Functional Variants in NOS1 and NOS2A Are Not Associated with Progressive Hearing Loss in Ménière's Disease in a European Caucasian Population

Abstract

Hearing loss in Ménière's disease (MD) is associated with loss of spiral ganglion neurons and hair cells. In a guinea pig model of endolymphatic hydrops, nitric oxide synthases (NOS) and oxidative stress mediate loss of spiral ganglion neurons. To test the hypothesis that functional variants of NOS1 and NOS2A are associated with MD, we genotyped three functional variants of NOS1 (rs41279104, rs2682826, and a cytosine-adenosine microsatellite repeat in exon 1f) and the CCTTT repeat in the promoter of NOS2A gene (rs3833912) in two independent MD sets (273 patients in total) and 550 controls. A third cohort of American patients was genotyped as replication cohort for the CCTTT repeat. Neither allele nor genotype frequencies of rs41279104 and rs2682826 were associated with MD, although longer alleles of the cytosine-adenosine microsatellite repeat were marginally significant (corrected p = 0.05) in the Mediterranean cohort but not in a second Galicia cohort. Shorter numbers of the CCTTT repeat in NOS2A were significantly more frequent in Galicia controls (OR = 0.37 [CI, 0.18–0.76], corrected p = 0.04), but this finding could not be replicated in Mediterranean or American case–control populations. Meta-analysis did not support an association between CCTTT repeats and risk for MD. Severe hearing loss (>75 dB) was also not associated with any functional variants studied. Functional variants of NOS1 and NOS2A do not confer susceptibility for MD.

Introduction

M énière's disease (MD) is an inner ear disorder characterized by episodes of vertigo lasting from minutes to hours and associated with sensorineural hearing loss, aural fullness or pressure, and tinnitus (MIM 156000). The hearing loss usually affects the low frequencies first, and in an animal model of endolymphatic hydrops (ELH), it is associated with loss of spiral ganglion neurons (SGNs), suggesting that neuronal apoptosis beginning at the apex may be the primary damage in MD (Merchant et al., 2005; Momin et al., 2010). Relevant to this pathophysiology is the observation that chronic stimulation of glutamate receptors of nerve afferents causes an N-methyl-d-aspartate (NMDA)–mediated toxicity, which leads to oxidative stress in SGNs (Anne et al., 2007; Bixenstine et al., 2008).

Nitric oxide (NO), a product of an NO synthase (NOS)–catalyzed reaction that converts l-arginine to citrulline, is important in promoting neuronal survival and plasticity (Calabrese et al., 2007) and in controlling mitochondrial oxygen consumption (Pacher et al., 2007). The genes NOS1 (nNOS) and NOS2A (iNOS) code for two isoforms of NOS (neuronal and induced) expressed in SGNs (Fessenden et al., 1999; Michel et al., 2000). NOS1 is a low-output, Ca²⁺-calmodulin constitutive form that is activated by the influx of Ca²⁺ through the NMDA receptor via postsynaptic density protein (PSD) 95 (Bredt, 2003). NOS2A is a high-output, Ca²⁺-independent enzyme, whose expression in human cells is induced by cytokines such as IFN-γ, IL-1β, and TNF-α (Kleinert et al., 2003).

After iNOS induction, NO is produced continuously until the enzyme is degraded (MacMicking et al., 1997). Aberrant iNOS induction is believed to be involved in the pathophysiology and immune response of several human diseases including asthma, arthritis, multiple sclerosis, colitis, psoriasis, and neurodegenerative diseases (Bogdan, 2001). This relationship may be related to transformation of NO to NO⁻, a highly reactive free radical that can conjugate with other free radicals to become cytotoxic at high concentrations or under oxidative conditions. Interestingly, both NOS1 and NOS2A are upregulated in SGNs in a model of ELH, suggesting that variants of these genes may be related to the neurotoxicity and apoptosis of SGNs in MD (Michel et al., 2000; Anne et al., 2007; Momin et al., 2010).

The regulation of NOS1 is highly complex. The gene has 12 alternative untranslated first exons, termed exons 1a–1l, each driven by distinct promoters (Boissel et al., 2003), reflecting tissue-specific expression of different transcripts. For example, 1d, 1f, and 1g (GenBank accession nos. AF446133, AF446135, and AF446136, respectively) are the dominant forms of NOS1 in human brain (Saur et al., 2002; Bros et al., 2006). Two polymorphic markers located in the promoters of the alternative first exons of NOS1, 1d and 1f, have been reported to affect its expression in vitro (Saur et al., 2004; Reif et al., 2009). The 1d promoter harbors an SNP (rs41279104), which has been associated with schizophrenia (Reif et al., 2006), and the 1f promoter has a cytosine-adenosine (CA) variable number of tandem repeats (VNTR) of 180–210 units termed NOS1 Ex1f VNTR, which has been associated with Alzheimer's disease (Galimberti et al., 2008) and Parkinson's disease (Rife et al., 2009). A third functional SNP (rs2682826) in the 3′-UTR of exon 29 of NOS1 gene has been also associated with schizophrenia (Shinkai et al., 2002; Cui et al., 2010).

NOS2 (MIM 163730) has a highly polymorphic pentanucleotide polypyrimidine microsatellite repeat (CCTTT, rs3833912) at position −2.6 kb (Fig. 1), which is functionally important in the regulation of iNOS transcription (Warpeha et al., 1999). This microsatellite has been studied in malaria (Kun et al., 1998), hypertension (Glenn et al., 1999), diabetic retinopathy (Warpeha et al., 1999), dementia with Lewy bodies (Xu et al., 2000b), rheumatoid arthritis (Gonzalez-Gay et al., 2004), and glaucoma (Motallebipour et al., 2005). In this study, we sought to determine whether these four variants are associated with MD.

FIG. 1.

Promoter region of the NOS2A gene showing putative transcription factor binding sites: IRF-1 (interferon regulatory factor-1), γ-IRE (γ-interferon response element), AABS (A-activator binding site), C/EBP (CCAAT-enhancer binding protein), TNF-RE (TNF response element), NF-kB (nuclear factor-kB), and the CCTTT-repeat polymorphism at position −300.

Materials and Methods

Subjects

DNA samples from 273 unrelated patients with definite MD and 550 controls from two ethnically defined geographic areas in Spain were included in a retrospective multicenter study between January 2004 and November 2010. A third cohort of European-descendent American patients with definite MD was used to replicate the findings in NOS2A. In all patients, MD was diagnosed using American Academy of Otolaryngology-Head and Neck Surgery (AAO-HNS) criteria (Monsell et al., 1995).

Group 1 comprised 163 Caucasian patients from the east and southeastern areas of Spain (91 unilateral and 72 bilateral MD) and 407 geographically matched controls. The patients were recruited from Hospital La Fe from Valencia, Hospital Virgen de las Nieves from Granada, and Hospital de Poniente from El Ejido, Almeria; we collected controls from Caucasian volunteer blood donors at Almeria and Granada. Group 2 was collected to replicate the results of Group 1 and included 110 Caucasian patients (47 unilateral and 63 bilateral MD) and 143 controls from Galicia (Celtic origin from northwestern Spain). The patients were recruited from the Hospital Santiago de Compostela and Hospital de Pontevedra (group 2) and the controls were provided by the Spanish DNA BioBank (www.bancoadn.org) from the same region.

The American cohort was comprised of DNA samples from 117 unrelated American patients with definite MD and 202 geographically matched controls. The patients were examined at the University of Iowa and Johns Hopkins University under institutional review board–approved guidelines. Population substructure was ruled out in the American cohort by genotyping the LCT promoter SNP rs4988235 (Campbell et al., 2005).

A basic neurotologic examination including pure-tone audiometry, nystagmus in the primary position, gaze-evoked and head-shaking nystagmus, and standard caloric test was performed on all patients. Hearing staging for each patient with definite MD was defined as the mean of four-tone average of 0.5, 1, 2, and 3 kHz according to the AAO-HNS criteria: stage 1, ≤25 dB; stage 2, 26–40 dB; stage 3, 41–70 dB; 4, stage 4, >75 db (Monsell et al., 1995).

Local institutional review boards of all participating institutions approved the study, and all patients gave informed consent to participate according to the Declaration of Helsinki.

NOS1 SNP genotyping

Total genomic DNA was isolated from peripheral blood of patients and healthy controls using the Bio robot M-48 Workstation (Genovision) and the MagAttract DNA Blood Mini M48 (192) kit from Qiagen. A TaqMan 5′ allelic discrimination assay using a custom TaqMan SNP Genotyping Assay (Applied Biosystems) was used to genotype rs41279104 and rs2682826, C_86363451_10C, and 15907244_10 with TaqMan probes obtained from Applied Biosystems. The TaqMan minor groove binder (MGB) probe sequences are shown in Table 1. Allele discrimination was performed using 10 ng of sample DNA in a 4 μL reaction mixture containing 2.5 μL TaqMan Universal polymerase chain reaction (PCR) mix (Applied Biosystems), 300 nM primers, and 200 nM TaqMan MGB probes (Applied Biosystems). Reaction conditions consisted of preincubation at 50 C for 120 s and denaturization at 95 C for 10 min, followed by 50 cycles of 92 C for 15 s and 60 C for 90 s. Amplification was performed in an ABI 7500 Fast Real-Time PCR System (Applied Biosystems) with continuous fluorescence monitoring.

Table 1.

Oligonucleotide Sequences Used for Polymerase Chain Reaction Amplification

Name
	Probes
rs41279104	CCCTCCCCAGGGGCAGGCTGGGAGGAGG[C/T]GGCTCTGCTGGGTTGGGAGGCCAAG	Reverse
rs2682826	CATGTTCCAGTGGTTTCATGCACCC[A/G]TGAGTTGCCCTTGTCGGCAAGAGAG	Forward
	Primers
NOS1 microsatellite	5′-GGACGCACCGATGATGTAAG-3′	Forward
	5′-ATTACTCCCAACGCAGCAGA-3′	Reverse
rs3833912	5′-ACCCCTGGAAGCCTACAACT-3′	Forward
	5′-GCCACTGCACCCTAGCCTGTCTCA-3′	Reverse

NOS1 and NOS2A microsatellite genotyping

NOS1 Ex1f VNTR (CA repeats) genotyping was carried out by PCR using a primer labeled with fluorescent dye 6-carboxyfluorescein amino hexy (FAM). The frequency of the length variant clusters mainly at the alleles 182/184, 192, and 200/202/204, and so we dichotomized the VNTR as short (180–196 repeats) and long (198–210 repeats), as previously described (Reif et al., 2006). For NOS2A, samples were genotyped by PCR of the multiallelic CCTTT repeat (rs3833912). Forward and reverse primers are shown in Table 1. PCR aliquots (2 μL) were mixed with 9.25 μL formamide and 0.25 μL of the internal size standard (GENESCAN-500 LIZ). Samples were analyzed by capillary electrophoresis in a 3130 XL Genetic Analyzer with Data Collection Software V3.0 (Applied Biosystems). Microsatellite alleles were assigned using the GeneMapper v4.0 software.

NOS2A promoter sequencing

The products from seven individuals were sequenced in both directions to confirm the number of repeats for accurate genotype assignment. The promoter region of iNOS was amplified with the same pairs of primers but with M13 tails using DNA from homozygous individuals. DNA sequencing was performed following the protocol of the VariantSEQr Resequencing System from Applied Biosystems with BigDye Terminators v3.1; M13 primers were analyzed by capillary electrophoresis on a 3130 XL Genetic Analyzer with the DNA Sequencing Analysis Software v5.2 (Applied Biosystems).

Statistical analysis

Allele frequencies were compared across both groups by the χ ² test with Fisher's exact test using SPSS Software (SPSS, Inc.). Odds ratios (OR) with 95% confidence intervals (95% CI) were calculated to compare the observed frequencies between cases and controls. Alleles of NOS1 Ex1f VNTR were grouped as either short or large, as previously described (Reif et al., 2006). Probability values (p) were corrected for multiple testing. p-Values lower than 0.05 were considered statistically significant. The time to each hearing loss >70 dB (hearing stage 4) for each allelic variant was determined according to the Kaplan–Meier method. Survival curves were compared using the log-rank test.

Results

NOS1 variants

The characteristics of southeast and northwest Spanish cohorts and the American cohort are shown in Table 2. The rs41279104 (exon 1d), rs2682826 (exon 29), and Ex1f VNTR genotypes were in Hardy–Weinberg equilibrium. In controls, genotype frequencies of rs41279104 and rs2682826 were not significantly different in either Mediterranean or Galicia cohorts (p = 0.43 and p = 0.56, respectively). There was also no difference in the genotype frequencies between Mediterranean or Galicia MD cases for either SNP (rs41279104 [p = 0.67] or rs2682826 (p = 0.92]). An analysis of pooled data was also not significant (Table 3).

Table 2.

Baseline Characteristics of Case and Control Subjects

	Southeast Spain population		Northwest Spain population		European American population
Variable	MD	Control	MD	Control	MD	Control
Subjects	163	407	110	143	117	202
Female gender (%)	54.3	57.3	49.5	51.4	54.8	54.0
Age (years)
Mean	55.8	38.1	55.3	37.2	56.4	53.8
Median	56	36	58	38.5	56.5	54
Range	15–88	21–64	12–79	18–64	32–84	32–84
SD	13.1	9.2	13.7	13.1	26.2	26

MD, Ménière's disease.

Table 3.

Distribution of rs41279104 (Exon 1d) and rs2682826 (Exon 29) Genotypes and Allelic Frequencies of the NOS1 Gene in Controls and Patients with Ménière's Disease

Cohort	rs41279104 (exon 1d)	Controls (%)	MD (%)	OR (95% CI)	Uncorrected p-value
Mediterranean	Genotype	n = 383	n = 159
	GG	78.1	76.1	0.89 (0.58–1.38)	0.65
	GA	19.8	22.6	1.18 (0.75–1.85)	0.48
	AA	2.1	1.3	0.60 (0.12–2.84)	0.73
	Allele	2n = 766	2n = 318
	G	88.0	87.4	0.95 (0.64–1.41)
	A	12.0	12.6	1.05 (0.71–1.57)	0.84
Galicia	Genotype	n = 137	n = 96
	GG	81.8	81.3	0.96 (0.50–1.89)	1.00
	GA	17.5	15.6	0.87 (0.43–1.76)	0.73
	AA	0.7	3.1	4.38 (0.45–42.82)	0.31
	Allele	2n = 274	2n = 192
	G	90.5	89.1	0.85 (0.46–1.57)
	A	9.5	10.9	1.17 (0.64–2.15)	0.64
Overall	Genotype	N = 520	N = 255
	GG	79.0	78.0	0.94 (0.65–1.36)	0.78
	GA	19.2	20.0	1.05 (0.72–1.53)	0.85
	AA	1.8	2.0	1.14 (0.37–3.42)	0.78
	Allele	2n = 1040	2n = 510
	G	88.7	88	0.94 (0.68–1.31)
	A	11.3	12	1.06 (0.76–1.47)	0.74

Cohort	rs2682826 (exon 29)	Controls (%)	MD (%)	OR (95% CI)	Uncorrected p-value
Mediterranean	Genotype	n = 407	n = 163
	CC	47.9	49.7	1.07 (0.74–1.54)	0.71
	CT	42.5	44.2	1.07 (0.74–1.54)	0.78
	TT	9.6	6.1	0.62 (0.30–1.27)	0.25
	Allele	2n = 814	2n = 326
	C	69.2	71.8	1.13 (0.85–1.50)
	T	30.8	28.2	0.88 (0.66–1.17)	0.39
Galicia	Genotype	n = 141	n = 109
	CC	46.8	52.3	1.25 (0.75–2.05)	0.44
	CT	40.4	40.4	0.99 (0.60–1.66)	1.00
	TT	12.8	7.3	0.54 (0.23–1.30	0.21
	Allele	2n = 282	2n = 218
	C	67.0	72.5	1.30 (0.88–1.91)
	T	33.0	27.5	0.77 (0.52–1.14)	0.20
Overall	Genotype	N = 548	N = 272
	CC	47.6	50.7	1.13 (0.85–1.51)	0.42
	CT	42.0	42.6	1.03 (0.76–1.38)	0.88
	TT	10.4	6.7	0.61 (0.35–1.06)	0.09
	Allele	2n = 1096	2n = 544
	C	68.6	72.1	1.18 (0.94–1.48)
	T	31.4	27.9	0.85 (0.67–1.06)	0.15

All corrected p-values were not significant.

The alleles of NOS1 Ex1f VNTR in exon 1f were distributed in a bimodal fashion with one peak for long (alleles K–Q; peak, allele N) and two peaks for short alleles (alleles C and H) (Fig. 2). Eight of 16 VNTR1 alleles observed in controls at a frequency greater than 1% accounted for 97% of total variation (C, 18.2%; D, 5.2%; H, 22.2%; I, 3.8%; L, 10%; M, 11.9%; N, 23%; O, 2.3%). When NOS1 Ex1f VNTR alleles were dichotomized as short (B–J) or long (K–Q) alleles, their frequencies were not significantly different in either Mediterranean or Galicia controls (p = 0.73). There was also no difference in allelic frequencies of Ex1f VNTR between Mediterranean or Galicia MD cases (p = 0.14). Again, with pooled data, no difference was found in genotype or allelic frequencies of Ex1f VNTR between cases and controls (Table 4).

FIG. 2.

Allelic distribution of the NOS1 promoter Ex1f variable number of tandem repeats in controls and patients with Ménière's disease. Alleles are arranged from short (B) to long (Q).

Table 4.

Allele Frequencies of Variable Number Of Tandem Repeats at Exon 1f of the NOS1 Gene in Patients with Ménière's Disease and Controls from Mediterranean and Galicia Series

Cohort	Ex1fVNTR	Controls (%)	MD (%)	OR (95% CI)	Uncorrected p-value
Mediterranean	Allele	2n = 798	2n = 324
	L	48.6	56.2	1.35 (1.04–1.76)
	S	51.4	43.8	0.74 (0.57–0.96)	0.025^a
	Genotype	n = 399	n = 162
	SS	27.8	18.5	0.59 (0.37–0.93)	0.02^b
	SL	47.1	50.6	1.15 (0.80–1.66)	0.46
	LL	25.1	30.9	1.34 (0.89–2.00)	0.17
Galicia	Allele	2n = 286	2n = 220
	L	50.0	50.5	1.02 (0.72–1.45)
	S	50.0	49.5	0.98 (0.69–1.40)	0.93
	Genotype	n = 143	n = 110
	SS	25.9	21.8	0.80 (0.44–1.44)	0.55
	SL	48.2	57.3	1.43 (0.87–2.37)	0.16
	LL	25.9	20.9	0.75 (0.42–1.37)	0.37
Overall	Allele	2n = 1084	2n = 544
	L	49.0	53.5	1.20 (0.97–1.47)
	S	51.0	46.5	0.83 (0.68–1.02)	0.09
	Genotype	n = 542	n = 272
	SS	27.3	19.9	0.66 (0.46–0.94)	0.02^b
	SL	47.4	53.3	1.27 (0.95–1.69)	0.12
	LL	25.3	26.8	1.08 (0.78–1.51)	0.67

Corrected p = 0.05.

Corrected p = 0.06.

NOS2A microsatellite

The CCTTT microsatellite was repeated 9–16 times, with significant differences in distribution frequency between the Mediterranean and Galician controls (Fig. 3, corrected p = 0.04). The number of repeats occurring most frequently were 11 (21%), 12 (30%), and 13 (19%); shorter microsatellites (nine repeats) in Mediterranean and Galicia controls were 5% and 13%, respectively (Table 5). We next compared CCTTT repeat frequency between patients with uni- and bilateral MD and found no difference in either Mediterranean (p = 0.21) or Galicia populations (p = 0.99).

FIG. 3.

Number of CCTTT repeats of the NOS2A promoter in controls from southeast (Mediterranean) and northwest (Celtic) of Spain showing differences in the frequency of the nine-repeat allele (Fisher test, corrected p = 0.04).

Table 5.

Allele Frequencies of CCTTT Microsatellite rs3833912 in the NOS2A Gene in Patients with Ménière's Disease and Controls from Mediterranean and Galicia Series

Cohort	Number of repeats	Controls (%)	MD (%)	OR (95% CI)	Uncorrected p-value
Mediterranean		2n = 684	2n = 312
	9	5.0	6.4	1.31 (0.74–2.31)	0.35
	10	11.3	16.7	1.58 (1.08–2.31)	0.02
	11	20.2	16.7	0.79 (0.56–1.13)	0.19
	12	31.9	30.4	0.94 (0.70–1.25)	0.65
	13	20.0	19.6	0.97 (0.69–1.36)	0.86
	14	7.6	7.4	0.97 (0.58–1.61)	0.90
	15	3.8	2.9	0.75 (0.35–1.62)	0.47
	16	0.3	—	—	1.00
Galicia		2n = 246	2n = 216
	9	12.6	5.1	0.37 (0.18–0.76)	0.005^a
	10	11.8	12.5	1.07 (0.61–1.87)	0.82
	11	22.0	19.9	0.88 (0.56–1.39)	0.59
	12	26.0	24.1	0.90 (0.59–1.38)	0.63
	13	17.9	20.8	1.21 (0.76–1.92)	0.42
	14	7.7	13.4	1.85 (1.01–3.41)	0.05
	15	2.0	3.7	1.85 (0.60–5.75)	0.28
	16	—	0.5	—	0.47
American		2n = 404	2n = 234
	8	1.0	0.9	0.87 (0.16–4.78)	0.80
	9	4.2	4.7	1.13 (0.52–2.46)	0.77
	10	13.6	15.8	1.18 (0.75–1.85)	0.45
	11	19.6	15.8	0.78 (0.51–1.20)	0.24
	12	33.2	32.9	1.00 (0.71–1.41)	0.94
	13	17.3	16.2	0.93 (0.61–1.44)	0.72
	14	5.9	8.1	1.41 (0.75–2.63)	0.29
	15	3.7	2.6	0.69 (0.26–1.80)	0.43
	16	1.5	2.6	1.76 (0.56–5.52)	0.33
	17	—	0.4	—	0.78
Overall		2n = 1334	2n = 762
	9	6.1	5.5	0.89 (0.61–1.31)	0.56
	10	12.1	15.2	1.30 (1.01–1.68)	0.04^b
	11	20.3	17.3	0.82 (0.65–1.04)	0.10
	12	31.1	29.4	0.92 (0.76–1.12)	0.41
	13	18.8	18.9	1.01 (0.80–1.26)	0.94
	14	7.1	9.3	1.34 (0.97–1.85)	0.07
	15	3.4	3.0	0.87 (0.52–1.45)	0.60
	16	0.6	0.9	1.54 (0.56–4.26)	0.40

Corrected p = 0.04.

Corrected p = 0.32.

In comparing cases and controls, we found that the nine-repeat allele was significantly more frequent in Galicia controls than patients (OR = 0.37 [CI, 0.18–0.76], corrected p = 0.04), although this finding was not replicated in either the Mediterranean (p = 0.35) or American cohorts (p = 0.77). Pooled data from all patients also showed that the nine-repeat allele was not associated with MD (p = 0.56).

Hearing loss was assessed in a subgroup of 208 patients with MD. Median time to develop hearing loss >70 dB was 26 years (95% CI, 22–30) for patients with the allele A and 22 years (18–27) for patients with allele G (rs41279104, log-rank test, p = 0.91; Fig. 4A). There was no difference between patients with allele C or T of rs2682826 (24 years [18–30] and 22 years [19–25], respectively; long-rank test, p = 0.81; Fig. 4B).

FIG. 4.

SNPs of the NOS1 gene are not associated with hearing loss progression. (A) Patients with allele A or G at rs41279104 displayed the same time to loss (75 dB) in the hearing level (log-rank test, p = 0.91). (B) Patients with allele C or T (rs2682826, log-rank test, p = 0.81).

The Ex1f VNTR of NOS1 also did not confer susceptibility for hearing loss (short allele, severe hearing loss at 22 years [16–28]; long allele, severe hearing loss at 24 years [16–32]; log-rank test, p = 0.52) (Fig. 5A). Patients with the 9- or 10-repeat allele of the CCTTT microsatellite of NOS2A had a median time to stage 4 of 24 years (20–28); for patients with longer-repeat alleles, this time was 20 years (5–35) (log-rank test, p = 0.17) (Fig. 5B).

FIG. 5.

Microsatellites of NOS1 and NOS2A are not associated with hearing loss progression. (A) Carriers of the short alleles Ex1f variable number of tandem repeats of NOS1 reached severe hearing loss at the same time as the patients with longer alleles (log-rank test, p = 0.52). (B) Patients with 9–10 or 11–16 repeats of CCTTT at NOS2A gene (log-rank test, p = 0.17).

Discussion

Functional allelic variants have been investigated in MD by sequencing candidate genes or by case–control studies designed to identify associations conferring susceptibility to MD. The list of genes that have been studied includes antiquitin (Lynch et al., 2002), aquaporin 2 (Mhatre et al., 2002), coagulation factor C homology (COCH) (Fransen et al., 1999), potassium channel genes, KCNE1 and KCNE3 (Doi et al., 2005), HLA class II genes (Koo et al., 2003; Lopez-Escamez et al., 2007), alpha-adducin (Teggi et al., 2008), heat-shock protein 70 (Kawaguchi et al., 2008), and PTPN22 (Lopez-Escamez et al., 2010). None of these genes has been associated with MD in independent population testing (Usami et al., 2003; Sanchez et al., 2004; Campbell et al., 2010).

Our study investigated the association between functional variants of NOS1 and NOS2A in Caucasians with MD. We were interested in these genes because NO protects against NMDA-mediated neurotoxicity by S-nitrosylating the NR1 and NR2 subunits of the NMDA receptor, reducing the intracellular Ca²⁺ influx responsible for neuronal apoptosis (Calabrese et al., 2007). NMDA-mediated excitotoxicity has been proposed as a key mechanism in the loss of SGNs in ototoxicity and ELH (Anne et al., 2007; Ruel et al., 2007). As high concentrations of glutamate induce apoptosis in SGNs, it is likely that hydrops-associated ionic disturbances in the cochlear nerve afferents lead to an increase of intracellular Ca²⁺ and NOS1 and NOS2A induction (Anne et al., 2007; Bixenstine et al., 2008).

The distribution of CCTTT alleles of NOS2A has been described in five ethnic populations and shows significant worldwide variation (Xu et al., 2000a). Consistent with this finding, our data confirm that the 12-repeat allele is the most frequent in the Caucasian population (Xu et al., 2000a; Motallebipuor et al., 2005). (Xu et al., 2000; Motallebipuor et al., 2005). Of interest to us is the observation that this VNTR may function as an enhancer or as a spacer element affecting transcription (Kleinert et al., 2003).

Two characteristics define enhancers and both are demonstrated by this microsatellite: the ability to bind nuclear factors (Motallebipour et al., 2005) and the independence of orientation or distance to the transcription start site (Warpeha et al., 1999). Increased spacing associated with more numerous repeats may create DNA flexibility, facilitating the interaction between flanking nuclear factors. Relevant to this possibility is the finding that the repeat sits approximately halfway between several NF-κB binding sites upstream of the transcription start site (Taylor et al., 1998), suggesting that the length of CCTTT could affect promoter interaction with nuclear factors or cytokines such as IFN-γ, IL-1β, or TNF-α.

Short CCTTT alleles are associated with dementia with Lewy bodies, but not with Alzheimer's disease (Xu et al., 2000b), and with migraine in the Han Chinese population, although additional studies are needed to replicate the latter finding in Caucasians (Jia et al., 2011). However, we were unable to find any association of this repeat with MD.

In addition, we genotyped three functional variants of NOS1 that have been associated with Alzheimer's disease (Galimberti et al., 2008) and behavioral disorders (Reif et al., 2009). Again, we found no differences in these variants between MD cases and controls. Although other functional variants of NOS1 could be genotyped, there is no evidence that known structural variations in NOS1 are associated with MD.

Conclusions

Functional variants of NOS1 (rs41279104 at exon 1d, rs2682826 at exon 29, and a CA microsatellite at exon 1f) and a CCTTT repeat (rs3833912) at the promoter of NOS2A genes do not confer susceptibility for MD.

Footnotes

Acknowledgments

This study was funded by an FIS PI10/0920 Research Project from ISCIII. J.A.L.-E. was partially supported by ISCIII research grant INT09/229. The 3130 XL Genetics Analyzer was funded by grant IF06/37291 from Ministry of Science. This work was partially supported by the University of Iowa, Department of Otolaryngology and the Research Fund of the American Otological Society (to R.J.H.S.).

Disclosure Statement

No competing financial interests exist.

References

Anne

, Kisley

L.B.

, Tajuddin

S.T.

, Leahy

, Alagramam

K.N.

, Megerian

C.A.

2007. Molecular changes associated with the endolymphatic hydrops model. Otol Neurotol, 28:834–841.

Bixenstine

P.J.

, Maniglia

M.P.

, Vasanji

, Alagramam

K.N.

, Megerian

C.A.

2008. Spiral ganglion degeneration patterns in endolymphatic hydrops. Laryngoscope, 118:1217–1223.

Bogdan

2001. Nitric oxide and the immune response. Nat Immunol, 2:907–916.

Boissel

J.P.

, Zelenka

, Godtel-Armbrust

, Feuerstein

T.J.

, Forstermann

2003. Transcription of different exons 1 of the human neuronal nitric oxide synthase gene is dynamically regulated in a cell- and stimulus-specific manner. Biol Chem, 384:351–362.

Bredt

D.S.

2003. Nitric oxide signaling specificity—the heart of the problem. J Cell Sci, 116:9–15.

Bros

, Boissel

J.P.

, Godtel-Armbrust

, Forstermann

2006. Transcription of human neuronal nitric oxide synthase mRNAs derived from different first exons is partly controlled by exon 1-specific promoter sequences. Genomics, 87:463–473.

Calabrese

, Mancuso

, Calvani

, Rizzarelli

, Butterfield

D.A.

, Stella

A.M.

2007. Nitric oxide in the central nervous system: neuroprotection versus neurotoxicity. Nat Rev Neurosci, 8:766–775.

Campbell

C.A.

, Della Santina

C.C.

, Meyer

N.C.

, Smith

N.B.

, Myrie

O.A.

, Stone

E.M.

, Fukushima

, Califano

, Carey

J.P.

, Hansen

M.R.

, Gantz

B.J

, Minor

L.B.

, Smith

R.J.H

. 2010. Polymorphisms in KCNE1 or KCNE3 are not associated with Ménière disease in the caucasian population. Am J Med Genet Part A, 152A:67–74.

Campbell

C.D.

, Ogburn

E.L.

, Lunetta

K.L.

, Lyon

H.N.

, Freedman

M.L.

, Groop

L.C.

, Altshuler

, Ardie

K.G.

, Hirschhorn

. 2005. Demonstrating stratification in a European American population. Nat Genet, 37:868–872.

10.

Cui

, Nishiguchi

, Yanagi

, Fukutake

, Mouri

, Kitamura

, Hashimoto

, Shirakawa

, Hishimoto

2010. A putative cis-acting polymorphism in the NOS1 gene is associated with schizophrenia and NOS1 immunoreactivity in the postmortem brain. Schizophrenia Res, 121:172–178.

11.

Doi

, Sato

, Kuramasu

, Hibino

, Kitahara

, Horii

, Matsushiro

, Fuse

, Kubo

2005. Meniere's disease is associated with single nucleotide polymorphisms in the human potassium channel genes, KCNE1 and KCNE3. ORL J Otorhinolaryngol Relat Spec, 67:289–293.

12.

Fessenden

J.D.

, Altschuler

R.A.

, Seasholtz

A.F.

, Schacht

1999. Nitric oxide/cyclic guanosine monophosphate pathway in the peripheral and central auditory system of the rat. J Comp Neurol, 404:52–63.

13.

Fransen

, Verstreken

, Verhagen

W.I.

et al. 1999. High prevalence of symptoms of Meniere's disease in three families with a mutation in the COCH gene. Hum Mol Genet, 8:1425–1429.

14.

Galimberti

, Scarpini

, Venturelli

, Strobel

, Herterich

, Fenoglio

, Guidi

, Scalabrini

, Cortini

, Bresolin

, Lesh

K.P.

, Reif

2008. Association of a NOS1 promoter repeat with Alzheimer's disease. Neurobiol Aging, 29:1359–1365.

15.

Glenn

C.L.

, Wang

W.Y.

, Morris

B.J.

1999. Different frequencies of inducible nitric oxide synthase genotypes in older hypertensives. Hypertension, 33:927–932.

16.

Gonzalez-Gay

M.A.

, Llorca

, Sanchez

, Lopez-Nevot

M.A.

, Amoli

M.M.

, Garcia-Porrua

, Ollier

W.E.R.

, Martin

2004. Inducible but not endothelial nitric oxide synthase polymorphism is associated with susceptibility to rheumatoid arthritis in northwest Spain. Rheumatology, 43:1182–1185.

17.

Jia

, Ni

, Chen

, Jiang

, Dong

, Gao

2011. Association of the pentanucleotide repeat polymorphism in NOS2A promoter region with susceptibility to migraine in a Chinese population. DNA Cell Biol, 30:117–122.

18.

Kawaguchi

, Hagiwara

, Suzuki

2008. Polymorphic analysis of the heat-shock protein 70 gene (HSPA1A) in Menière's disease. Acta Otolaryngol, 128:1173–1177.

19.

Kleinert

, Schwarz

P.M.

, Forstermann

2003. Regulation of the expression of inducible nitric oxide synthase. Biol Chem, 384:1343–1364.

20.

Koo

J.W.

, Oh

S.H.

, Chang

S.O.

, Park

M.H.

, Lim

M.J.

, Yoo

T.J.

, Kim

C.S.

2003. Association of HLA-DR and type II collagen autoimmunity with Meniere's disease. Tissue Antigens, 61:99–103.

21.

Kun

J.F.

, Mordmuller

, Lell

, Lehman

L.G.

, Luckner

, Kremsner

P.G.

1998. Polymorphism in promoter region of inducible nitric oxide synthase gene and protection against malaria. Lancet, 351:265–266.

22.

Lopez-Escamez

J.A.

, Saenz-Lopez

, Acosta

, Moreno

, Gazquez

, Perez-Garrigues

, Lopez-Nevot

M.A.

2010. Association of a functional polymorphism of PTPN22 encoding a lymphoid protein phosphatase in bilateral Meniere`s disease. Laryngoscope, 120:103–107.

23.

Lopez-Escamez

J.A.

, Vilchez

J.R.

, Soto-Varela

, Santos-Perez

, Perez-Garrigues

, Aran

, Lopez-Nevot

M.A.

2007. HLA-DRB1*1101 allele may be associated with bilateral Meniere's disease in southern european population. Otol Neurotol, 28:891–895.

24.

Lynch

, Cameron

T.L.

, Knight

, Kwok

T.Y.

, Thomas

, Forrest

S.M.

, Giersch

A.B.

, Briggs

R.J.

, Pyman

B.C.

2002. Structural and mutational analysis of antiquitin as a candidate gene for Meniere disease. Am J Med Genet, 110:397–399.

25.

MacMicking

, Xie

Q.W.

, Nathan

1997. Nitric oxide and macrophage function. Ann Rev Immunol, 15:323–350.

26.

Merchant

S.N.

, Adams

J.C.

, Nadol

J.B.

2005. Pathophysiology of Menière syndrome: are symptoms caused by endolymphatic hydrops? Otol Neurotol, 26:74–81.

27.

Mhatre

A.N.

, Jero

, Chiappini

, Bolasco

, Barbara

, Lalwani

A.K.

2002. Aquaporin-2 expression in the mammalian cochlea and investigation of its role in Meniere's disease. Hear Res, 170:59–69.

28.

Michel

, Hess

, Su

, Bloch

, Stennert

, Addicks

2000. Expression of inducible nitric oxide synthase (iNOS/NOS II) in the hydropic cochlea of guinea pigs. Hear Res, 143:23–28.

29.

Momin

S.R.

, Melki

S.J.

, Alagramam

K.N.

, Megerian

C.A.

2010. Spiral ganglion loss outpaces inner hair cell loss in endolymphatic hydrops. Laryngoscope, 120:159–165.

30.

Monsell

E.M.

, Balkany

T.A.

, Gates

G.A.

, Goldenberg

R.A.

, Meyerhoff

W.L.

, House

J.W.

1995. Committee on Hearing and Equilibrium guidelines for the diagnosis and evaluation of therapy in Meniere's disease. Otolaryngol Head Neck Surg, 113:181–185.

31.

Motallebipour

, Rada-Iglesias

, Jansson

, Wadelius

2005. The promoter of inducible nitric oxide synthase implicated in glaucoma based on genetic analysis and nuclear factor binding. Mol Vision, 11:950–957.

32.

Pacher

, Beckman

J.S.

, Liaudet

2007. Nitric oxide and peroxynitrite in health and disease. Physiol Rev, 87:315–424.

33.

Reif

, Herterich

, Strobel

, Ehlis

A.C.

, Saur

, Jacob

C.P.

, Wienker

, Töpner

, Fritzen

, Walter

, Schmitt

, Fallgatter

A.J.

, Lesch

K.P.

2006. A neuronal nitric oxide synthase (NOS-I) haplotype associated with schizophrenia modifies prefrontal cortex function. Mol Psychiatry, 11:286–300.

34.

Reif

, Jacob

C.P.

, Rujescu

, Herterich

, Lang

, Gutknecht

, Baehne

C.G.

, Strobel

, Freitag

C.M.

, Giegling

, Romanos

, Hartmann

, Rösler

, Renner

T.J.

, Fallgatter

A.J.

, Retz

, Ehlis

A.C.

, Lesh

2009. Influence of functional variant of neuronal nitric oxide synthase on impulsive behaviors in humans. Arch Gen Psychiatry, 66:41–50.

35.

Rife

, Rasoul

, Pullen

, Mitchell

, Grathwol

, Kurth

2009. The effect of a promoter polymorphism on the transcription of nitric oxide synthase 1 and its relevance to Parkinson's disease. J Neurosci Res, 87:2319–2325.

36.

Ruel

, Wang

, Rebillard

, Eybalin

, Lloyd

, Pujol

, Puel

J.L.

2007. Physiology, pharmacology and plasticity at the inner ear hair cell synaptic complex. Hear Res, 227:19–27.

37.

Sanchez

, Lopez-Escamez

J.A.

, Lopez-Nevot

M.A.

, Lopez-Nevot

, Cortes

, Martin

2004. Absence of COCH mutations in patients with Meniere disease. Eur J Hum Genet, 12:75–78.

38.

Saur

, Seidler

, Paehge

, Schusdziarra

, Allescher

H.D.

2002. Complex regulation of human neuronal nitric-oxide synthase exon 1c gene transcription. Essential role of Sp and ZNF family members of transcription factors. J Biol Chem, 277:25798–25814.

39.

Saur

, Vanderwinden

J.M.

, Seidler

, Schmid

R.M.

, De Laet

M.H.

, Allescher

H.D.

2004. Single-nucleotide promoter polymorphism alters transcription of neuronal nitric oxide synthase exon 1c in infantile hypertrophic pyloric stenosis. Proc Natl Acad Sci USA, 101:1662–1667.

40.

Shinkai

, Ohmori

, Hori

, Nakamura

2002. Allelic association of the neuronal nitric oxide synthase (NOS1) gene with schizophrenia. Mol Psychiatry, 7:560–563.

41.

Taylor

B.S.

, de Vera

M.E.

, Ganster

R.W.

, Wang

, Shapiro

R.A.

, Morris

S.M.

Jr. , Billiar

T.R.

, Geller

G.A.

1998. Multiple NF-kappaB enhancer elements regulate cytokine induction of the human inducible nitric oxide synthase gene. J Biol Chem, 273:15148–15156.

42.

Teggi

, Lanzani

, Zagato

, Delli Carpini

, Manunta

, Bianchi

, Bussi

2008. Gly460Trp alpha-adducin mutation as a possible mechanism leading to endolymphatic hydrops in Meniere's syndrome. Otol Neurotol, 29:824–828.

43.

Usami

, Takahashi

, Yuge

, Ohtsuka

, Namba

, Abe

, Fransen

, Patthy

, Otting

, Van Camp

2003. Mutations in the COCH gene are a frequent cause of autosomal dominant progressive cochleo-vestibular dysfunction, but not of Meniere's disease. Eur J Hum Genet, 11:744–748.

44.

Warpeha

K.M.

, Xu

, Liu

, Charles

I.G.

, Patterson

C.C.

, Ah-Fat

, Harding

, Hart

P.M.

, Chakravarthy

, Hughes

A.E.

1999. Genotyping and functional analysis of a polymorphic (CCTTT)(n) repeat of NOS2A in diabetic retinopathy. FASEB J, 13:1825–1832.

45.

, Humphries

, Tomita

, Okuyama

, Matsuki

, Burgner

, Kwiatkowski

, Liu

, Charles

I.G.

2000a. Survey of the allelic frequency of a NOS2A promoter microsatellite in human populations: assessment of the NOS2A gene and predisposition to infectious disease. Nitric Oxide, 4:379–383.

46.

, Liu

, Emson

, Harrington

C.R.

, McKeith

I.G.

, Perry

R.H.

, Morris

C.M.

, Charles

I.G.

2000b. The CCTTT polymorphism in the NOS2A gene is associated with dementia with Lewy bodies. Neuroreport, 11:297–299.