1993; Sankaranarayanan et al., 1999). Studies on atherosclerosis suggest that smooth muscle cell proliferation, the source of atherosclerotic plaques, is one of the several steps that lead to atherosclerosis. Atherosclerotic plaques of the arterial wall, resulting from the monoclonal proliferation of a single mutated cell (Benditt and Benditt, 1973; Ross and Glomset, 1973; Bridges et al., 1990; Penn, 1990), are hypothesized to be benign neoplasms. For this reason, it is suggested that there may be similarities between cancer and atherosclerosis (Binková et al., 2002).

Environmental pollutants such as polycyclic aromatic hydrocarbons (PAH), aldehydes, and metals contribute to the incidence, severity, and risk of coronary artery disease (CAD) by affecting atherogenesis, thrombosis, or blood pressure. Intrauterine exposure to drugs, toxins, and infection has been linked with cardiac birth defects and premature CAD in later life (O'Toole et al., 2008). Some carcinogenic PAH molecules undergo metabolic activation and detoxification reactions by phase I and phase II enzymes in the cell. DNA adducts are produced as a result of these reactions (García-Suástegui et al., 2011). Evidence indicates that the interaction of DNA adducts with DNA may trigger pathogenic pathways in the cell. Significant correlation was found between DNA adduct levels, which are accepted as a biomarker of exposure to environmental carcinogens, and atherogenic risk factors. Higher DNA adduct levels were detected in individuals with severe CAD (De Flora et al., 1997; Van Schooten et al., 1998) and also in atherosclerotic plaques, suggesting their involvement in pathogenesis (Ross, 1993; Jones et al., 1998; Andreassi et al., 2000). The generation of DNA adducts can be modulated by genetic polymorphisms of carcinogen-activating (cytochrome P-450 [CYP] enzymes) and detoxifying enzymes (glutathione-S-transferases [GST]) (Guengerich, 2000). The CYP and GST gene families encode the major enzymatic detoxification system for xenobiotics in mammals (Tsatsakis et al., 2009). Polymorphisms of these genes may lead to differences in the level of susceptibility of individuals to the potential adverse effects of environmental influences, such as chemical exposure, on CAD risks.

CYP phase I enzymes detoxify endogenous and foreign substrates by catalyzing oxidation reactions (Barouki and Morel, 2001). The CYP1A1 enzyme encoded by the CYP1A1 gene has aryl hydrocarbon hydroxylase activity, and is involved especially in the activation of a majority of procarcinogens (Shimada et al., 1996; Sabitha et al., 2010). CYP1A1 enzymes principally participate in the initial activation reactions of detoxification of some carcinogens such as PAH (Shimada et al., 1996; Sabitha et al., 2010). One of the most well-known CYP1A1 gene polymorphisms is a 2455A/G substitution in exon 7 (CYP1A1*2C allele) (Lu et al., 2008). This polymorphism exchanges isoleucine 462 with valine (Hayashi et al., 1991). The frequencies of these mutations exhibit significant interethnic differences (Aynacioglu et al., 1998; Kvitko et al., 2000).

GSTs are a group of phase II enzymes that detoxify endogenous and exogenous electrophiles, determined by a gene family (Gaspar et al., 2002). Phase II enzymes catalyze both detoxification and bioactivation reactions and are generally considered as antioxidants. These enzymes are involved in the metabolism of xenobiotics and may be related to the risk of both atherosclerosis and coronary heart disease (Bridges et al., 1990). There are several studies analyzing the relationship between GSTT1 and GSTM1 null genotypes and the prevalence of CAD or cardiovascular risk factors (Tamer et al., 2004; Abu-Amero et al., 2006; Kim et al., 2008; Wang et al., 2008).

In this study, we investigated the relationship between the risk of CAD and CYP1A1*2C, GSTT1, and GSTM1 polymorphisms in a Turkish population.

Materials and Methods

Study groups

Our analysis included 132 patients found to have CAD (44 women [33.3%] and 88 men [66.7%]) with a mean age of 62.42±9.14 and 151 healthy controls (79 women [52.3%] and 72 men [47.7%]) with a mean age of 55.6±9.36. This case–control study was approved by the Ethics Committee of the Ankara Kecioren Training and Research Hospital, Ankara, Turkey, and all patients gave written consent to participate in the study. All individuals were recruited to coronary angiography. Each angiogram obtained was classified as revealing normal coronary arteries (control group), having coronary lesions with less than 50% luminal stenosis or having three major epicardial coronary arteries with 50% or more luminal obstructions (patient group).

DNA isolation

Blood samples (10 mL) were collected from the patients and controls into EDTA-coated tubes. Genomic DNA used for polymorphic analyses was extracted from lymphocytes of donors by the standard method (Sambrook et al., 1982).

Genotyping

CYP1A1 polymorphism

The genetic polymorphism analysis for CYP1A1*2C was determined by using the polymerase chain reaction/restriction fragment length polymorphism (PCR/RFLP) method described by Cascorbi et al. (1996) and Krajinovic et al. (1999). The primer pairs used were F-5′ CTGTCTCCCTCTGGTTACAGGAAGC 3′ R-5′ TTCCACCCGTTGCAGCAGGATAGCC 3′ for Ile/Val (Krajinovic et al., 1999). The PCR conditions for Ile/Val polymorphism were initial denaturation at 94°C 5 min was followed by 35 cycles of 30 s at 94°C, 1 min at 60°C, 1 min 72°C, and final extension 10 min at 72°C. The amplified products for CYP1A1 Ile/Val polymorphism were subjected to restriction enzyme digestion with BsrDI (Fermentas) at 37°C for 16h. RFLP products were investigated in 1.5% agarose gel and stained with ethidium bromide. The wild-type genotype (Ile/Ile, AA) has two bands representing 149 and 55 bp fragments; the heterozygous genotype (Ile/Val, AG) has three bands representing 204, 149, and 55 bp fragments; the homozygous genotype (Val/Val, GG) results in one 204 bp fragment.

GSTT1 and GSTM1 polymorphism

The polymorphic deletion of the GSTT1 and GSTM1 genes were genotyped using the multiplex PCR approach (Krajinovic et al., 1999; Takanashi et al., 2003; Canalle et al., 2004). Genotyping of the genes (null genotypes) is revealed by the absence of 480 bp for GSTT1 and 219 bp for GSTM1 PCR products, respectively, using β-globin amplification (268 bp) as an internal positive control. This assay does not distinguish between wild-type and heterozygous individuals. The primers used for GSTT1 amplification were TF5′ TTCCTTACTGGTCCTCACATCTC 3′ and TR5′ TCACCGGATCATGGCCAGCA 3′. GSTM gene amplification primers were MF5′ GAACTCCCTGAAAAGCTAAAGC 3′ and MR5′ GTTGGGCTCAAATATACGGTGG 3′ (Canalle et al., 2004). β globin gene primers were βF5′ CAACTTCATCCACGTTCACC 3′ and βR5′ GAAGAGCCAAGGACAGGTAC 3′ (Krajinovic et al., 1999). Cycling conditions were 95°C for 4 min for one cycle; 94°C for 1 min, 60°C for 45s, 72°C for 1 min for 34 cycles; followed by an elongation cycle of 72°C for 10 min. PCR product sizes for GSTT1, M1, and β globin genes were 480, 215, and 268 bp, respectively. Determinations of GSTT1 and GSTM1 genotypes are absolute, while the lack of specific bands for GSTT1 and GSTM1 genotypes were defined as null genotypes termed GSTT1 or M1 (null) if absent and the presence of specific band for GSTT1 or GSTM1, termed as GSTT1 or GSTM1 (present), occurred for both homozygote and hemizygote individuals for the normal gene in 2% agarose gel electrophoresis with ethidium bromide. Genotyping was replicated at least twice for all subjects. In addition to negative controls (without template DNA), genomic DNAs of subjects whose genotypes were confirmed in our previous studies (Taspinar et al., 2008; Aydos et al., 2009) were used as positive controls in this study.

Sample size

The sample size required for the study was calculated on the basis of the primary independent variable, which was CYP1A1*2C. A logistic regression of a binary response variable (CAD) on a binary independent variable (CYP1A1*2C) with a sample size of 283 observations (of which 53% are in the group controls and 47% are in the group patients) achieves 83% power at a 0.05 significance level to detect a change in probability from the baseline value of 0.45 to 0.632. This change corresponds to an odds ratio (OR) of 2.1. An adjustment was made because a multiple regression of the independent variable of interest on the other independent variables in the logistic regression obtained an R ² of 0.10 (Hintze, 2001).

Statistical analysis

Differences between groups for categorical variables were analyzed by the chi-square test, and ORs were calculated. Age, low-density lipoprotein (LDL), high-density lipoprotein (HDL), triglyceride, weight, height, and body mass index were evaluated by Student's t-test. The risk factors for CAD and the association between CAD and CYP1A1, GSTT1, and GSTM1 polymorphisms were evaluated by multiple logistic regression analysis. The entry and removal criteria used were p-values of 0.05 for entry p-values of 0.10 for variable removal in multiple logistic regression analysis. Adjusted ORs and their confidence intervals (CIs) were calculated. p-values less than 0.05 were considered significant. SPSS for Windows 11.5 was used for statistical analysis.

Results

This case–control study involved 132 patients with CAD (44 women [33.3%] and 88 men [66.7%]) with a mean age of 62.42±9.14 and 151 healthy controls (79 women [52.3%] and 72 men [47.7%]) with a mean age of 55.6±9.36. Demographic characteristics are given in Table 1. Statistically significant differences between patients and controls were found for age (p<0.001), gender (p<0.01), LDL (p<0.01), HDL (p<0.01), presence of diabetes (p<0.01), and educational status (p<0.001). While mean age, LDL, height, presence of diabetes (OR=2.39, 95% CI: 1.41–4.05), and the proportion of men (OR=2.19, 95% CI 1.36–3.56) were higher in patients than in controls, the mean HDL of the controls was higher than that of patients. Although most of the controls had graduated from primary school, 43.5% and 39.1% of the patients were high school and primary school graduates, respectively. The risk of CAD was increased 1.09-fold (95% CI: 0.65–1.82) for individuals with a family history for CAD and 1.60-fold (95% CI: 0.97–2.64) for smokers, but these differences were statistically nonsignificant.

Table 1.

Demographic Characteristics of the Study Population

Variable	Patients	Controls	OR (95% CI)	p-Value
Age	62.42±9.14	55.6±9.36		<0.001
Gender (male), n (%)	88 (66.7)	72 (47.7)	[2.19 (1.36–3.56)]	0.001
LDL (mg/dL, mean±SD)	102.16±39.04	118.78±36.96		0.001
HDL (mg/dL, mean±SD)	41.28±13.20	45.68±11.64		0.006
Triglyceride (mg/dL, mean±SD)	155.88±78.47	163.75±92.80		0.471
BMI (kg/m², mean±SD)	28.33±5.19	29.53±5.47		0.167
Family History, n (%)	52 (41.9)	47 (39.8)	[1.09 (0.65–1.82)]	0.739
Smoking status, n (%)	51 (41.1)	45 (30.4)	[1.60 (0.97–2.64)]	0.065
Diabetes, n (%)	65 (50.8)	35 (30.2)	[2.39 (1.41–4.05)]	0.001
Education status, n (%)
Primary school	18 (39.1)	79 (76.0)		<0.001
Middle	5 (10.9)	8 (7.7)
High school	20 (43.5)	10 (9.6)
University	3 (6.5)	7 (6.7)

BMI, body mass index; LDL, low-density lipoprotein; HDL, high-density lipoprotein; OR, odds ratio; CI, confidence interval.

The genotype distribution (CYP1A1, GSTT1, and GSTM1) among patients and controls are given in Table 2. The frequencies of the CYP1A1 Ile/Ile, Ile/Val, and Val/Val genotypes were 88.3%, 11.0%, and 0.7% in the control group and 82.5%, 14.9%, and 2.6% in the patient group, respectively. Although carriers of the CYP1A1 Ile/Val (AG) genotype (OR=1.45, 95% CI: 0.70–3.01) and CYP1A1 Val/Val (GG) genotype (OR=4.09, 95% CI: 0.42–39.89) had an increased risk of CAD, there were no significant differences between these groups in terms of CYP1A1 distribution. Also, the frequency of the CYP1A1 Ile allele was 89.9% in the patients and 93.8% in the controls, which suggested that persons carrying the Val allele had an increased risk for CAD (OR=1.70, 95% CI: 0.89–3.23). However, this difference was not statistically significant (Table 2).

Table 2.

Distribution of Genotypes in Patient and Control Groups

Genotype		Patients (n=132), no. (%)	Controls (n=151), no. (%)	OR (95% CI)	p-Value
CYP1A1	Ile/Ile (AA)	94 (82.5)	128 (88.3)	Reference	0.278
	Ile/Val (AG)	17 (14.9)	16 (11.0)	[1.45 (0.70–3.01)]
	Val/Val (GG)	3 (2.6)	1 (0.7)	[4.09 (0.42–39.89)]
	Ile/Val (AA)+Val/Val (GG)	20 (17.5)	17 (11.7)	[1.60 (0.89–3.22)]
Allele	Ile (A)	205 (89.9)	272 (93.8)	Reference	0.104
	Val (G)	23 (10.1)	18 (6.2)	[1.70 (0.89–3.23)]
GSTT1	Present (WT)	94 (77.0)	124 (83.2)	Reference	0.202
	Null (null)	28 (23.0)	25 (16.8)	[1.48 (0.81–2.70)]
GSTM1	Present (WT)	71 (58.2)	76 (53.5)	Reference	0.446
	Null (null)	51 (41.8)	66 (46.5)	[0.83 (0.51–1.35)]

While the frequency of individuals carrying the GSTT1 null genotype was higher in the patient group (23.0%) than in the control group (16.8%), there was no statistical difference in terms of the GSTT1 null genotype (OR=1.48, 95% CI: 0.81–2.70). Although the frequency of the GSTM1 null genotype was lower in patients than in controls (41.8% and 46.5%, respectively), this difference was not significant (OR=0.83, 95% CI: 0.51–1.35) (Table 2).

After univariate analyses, we performed multivariate logistic regression analysis to determine the risk factors for CAD (Table 3). In this analysis both demographic characteristics (age, gender, family history, smoking status, and diabetes) and genotypes were taken as independent variables. Backward likelihood ratio was used for variable selection. Based on this analysis, we found that age (OR=1.070, 95% CI: 1.026–1.116), gender (=male) (OR=4.501, 95% CI: 2.192–9.239), smoking status (OR=3.079, 95% CI: 1.230–7.709), and the GSTT1 null genotype (OR=0.439, 95% CI: 0.213–0.904) were statistically significant variables.

Table 3.

Risk Factors for Coronary Artery Disease Determined by Multiple Logistic Regression

Risk factors	OR (95% CI)	p-Value
Age	[1.070 (1.026–1.116)]	0.001
Gender (male)	[4.501 (2.192–9.239)]	<0.001
Family history	[1.161 (0.551–2.447)]	0.695
Smoking status	[3.079 (1.230–7.709)]	0.016
Diabetes	[1.739 (0.822–3.678)]	0.148
CYP1A1 ^variant	[1.106 (0.422–2.903)]	0.837
GSTT1 ^null	[1.312 (0.518–3.322)]	0.567
GSTM1 ^null	[0.439 (0.213–0.904)]	0.026

After the determination of risk factors for CAD, we conducted a series of analyses to assess the possible interactions between genotypes after adjustment for the risk factors indicated above (Table 4). When the combined effects of GSTM1 and GSTT1 were evaluated, the carriers of the GSTM1 wild GSTT1 null (OR=1.156, 95% CI: 0.373–3.585; p>0.05) and GSTM1 null GSTT1 null genotypes (OR=1.467, 95% CI: 0.461–4.669; p>0.05) were found to have an increased risk for CAD without statistical significance. When CYP1A1 and GSTT1 genotypes were combined, the GSTT1 null CYP1A1 variant (95% CI: 1.386–57.220; p<0.05) genotypes increased CAD risk 8.907 times.

Table 4.

The Risk of Coronary Artery Disease with Genotype Combinations (CYP1A1, GSTM1, and GSTT1)

Genotypes	Patients, n (%)	Controls, n (%)	OR ^a (95% CI)	p-Value
CYP1A1 ^wild GSTT1 ^wild	68 (63.6)	105 (73.4)	Reference
CYP1A1 ^variant GSTT1 ^wild	13 (12.1)	15 (10.5)	1.497 (0.578–3.874)	0.406
CYP1A1 ^wild GSTT1 ^null	21 (19.6)	21 (14.7)	1.082 (0.423–2.769)	0.870
CYP1A1 ^variant GSTT1 ^null	5 (4.7)^b	2 (1.4)	8.907 (1.386–57.220)	0.021^b
GSTT1 ^wild GSTM1 ^wild	59 (48.4)	62 (44.0)	Reference
GSTT1 ^null GSTM1 ^wild	12 (9.8)	13 (9.2)	1.156 (0.373–3.585)	0.801
GSTT1 ^wild GSTM1 ^null	35 (28.7)	57 (40.4)	0.593 (0.301–1.166)	0.130
GSTT1 ^null GSTM1 ^null	16 (13.1)	9 (6.4)	1.467 (0.461–4.669)	0.516

Adjusted ORs for age, gender, and smoking.

p<0.05.

In this study, the effect of the CYP1A1*2C, GSTT1, and GSTM1 genotypes on CAD risk was studied in both smokers and nonsmokers. Despite no significant effect in any of the groups, it was investigated whether smoking had an effect. CAD risk was increased 2.054-fold (95% CI: 0.570–7.408), 1.285-fold (95% CI: 0.456–3.623), and 1.260-fold (95% CI: 0.534–2.973) in smokers carrying the CYP1A1 variant (Ile/Ile and Ile/Val) and the GSTT1 and GSTM1 null genotypes, respectively. Dual combinations of the CYP1A1, GSTT1, and GSTM1 genotypes were found to increase the risk of CAD, but none of them were statistically significant (Table 5).

Table 5.

The Effect of Genotypes on Coronary Artery Disease Risk in Smokers

Genotype, smoking	OR (95% CI)
CYP1A1 ^wild	1
CYP1A1 ^variant	2.054 (0.570–7.408)
GSTT1 ^wild	1
GSTT1 ^null	1.285 (0.456–3.623)
GSTM1 ^wild	1
GSTM1 ^null	1.260 (0.534–2.973)
GSTT1 ^wild GSTM1 ^wild	1
GSTT1 ^null GSTM1 ^wild	1.750 (0.369–8.302)
GSTT1 ^wild GSTM1 ^null	1.200 (0.467–3.082)
GSTT1 ^null GSTM1 ^null	2.625 (0.456–15.112)
CYP1A1 ^wild GSTT1 ^wild	1
CYP1A1 ^wild GSTT1 ^null	1.383 (0.415–4.612)
CYP1A1 ^variant GSTT1 ^wild	1.481 (0.361–6.074)
CYP1A1 ^variant GSTT1 ^null	NA
CYP1A1 ^wild GSTM1 ^wild	1
CYP1A1 ^wild GSTM1 ^null	1.434 (0.544–3.770)
CYP1A1 ^variant GSTM1 ^wild	5.833 (0.623–54.654)
CYP1A1 ^variant GSTM1 ^null	0.778 (0.117–5.183)

NA, not applicable.

Discussion

There is a metabolic balance between the CYP1A1 (phase I) and GST (phase II) enzymes. Toxic metabolites are formed during the metabolization of xenobiotics by CYP1A1 enzyme activity. The toxic metabolites generated are detoxified by GST enzymes (Ketterer et al., 1992; Rushmore and Pickett, 1993). The differences of the activities of these enzymes cause the accumulation of DNA adducts in cells. Increasing levels of DNA adducts in cells may result in different kinds of mutations. Therefore, people with an altered ability to activate and detoxify toxic metabolites may have an increased risk of the development of some diseases such as cancer, infertility, and CAD (Perera, 1996; Schuppe et al., 2000; Aydemir et al., 2007; Manfredi et al., 2007; Kim et al., 2008; Aydos et al., 2009).

No previous studies are available on the analysis of the combined effect of CYP1A1*2C, GSTM1, and GSTT1 polymorphisms and CAD risk. Available studies are related to the effect of CYP1A1 polymorphisms, and particularly Msp1 polymorphism and GSTT1 and GSTM1 polymorphisms on CAD separately (Tamer et al., 2004; Abu-Amero et al., 2006; Kim et al., 2008; Yeh et al., 2009; Jarvis et al., 2010; Tang et al., 2010). Further, there is only one study available on the combined effect of CYP1A1 polymorphism, and GSTM1 and GSTT1 polymorphisms (Manfredi et al., 2007) on CAD. In the mentioned study, CYP1A1 Msp1 (CYP1A1*2A) polymorphism was studied in only smokers, but in our study, CYP1A1*2C polymorphism was analyzed in both smokers and nonsmokers. Procarcinogenic chemicals that enter the cell are transformed into active forms by the CYP1A1 enzyme. In the presence of the CYP1A1 Val allele, enzyme activity and/or inducibility increases (Bartsch et al., 2000; D'alò et al., 2004). When a person who carries the CYP1A1 Val allele is exposed to chemicals, environmental pollutants, or tobacco smoke, the adverse effects of these factors might be more powerful due to increased enzyme activity. CYP1A1 enzymes activate a number of chemicals in environmental pollutants as well as in tobacco smoke. There is only one study available on the association between CYP1A1*2C polymorphism and CAD risk (Yeh et al., 2009). Yeh et al. (2009) reported that individuals with the CYP1A1*2C GG genotype had lower CAD risk. In our study, although the carriers of the CYP1A1 Ile/Val (AG) genotype (OR=1.45, 95% CI: 0.70–3.01) or CYP1A1 Val/Val (GG) genotype (OR=4.09, 95% CI: 0.42–39.89) had a higher risk of CAD, there were no significant difference between the groups in terms of CYP1A1 distribution. Further, the frequency of the CYP1A1 Ile allele was 89.9% in patients and 93.8% in controls, which demonstrated that individuals carrying the Val allele had an increased risk for CAD (OR=1.70, 95% CI: 0.89–3.23). However, this difference was statistically insignificant probably due to the small sample size. Activation of mutagens by CYP1A1 may play an important role in CAD. The differences between the results reported by Yeh et al. (2009) and our study may be due to ethnic diversity. Further studies need to be conducted in larger groups of different ethnicities to clarify the role of CYP1A1*2C polymorphism on CAD. The frequency of CYP1A1 in our control group was similar to the frequencies reported in other studies conducted in Turkish populations (Aynacioglu et al., 1998; Aydın-Sayitoglu et al., 2006).

Oxidative stress is involved in the pathogenesis of several diseases such as atherosclerosis and cancer. GST enzymes play a major role in the prevention of oxidative stress caused by mutagens and environmental pollutants in the cell (Tang et al., 2010). In recent years, although the number of studies investigating the link between the risk of diseases and GST polymorphisms has increased (Maciel et al., 2009; Manfredi et al., 2009; Gravina et al., 2011; Tang et al., 2010; Güven et al., 2011), the functional effects of these polymorphisms in CAD have not been fully elucidated. Martin et al. (2009) showed that the increased frequency of the GSTT1 and GSTM1 null genotypes in CAD patients was statistically insignificant. Tang et al. (2010) reported that GSTT1 and M1 polymorphisms may modify the effect on oxidative stress markers and inflammation in Chinese CAD patients. Contrary to these results, the frequencies of the GSTT1 and M1 null genotypes were found to be similar in patients and controls in the study of Masetti et al. (2003). In our study, the frequency of the GSTT1 null and GSTM1 null genotype were found to be different in patients (23.0% and 41.8%) and controls (16.8% and 46.5%, respectively). We found the frequency of GSTM1 null genotype in controls to be higher than that in patients, as also reported by Wilson et al. (2000). They found that the GSTM1 null genotype was associated with a decreased CAD risk. In our study, the differences between the distribution of the GSTT1 and GSTM1 null genotypes of the two groups were statistically insignificant. When we analyzed the combined effects of these genes, we found that the GSTT1 and GSTM1 null genotypes increased the risk of CAD, but this result was also insignificant. Several studies reported that GSTT1 and GSTM1 polymorphisms could be a risk factor for atherosclerosis (Tamer et al., 2004; Wang et al., 2008; Maciel et al., 2009; Tang et al., 2010). We also considered that GSTT1 and GSTM1 polymorphisms may play an important role in varying susceptibility of individuals to CAD. The discrepancies between the results of published studies may have stemmed from differences in ethnicity, the number of patients, and patient selection criteria. The frequencies of the GSTT1 and GSTM1 null genotypes in our control group are consistent with values determined in other studies conducted in Turkish populations (Ada et al., 2004; Unal et al., 2007; Yildiz et al., 2010; Güven et al., 2011).

As mentioned before, excluding the present study, to date, only Manfredi et al. (2007) has studied the combined effect of CYP1A1, GSTT1, and GSTM1 in smokers. They reported that neither CYP1A1 Msp1 polymorphism nor the GSTM1 null genotype were associated with CAD risk. However, smokers carrying only the GSTT1 null genotype had an increased risk of CAD. Manfredi et al. (2007) also showed that smokers carrying both the GSTT1 and GSTM1 null genotypes had a high risk of CAD. The combined effect of the CYP1A1 Msp1 variant and the GSTT1 and GSTM1 null genotypes increased CAD risk insignificantly.

According to our results, an individual carrying CYP1A1 Val/Val (GG) or CYP1A1 Ile/Val (AG) in association with the GSTT1 null genotype has an 8.907-fold increased risk of CAD compared to an individual carrying CYP1A1 Ile/Ile (AA) in association with the GSTT1 present genotype (OR=8.907, 95% CI: 1.386–57.220; p<0.05). In the presence of the CYP1A1 Val allele, enzymatic activity increases (Song et al., 2001). High CYP1A1 activity can be involved in the local generation of reactive oxygen species and, consequently, the formation of DNA adducts are found at significantly higher levels in individuals with severe CAD (Ross, 1993; Jones et al., 1998; Andreassi et al., 2000). When an individual carrying the CYP1A1 Val allele is exposed to xenobiotics, the adverse effects might occur stronger due to increased enzymatic activity. Therefore, in the co-presence of the CYP1A1 Val allele and the null gene GSTT1, DNA adducts accumulating in the cell may cause different kinds of mutations.

We also analyzed the effect of CYP1A1, GSTT1, and GSTM1 polymorphisms on CAD risk for smokers. Our results suggested that individuals carrying CYP1A1 variant genotypes (Ile/Ile and Ile/Val) and the GSTT1 and GSTM1 null genotypes had higher risk of CAD, although insignificant. Tamer et al. (2004) found that smokers with the GSTT1 and GSTM1 null genotypes had a significantly increased risk of CAD. Salama et al. (2002) reported that the frequency of the GSTM1 null genotype did not differ significantly between patients and controls, but indicated that the frequency of the GSTT1 null allele was higher in patients than controls, and reached a marginally significant level.

The arterial smooth muscle cells play a basic role in pathogenesis of atherogenesis. The level of DNA adducts is higher in vascular tissues than in other tissues (Girisha et al., 2004). De Flora and Izotti (2007) stated that DNA adducts were systemically present in arterial smooth muscles and the level of DNA adducts were correlated with atherogenic risk factors. There are several studies to explain the association between DNA adduct levels and coronary vascular disease (Van Schooten et al., 1998; Izzotti et al., 2001; Binková et al., 2002). In these studies, DNA adduct levels were measured in vascular tissues. We are planning to make another study measuring DNA adducts on vascular tissues of CAD patients.

In conclusion, to our knowledge, this is the first study investigating the relationship between CYP1A1*2C, GSTT1, GSTM1, and CAD. Carrying the CYP1A1 variant in association with the GSTT1 null genotype poses a very significant risk for CAD in both smokers and nonsmokers. We suggest that, in addition to tobacco, other xenobiotics and environmental pollutants may also be important for CAD risk. Our results suggest that genetic polymorphisms of xenobiotic-metabolizing enzymes could play an important role in CAD. Further studies are required to clarify not only the role of CYP1A1*2C, GSTT1, and GSTM1 on CAD risk in large samples of different populations, but also the correlation between the different polymorphic gene combinations and susceptibility to environmental CAD.

Footnotes

Disclosure Statement

No competing financial interests exist.

References

Abu-Amero

K.K.

, Al-Boudari

O.M.

, Mohamed

G.H.

, Dzimiri

2006. T null and M null genotypes of the glutathione S-transferase gene are risk factor for CAD independent of smoking. BMC Med Genet, 7:38.

Ada

A.O.

, Süzen

S.H.

, Iscan

2004. Polymorphisms of cytochrome P450 1A1, glutathione S-transferases M1 and T1 in a Turkish population. Toxicol Lett, 151:311–315.

Andreassi

M.G.

, Botto

, Colombo

M.G.

, Biagini

, Clerico

2000. Genetic instability and atherosclerosis: can somatic mutations account for the development of cardiovascular diseases? Environ Mol Mutagen, 35:265–269.

Aydemir

, Onaran

, Kiziler

A.R.

, Alici

, Akyolcu

M.C.

2007. Increased oxidative damage of sperm and seminal plasma in men with idiopathic infertility is higher in patients with glutathione S-transferase Mu-1 null genotype. Asian J Androl, 9:108–115.

Aydin-Sayitoglu

, Hatirnaz

, Erensoy

, Ozbek

2006. Role of CYP2D6, CYP1A1, CYP2E1, GSTT1, and GSTM1 genes in the susceptibility to acute leukemias. Am J Hematol, 81:162–170.

Aydos

S.E.

, Taspinar

, Sunguroglu

, Aydos

2009. Association of CYP1A1 and glutathione S-transferase polymorphisms with male factor infertility. Fertil Steril, 92:541–547.

Aynacioglu

A.S.

, Cascorbi

, Mrozikiewicz

P.M.

, Roots

1998. High frequency of CYP1A1 mutations in a Turkish population. Arch Toxicol, 72:215–218.

Barouki

, Morel

2001. Repression of cytochrome P450 1A1 gene expression by oxidative stress: mechanisms and biological implications. Biochem Pharmacol, 61:511–516.

Bartsch

, Nair

, Risch

, Rojas

, Wikman

, Alexandrov

2000. Genetic polymorphism of CYP genes, alone or in combination, as a risk modifier of tobacco-related cancers. Cancer Epidemiol Biomarkers Prev, 9:3–28.

10.

Benditt

E.P.

, Benditt

J.M.

1973. Evidence for a monoclonal origin of human atherosclerotic plaques. Proc Natl Acad Sci USA, 70:1753–1756.

11.

Binková

, Smerhovský

, Strejc

, Boubelík

, Stávková

, Chvátalová

, Srám

R.J.

2002. DNA-adducts and atherosclerosis: a study of accidental and sudden death males in the Czech Republic. Mutat Res, 501:115–128.

12.

Bridges

B.A.

, Bowyer

D.E.

, Hansen

E.S.

, Penn

, Wakabayashi

1990. The possible involvement of somatic mutations in the development of atherosclerotic plaques. Mutat Res, 239:143–148.

13.

Canalle

, Burim

R.V.

, Tone

L.G.

, Takahashi

C.S.

2004. Genetic polymorphisms and susceptibility to childhood acute lymphoblastic leukemia. Environ Mol Mutagen, 43:100–109.

14.

Cascorbi

, Brockmöller

, Roots

1996. A C4887A polymorphism in exon 7 of human CYP1A1: population frequency, mutation linkages, and impact on lung cancer susceptibility. Cancer Res, 56:4965–4969.

15.

D'Alò

, Voso

M.T.

, Guidi

, Massini

, Scardocci

, Sica

, Pagano

, Hohaus

, Leone

2004. Polymorphisms of CYP1A1 and glutathione S-transferase and susceptibility to adult acute myeloid leukemia. Haematologica, 89:664–670.

16.

De Flora

, Izzotti

, Walsh

, Degan

, Petrilli

G.L.

, Lewtas

1997. Molecular epidemiology of atherosclerosis. FASEB J, 11:1021–1031.

17.

De Flora

, Izotti

2007. Mutagenesis and cardiovascular diseases Molecular mechanisms, risk factors, and protective factors. Mutat Res, 621:5–17.

18.

García-Suástegui

W.A.

, Huerta-Chagoya

, Carrasco-Colín

K.L.

, Pratt

M.M.

, John

, Petrosyan

, Rubio

, Poirier

M.C.

, Gonsebatt

M.E.

2011. Seasonal variations in the levels of PAH-DNA adducts in young adults living in Mexico City. Mutagenesis, 26:385–391.

19.

Gaspar

P.A.

, Hutz

M.H.

, Salzano

F.M.

, Hill

, Hurtado

A.M.

, Petzl-Erler

M.L.

, Tsuneto

L.T.

, Weimer

T.A.

2002. Polymorphisms of CYP1a1, CYP2e1, GSTM1, GSTT1, and TP53 genes in Amerindians. Am J Phys Anthropol, 119:249–256.

20.

Girisha

K.M.

, Gilmour

, Mastana

, Singh

V.P.

, Sinha

, Tewari

, Ramesh

, Sankar

V.H.

, Agrawal

2004. T1 And M1 polymorphism ın glutathione S-transferase gene and coronary artery disease ın North Indian population. Indian J Med Sci, 58:520–526.

21.

Gravina

, Spoletini

, Masini

, Valentini

, Vanni

, Paladini

, Bossù

, Caltagirone

, Federici

, Spalletta

, Bernardini

2011. Genetic polymorphisms of glutathione S-transferases GSTM1, GSTT1, GSTP1 and GSTA1 as risk factors for schizophrenia. Psychiatry Res, 187:454–456.

22.

Guengerich

F.P.

2000. Metabolism of chemical carcinogens. Carcinogenesis, 21:345–351.

23.

Güven

, Görgün

, Unal

, Yenerel

, Batar

, Küçümen

, Dinç

U.A.

, Güven

G.S.

, Ulus

, Yüksel

2011. Glutathione S-transferase M1, GSTT1 and GSTP1 genetic polymorphisms and the risk of age-related macular degeneration. Ophthalmic Res, 46:31–37.

24.

Hayashi

S.I.

, Watanabe

, Nakachi

, Kawajiri

1991. PCR detection of an A/G polymorphism within exon 7 of the CYP1A1 gene. Nucleic Acids Res, 19:4797.

25.

Hintze

2001. NCSS and PASS. Kaysville UT: Number Cruncher Statistical Systems www.ncss.com.

26.

Izzotti

, Cartiglia

, Lewtas

, De Flora

2001. Increased, DNA alterations in atherosclerotic lesions of individuals lacking the GSTM1 genotype. FASEB J, 15:752–757.

27.

Jarvis

M.D.

, Palmer

B.R.

, Pilbrow

A.P.

, Ellis

K.L.

, Frampton

C.M.

, Skelton

, Doughty

R.N.

, Whalley

G.A.

, Ellis

C.J.

, Yandle

T.G.

, Richards

A.M.

, Cameron

V.A.

2010. CYP1A1 MSPI (T6235C) gene polymorphism is associated with mortality in acute coronary syndrome patients. Clin Exp Pharmacol Physiol, 37:193–198.

28.

Jones

T.D.

, Morris

M.D.

, Basavaraju

S.R.

1998. Atherosclerotic risks from chemicals: part II. A RASH analysis of in vitro and in vivo bioassay data to evaluate 45 potentially hazardous compounds. Arch Environ Contam Toxicol, 35:165–177.

29.

Ketterer

, Harris

J.M.

, Talaska

, Meyer

D.J.

, Pemble

S.E.

, Taylor

J.B.

, Lang

N.P.

, Kadlubar

F.F.

1992. The human glutathione S-transferase supergene family, its polymorphism, and its effects on susceptibility to lung cancer. Environ Health Perspect, 98:87–94.

30.

Kim

S.J.

, Kim

M.G.

, Kim

K.S.

, Song

J.S.

, Yim

S.V.

, Chung

J.H.

2008. Impact of glutathione S-transferase M1 and T1 gene polymorphisms on the smoking-related coronary artery disease. J Korean Med Sci, 23:365–372.

31.

Krajinovic

, Labuda

, Richer

, Karimi

, Sinnet

1999. Susceptibility to childhood acute lymphoblastic leukemia: influence of CYP1A1, CYP2D6, GSTM1, and GSTT1 genetic polymorphisms. Blood, 93:1496–1501.

32.

Kvitko

, Nunes

J.C.

, Weimer

T.A.

, Salzano

F.M.

, Hutz

M.H.

2000. Cytochrome P4501A1 polymorphisms in South American Indians. Hum Biol, 72:1039–1043.

33.

, Wu

, Xia

, Wang

, Gu

, Liang

, Lu

, Song

, Wang

, Peng

, Zhang

, Wang

2008. Polymorphisms in CYP1A1 gene are associated with male infertility in a Chinese population. Int J Androl, 31:527–533.

34.

Maciel

S.S.

, Pereira Ada

, Silva

G.J.

, Rodrigues

M.V.

, Mill

J.G.

, Krieger

J.E.

2009. Association between glutathione S-transferase polymorphisms and triglycerides and HDL-cholesterol. Atherosclerosis, 206:204–208.

35.

Manfredi

, Calvi

, del Fiandra

, Botto

, Biagini

, Andreassi

M.G.

2009. Glutathione S-transferase T1- and M1-null genotypes and coronary artery disease risk in patients with Type 2 diabetes mellitus. Pharmacogenomics, 10:29–34.

36.

Manfredi

, Federici

, Picano

, Botto

, Rizza

, Andreassi

M.G.

2007. GSTM1, GSTT1 and CYP1A1 detoxification gene polymorphisms and susceptibility to smoking-related coronary artery disease: a case-only study. Mutat Res, 621:106–112.

37.

Martin

N.J.

, Collier

A.C.

, Bowen

L.D.

, Pritsos

K.L.

, Goodrich

G.G.

, Arger

, Cutter

, Pritsos

C.A.

2009. Polymorphisms in the NQO1, GSTT and GSTM genes are associated with coronary heart disease and biomarkers of oxidative stress. Mutat Res, 674:93–100.

38.

Masetti

, Botto

, Manfredi

, Colombo

M.G.

, Rizza

, Vassalle

, Clerico

, Biagini

, Andreassi

M.G.

2003. Interactive effect of the glutathione S-transferase genes and cigarette smoking on occurrence and severity of coronary artery risk. J Mol Med, 81:488–494.

39.

O'Toole

T.E.

, Conklin

D.J.

, Bhatnagar

2008. Environmental risk factors for heart disease. Rev Environ Health, 23:167–202.

40.

Penn

1990. International Commission for Protection Against Environmental Mutagens and Carcinogens. ICPEMC Working Paper 7/1/1. Mutational events in the etiology of arteriosclerotic plaques. Mutat Res, 239:149–162.

41.

Perera

F.P.

1996. Molecular epidemiology: insights into cancer susceptibility, risk assessment, and prevention. J Natl Cancer Inst, 88:496–509.

42.

Ross

1993. Rous-Whipple Award Lecture. Atherosclerosis: a defense mechanism gone awry. Am J Pathol, 143:987–1002.

43.

Ross

, Glomset

J.A.

1973. Atherosclerosis and the arterial smooth muscle cell: proliferation of smooth muscle is a key event in the genesis of the lesions of atherosclerosis. Science, 180:1332–1339.

44.

Rushmore

T.H.

, Pickett

C.B.

1993. Glutathione S-transferases, structure, regulation, and therapeutic implications. J Biol Chem, 268:11475–11478.

45.

Sabitha

, Reddy

M.V.

, Jamil

2010. Smoking related risk involved in individuals carrying genetic variants of CYP1A1 gene in head and neck cancer. Cancer Epidemiol, 34:587–592.

46.

Salama

S.A.

, Au

W.W.

, Hunter

G.C.

, Sheahan

R.G.

, Badary

O.A.

, Abdel-Naim

A.B.

, Hamada

F.M.

2002. Polymorphic metabolizing genes and susceptibility to atherosclerosis among cigarette smokers. Environ Mol Mutagen, 40:153–160.

47.

Sambrook

, Fritsch

E.F.

, Maniatis

1982. Molecular Cloning a Laboratory Manual, 2nd. Cold Spring Harbor Lobısıçanory Press: Cold Spring Harbor, NY.

48.

Sankaranarayanan

, Chakraborty

, Boerwinkle

E.A.

1999. Ionizing radiation and genetic risks. VI. Chronic multifactorial diseases: a review of epidemiological and genetic aspects of coronary heart disease, essential hypertension and diabetes mellitus. Mutat Res, 436:21–57.

49.

Schuppe

H.C.

, Wieneke

, Donat

, Fritsche

, Köhn

F.M.

, Abel

2000. Xenobiotic metabolism, genetic polymorphisms and male infertility. Andrologia, 32:255–262.

50.

Shimada

, Hayes

C.L.

, Yamazaki

, Amin

, Hecht

S.S.

, Guengerich

F.P.

, Sutter

T.R.

1996. Activation of chemically diverse procarcinogens by human cytochrome P-450 1B1. Cancer Res, 56:2979–2984.

51.

Song

, Tan

, Xing

, Lin

2001. CYP 1A1 polymorphism and risk of lung cancer in relation to tobacco smoking: a case-control study in China. Carcinogenesis, 22:11–16.

52.

Takanashi

, Morimoto

, Yagi

, Kuriyama

, Kano

, Imamura

, Hibi

, Todo

, Imashuku

2003. Impact of glutathione S-transferase gene deletion on early relapse in childhood B-precursor acute lymphoblastic leukemia. Haematologica, 88:1238–1244.

53.

Tamer

, Ercan

, Camsari

, Yildirim

, Ciçek

, Sucu

, Ateş

N.A.

, Atik

2004. Glutathione S-transferase gene polymorphism as a susceptibility factor in smoking-related coronary artery disease. Basic Res Cardiol, 99:223–229.

54.

Tang

J.J.

, Wang

M.W.

, Jia

E.Z.

, Yan

J.J.

, Wang

Q.M.

, Zhu

, Yang

Z.J.

, Lu

, Wang

L.S.

2010. The common variant in the GSTM1 and GSTT1 genes is related to markers of oxidative stress and inflammation in patients with coronary artery disease: a case-only study. Mol Biol Rep, 37:405–410.

55.

Taspinar

, Aydos

S.E.

, Comez

, Elhan

A.H.

, Karabulut

H.G.

, Sunguroglu

2008. CYP1A1, GST gene polymorphisms and risk of chronic myeloid leukemia. Swiss Med Wkly, 138:12–17.

56.

Tsatsakis

A.M.

, Zafiropoulos

, Tzatzarakis

M.N.

, Tzanakakis

G.N.

, Kafatos

2009. Relation of PON1 and CYP1A1 genetic polymorphisms to clinical findings in a cross-sectional study of a Greek rural population professionally exposed to pesticides. Toxicol Lett, 186:66–72.

57.

Unal

, Güven

, Devranoğlu

, Ozaydin

, Batar

, Tamçelik

, Görgün

E.E.

, Uçar

, Sarici

2007. Glutathione S transferase M1 and T1 genetic polymorphisms are related to the risk of primary open-angle glaucoma: a study in a Turkish population. Br J Ophthalmol, 91:527–530.

58.

Van Schooten

F.J.

, Hirvonen

, Maas

L.M.

, De Mol

B.A.

, Kleinjans

J.C.

, Bell

D.A.

, Durrer

J.D.

1998. Putative susceptibility markers of coronary artery disease: association between VDR genotype, smoking, and aromatic DNA adduct levels in human right atrial tissue. FASEB J, 12:1409–1417.

59.

Wang

L.S.

, Tang

J.J.

, Tang

N.P.

, Wang

M.W.

, Yan

J.J

, Wang

Q.M.

, Yang

Z.J.

, Wang

2008. Association of GSTM1 and GSTT1 gene polymorphisms with coronary artery disease in relation to tobacco smoking. Clin Chem Lab Med, 46:1720–1725.

60.

Wilson

M.H.

, Grant

P.J.

, Hardie

L.J.

, Wild

C.P.

2000. Glutathione S-transferase M1 null genotype is associated with a decreased risk of myocardial infarction. FASEB J, 14:791–796.

61.

Yeh

C.C.

, Sung

F.C.

, Kuo

L.T.

, Hsu

W.P.

, Chu

H.Y.

2009. Polymorphisms of cytochrome P450 1A1, cigarette smoking and risk of coronary artery disease. Mutat Res, 667:77–81.

62.

Yildiz

, Karkucak

, Yakut

, Gorukmez

, Ozmen

2010. Lack of association of genetic polymorphisms of angiotensin-converting enzyme gene I/D and glutathione-S-transferase enzyme T1 and M1 with retinopathy of prematures. Genet Mol Res, 9:2131–2139.