CITED2 Mutations in Conserved Regions Contribute to Conotruncal Heart Defects in Chinese Children

Abstract

Conotruncal heart defects (CTDs) are severe malformations of outflow tract with heterogeneous morphology. Several missense variants of CITED2 have been identified to cause CTDs in recent researches. In this study, we screened the coding regions of CITED2 in 605 Chinese children with CTDs and found two possible pathogenic mutant sites: p.Q117L and p.T257A, both located in the conserved regions of CITED2. Then, we investigated the biological and functional alterations of them. Western blotting showed low level of protein expression of mutant Q117 and T257A compared with wild-type CITED2. Dual-luciferase reporter assay demonstrated that mutant Q117 and T257A decreased the ability of CITED2 to modulate the expression of paired-like homeodomain transcription factor 2 gamma (PITX2C), which are closely related to cardiac growth and left–right patterning. Meanwhile, T257A also exhibited impaired ability to mediate vascular endothelial growth factor expression, another gene closely associated with the normal development of cardiovascular system. Three-dimensional molecular conformation showed reduced hydrogen bond between Asp254 and mutant Thr257, indicating the weakened stability and binding ability of CITED2. All these results suggest that CITED2 mutations in conserved regions lead to disease-causing biological and functional changes and may contribute to the occurrence of CTDs.

Introduction

Conotruncal heart defects (CTDs), which account for 15–20% congenital heart defects (CHDs) (Conti et al., 2003), are severe malformations of outflow tract (OFT) with heterogeneous morphology, including tetralogy of Fallot (TOF), double-outlet of right ventricle, pulmonary atresia with ventricular septal defect, transposition of the great arteries (TGA), interrupted aortic arch (IAA), and persistent truncus arteriosus (Nakajima, 2010). The pathogenesis of CTDs involves environmental factors, multiple genes variants, and other unknown causes among which genetic factors have been identified to play a major role in sporadic, non-Mendelian, and nonchromosomal CTDs (Bentham and Bhattacharya, 2008). Many studies have focused on the molecular biology of CTDs, and several gene mutations have been discovered to be responsible for the abnormal OFT development such as NKX2.5, GATA4, FOG2, TBX1, and CITED2 (Yagi et al., 2003; Liu et al., 2014; Zhang et al., 2014, 2016; Abdul Samad et al., 2016) in the past few decades.

CITED2, also known as CBP/P300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 2, is a CBP/P300-interacting protein, which is highly conserved among mammals and widely expressed in vertebrates (Chen et al., 2012). CITED2 is involved in developmental regulation of embryonic heart, neural tube, neural crest cells, adrenal glands, placenta, liver, lung, eye, and gonads by cooperating with other transcription factors (Lopes Floro et al., 2011). Lack of CITED2 during gestation is lethal, indicating the essential role of CITED2 in embryonic development. CITED2 has three regions, namely CR1, CR2, and CR3, which are conserved among CITED family members (Braganca et al., 2002). CR2 participates in all known important biological activities of CITED2 through its binding to P300-CH1 (Bhattacharya et al., 1999; Braganca et al., 2002), while the functions of CR1 and CR3 are poorly understood. CITED2 also has a unique Serine–Glycine-Rich Junction (SRJ, residues 161–199) (Andrews et al., 2000; Yin et al., 2002), which has been identified to be a mutational hotspot; variants located in this region have higher risk to cause congenital cardiovascular malformations.

As mentioned above, CITED2 lacks typical DNA binding sites and may act as a cofactor to regulate the expression of specific genes such as paired-like homeodomain transcription factor 2 gamma (PITX2C) and vascular endothelial growth factor (VEGF) (Bhattacharya et al., 1999; Bamforth et al., 2004); abnormal expression of both have been clearly identified to be associated with CTDs. In vivo, CITED2 regulates PITX2C through cooperation with TFAP2C. CITED2 knockout mice developed various kinds of laterality defects and conotruncal malformations such as right atrial isomerism, hyposplenia, double-outlet right ventricle, common arterial trunk, and IAA because of abnormal expression of PITX2C (Bamforth et al., 2004). CITED2 can also block HIF1A transcriptional activity by competitively inhibiting the interaction between HIF1A and CBP/P300. The expression of HIF1A-induced gene VEGF could be influenced if the competition between CITED2 and HIF1A for CBP/p300 is perturbed.

Since Sperling et al. (2005) first uncovered the connection between congenital heart diseases and CITED2 mutations in 2005, a growing number of mutations have been reported to cause CHDs. Most of them are located in the SRJ region (Sperling et al., 2005; Chen et al., 2012; Li et al., 2012; Xu et al., 2014). Our study focuses on CTDs, which is a main kind of congenital cardiovascular malformations; the mutations involved are both located in CITED2 conserved regions instead of SRJ. We seek to clarify the relationship between the CITED2 variants in CRs and CTDs by analyzing the biological and functional alterations of these mutants.

Materials and Methods

Ethics statement

The study conformed to the ethical guidelines of the 2013 Declaration of Helsinki and was approved by Local Ethics Committees of Xinhua Hospital (Shanghai, China).

Patient samples and DNA extraction

CTD patients' blood samples alone with detailed clinical diagnoses were obtained from Xinhua Hospital and Shanghai Children's Medical Center during May 2013 to March 2015. Phenotypes of these patients are listed in Table 1. Genomic DNA was extracted from the blood sample using TIANamp Genomic DNA Kit (TIANGEN, Beijing, China). Corresponding 300 control blood samples were also gained from the two hospitals and DNA was extracted using the same method.

Table 1.

Conotruncal Heart Defect Patients Screened in This Study

Phenotype	N = 605	Ratio (%)
Pulmonary atresia with ventricular septal defect (PA/VSD)	98	16.2
Double-outlet right ventricle (DORV)	99	16.4
Tetralogy of Fallot (TOF)	234	38.7
Transposition of the great arteries (TGA)	92	15.2
Single ventricle (SV) and single atrium (SA)	46	7.6
Interrupted aortic arch (IAA)	16	2.6
Pulmonary atresia with intact ventricular septum (PAIVS)	13	2.1
Persistent truncus arteriosus (PTA)	10	1.2

Mutation screening and bioinformatic analysis

Exon regions of CITED2 were tested by target sequence technique for mutant screening. Then, all candidate mutations were confirmed by Sanger sequencing. The PolyPhen-2 and SIFT programs were used to predict the disease-causing potential of CITED2 mutations. Species protein sequences of CITED2 were obtained from NCBI (www.ncbi.nlm.nih.gov/), blasted using ClustalX software. The results were analyzed using online software BoxShade (www.ch.embnet.org/software/BOX_form.html).

Plasmid construction and site-directed mutagenesis

The CITED2 expression vector containing human CITED2 cDNA was purchased from OriGene (Rockville, MD). Online software PrimerX (http://bioinformatics.org/primerx/) was used to design mutant primers, and KOD-Plus- high fidelity PCR kit (TOYOBO, Osaka, Japan) was used to construct CITED2 mutant sites.

PITX2C promoter and VEGF promoter regions were amplified by PCR from human genomic DNA and then cloned into the luciferase reporter pGL3-basic vector at the sites of Kpn1 and Xho1.

The HIF1A cDNA expression vector and the TFAP2C cDNA expression vector are generous gifts from Prof. Hong Pan (National Research Institute for Family Planning, China).

All the above-mentioned plasmids were verified by DNA sequence, and the primers used for PCR are listed in Table 2.

Table 2.

Primers Used in This Study

Name	Sequence
Q117L	F: 5′ TGGTTGTTGAGCTTCAGCAGCTGCATGCTGG 3′
	R: 5′ CCAGCATGCAGCTGCTGAAGCTCAACAACCA 3′
T257A	F: 5′ GAGTTTGATTTATGGCGGACTTCGTGTGC 3′
	R: 5′ GCACACGAAGTCCGCCATAAATCAAACTC 3′
PITX2C-promoter	F: 5′ GGGGTACCGGGGACAAAAGGACTTTC 3′
	R: 5′ CCGCTCGAGCCCTGTTGGCCTAACATC 3′
VEGF-promoter	F: 5′ GGGGTACCTTTGGGTTTTGCCAGACT 3′
	R: 5′ CCGCTCGAGAGGAGGGAGCAGGAATAG 3′
CITED2-qRTPCR	F: 5′ TTCCCTCACTTTCTCCAGTGCTCA 3′
	R: 5′ ATGAAGCGAGATGGCAGTTTGTGC 3′
GAPDH-qRTPCR	F: 5′ AGGTCGGTGTGAACGGATTTG 3′
	R: 5′TGTAGACCATGTAGTTGAGGTCA 3′

Cell culture and transient transfection

C2C12 and 293T cells were maintained in DMEM high glucose medium (HyClone, Utah) with 10% fetal bovine serum (Invitrogen, California) and 100 U/mL penicillin/streptomycin in humidified atmosphere at 37°C with 5% CO₂. For VEGF-Luc reporter assay, cells with transfected plasmids were maintained in hypoxia condition with 1% O₂. Fugene HD transfection reagent (Promega, Madison, WI) was used for transfection according to the manufacturer's instruction.

Western blotting and cycloheximide chase assay

Total proteins of 293T cells were extracted using total protein lysis buffer RIPA (Beyotime, Shanghai, China), separated by 12.5% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE), and transferred to nitrocellulose membranes using a Mini-PROTEAN Tetra System (Bio-Rad). Primary monoclonal antibody anti-CITED2 (1:2000; EPR3416(2); Abcam) and the secondary antibody anti-rabbit (1:10,000; 111035003; Jackson) were used to analyze the presence of CITED2 protein. β-actin was chosen as inner control. Detection of targeted protein bands was performed by ECL western blotting detection reagents according to the manufacturer's protocol. Gray value of every band was quantified using Image Lab software.

For cycloheximide chase assay, 293T cells were transfected with WT-CITED2 (wild type), Q117L, and T257A plasmids. Thirty-six hours after transfection, cells were treated with 100 μg/mL cycloheximide (MCE, HY-12320) for indicated time (0, 20, 40, 80 min). Western blotting was used to analyze the protein expression, and the results were exhibited as ratio of CITED2/β-actin gray value.

Quantitative real-time PCR

293T cells were maintained in 12-well plates. Total RNA was isolated using 1 mL TRIzol reagent (15596026; Invitrogen) according to the manufacturer's instructions 24 h after transfection. Total RNA (about 1 μg) was retrotranscribed with PrimeScript™ RT reagent (TaKaRa, Japan). qPCR was performed according to the SYBR^® Premix Ex Taq™ II protocol (TaKaRa, Japan). GAPDH was used as control to normalize the expression levels. Primers used in qRT-PCR are listed in Table 2.

Dual-luciferase reporter assay

C2C12 cells were cotransfected with 50 ng WT-CITED2 or mutants, transcription factor TFAP2C or HIF1A, and 100 ng PITX2C or VEGF promoter reporter plasmid. Twenty nanograms of pRL-TK plasmid (E2241; Promega) were used as internal control. Firefly and Renilla luciferase activities were measured using the Dual-Glo Luciferase Assay System 6 Kit (Promega, Madison, WI) and the Centro XS3 LB 960 Microplate Luminometer (Berthold, Bad Wildbad, Germany). The results represent the means of three independent experiments performed in triplicate.

Three-dimensional reconstruction of CITED2 mutant protein

CITED2 C-terminal protein (216–259) three-dimensional (3D) model was obtained from SWISS-MODEL (https://swissmodel.expasy.org/). The graph of CITED2 Thr257 and its mutation Ala257 was constructed and drawn by Swiss PDB Viewer (SPDBV) software.

Statistical analysis

Statistical analysis was performed using t-test or one-way ANOVA. All data were analyzed by Prism GraphPad 6.02 software, and p < 0.05 was considered significant.

Results

Screening and bioinformatic analysis of CITED2 mutations

We sequenced the entire CITED2 open reading frame in 605 CTD cases and 300 unrelated control individuals. Several nonsynonymous variants were identified, among which two mutants—p.Q117L and p.T257A (Table 3)—had not yet been reported in CTD patients and were predicted to be pathogenic by SIFT and PolyPhen-2. The screening results were verified by Sanger sequence (Fig. 1b).

FIG. 1.

Biological analysis of CITED2 and mutants. (a) Functional regions of CITED2 and corresponding amino acid locations are marked. Q117L is located in CR1 and T257A in CR2. (b) Sanger sequencing of mutant Q117/T257A showed c.350A changed to T and c.769A changed to G of CITED2 gene. (c) Sequence alignment of CITED2 proteins among several species (human, mouse, dog, sheep, pig, horse, cow, monkey, and marten). Both Q117 and T257A are highly conserved. Color images available online at www.liebertpub.com/dna

Table 3.

Detailed Information of CITED2 Mutations Involved in This Study

dbSNP	Variation	Protein	Disease	SIFT	PolyPhen-2
Not found	c.350A>T	p.Q117L	D-TGA/PDA/ASD	0	0.993
rs766774041	c.769A>G	p.T257A	TOF/PFO/DA	0.25	0.957

Mutant Q117L locates in CITED2 conserved region 1 (CR1); it was detected from a patient with TGA, patent ductus arteriosus, and atrial septal defect (ASD). T257A locates in another CITED conserved region—CR2 (Fig. 1a); the patient carrying T257A suffered from TOF, patent foramen ovale, and dextro-aortic arch. Homology analysis of CITED2 protein showed that two conserved region mutants are also highly conserved among species (Fig. 1c). These observations suggested that the two amino acids might be functionally important, and severe congenital cardiac defects could be associated with the p.Q117L and p.T275A variations.

CITED2 mutations decrease protein expression and have impact on transcriptional activities

To explore if the predicted disease-causing mutants could result in functional changes of CITED2, we first checked the protein expression level of WT-CITED2 and its mutants by western blot (Fig. 2a). Gray intensity ratio of CITED2/β-actin was analyzed using GraphPad software. The results showed that both Q117L and T257A had lower protein expression than WT-CITED2 (Fig. 2b).

FIG. 2.

Functional analysis of CITED2 and mutants. (a) Western blotting of CITED2 and mutants. Cells were cotransfected with WT-CITED2, Q117L, and T257A. Anti-CITED2 antibody was used as primary antibody, and β-actin was chosen as inner control. (b) Every column represents the ratio of gray value of CITED2/β-actin. Expression level of control group, WT-CITED2, and mutants were analyzed using unpaired t-test (**p < 0.01 vs. WT-CITED2). (c) To identify CITED2 cooperating with TFAP2C to induce PITX2C, cells were cotransfected with empty vector, TFAP2C expression plasmid, WT-CITED2 expression plasmid, as well as PITX2C promoter reporter plasmid and internal control plasmid pRL-TK. (d) To identify the mutations in regulating TFAP2C-PITX2C transcriptional activity, cells were cotransfected with empty vector, TFAP2C, WT-CITED2, or CITED2 mutants, as well as PITX2C promoter reporter plasmid and pRL-TK. Forty-eight hours after transfection, the luciferase activities were measured (t-test, **p < 0.01 vs. WT-CITED2). (e) To identify CITED2 repressing HIF1A, cells were cotransfected with empty vector, HIF1A expression plasmid, WT-CITED2 expression plasmid, as well as VEGF promoter reporter plasmid and internal control plasmid pRL-TK. Cells were maintained in 1% O₂ to simulate hypoxia environment. (f) To identify the mutations in regulating HIF1A-VEGF transcriptional activity, cells were cotransfected with empty vector, HIF1A, WT-CITED2, or CITED2 mutants, as well as VEGF promoter reporter plasmid and pRL-TK. Forty-eight hours after transfection, the luciferase activities were measured (t-test, *p < 0.05 vs. WT-CITED2). All the above-mentioned experiments were carried out at least three times independently. VEGF, vascular endothelial growth factor; WT, wild type.

Dual-luciferase reporter assay was used to assess whether the mutations would have impact on transcriptional activities of CITED2. As shown in Figure 2c, TFAP2C alone exhibits a faint transcriptional activation in our assay and increased effect on targeted PITX2C promoter when cotransfected with WT-CITED2. Then, we cotransfected TFAP2C with CITED2 wild type and mutants. Both Q117L and T257A showed weaker synergistic effect, resulting in a lower expression of downstream PITX2C (Fig. 2d). Meanwhile, HIF1A activates VEGF promoter, and this mechanism was blocked when cotransfected with WT-CITED2 in hypoxia condition (Fig. 2e) (1% O₂). Mutant T257A had higher luciferase activity than WT-CITED2, and Q117L showed little difference compared with WT-CITED2. Abnormal luciferase level of PITX2C and VEGF indicated that the mutants impair the transcriptional activities of CITED2.

3D protein structure analysis showing a loss of hydrogen bond between Thr257 and Asp254

To further predict the functional changes of these mutations, a C-terminal protein (216–259) 3D model was constructed using SPDBV software (Fig. 3a). In normal condition, Thr257 connects with 254Asp by two hydrogen bonds, while mutant Ala257 has only one hydrogen bond connecting to 254Asp (Fig. 3b, c). Due to the great significance of hydrogen bond in maintaining protein structures, this change may lead to the decreased stability of CITED2 protein and subsequently have impact on its biological functions to some degree.

FIG. 3.

Three-dimensional molecular conformation of CITED2 aa216–259. (a) Conformation of CITED2 C-terminal aa216–259. Rectangle-marked area was amplified and is shown in (b) and (c). (b) Local interaction between Thr257 and Asp254. In normal condition, Thr257 (red) and Asp254 (yellow) link with two hydrogen bonds (green). (c) Local interaction between mutant Ala257 and Asp254. Thr257 turned into Ala257, and the hydrogen bond was reduced. Color images available online at www.liebertpub.com/dna

T257A encoded unstable proteins and led to low expression of CITED2

We first performed qRT-PCR to figure out if the mutations could alter the expression of mRNA. The results indicated that both Q117 and T257A had little impact on CITED2 transcriptional expression (Supplementary Fig. S1; Supplementary Data are available online at www.liebertpub.com/dna). Cycloheximide chase assay was applied to prove a real decrease of the stability of mutant proteins instead of other reasons such as poorer expression of particular construct due to the mutations. We found that T257A protein reduced nearly 70% in 20 min, while WT-CITED2 reduced 15%. The expression level of T257A protein was extremely low after 20 min and was almost undetectable near 80 min. Although the Q117L expression has always been lower than wild type, the two shared similar decay rate of protein during our observation (Supplementary Fig. S2). These results indicated that the stability of T257A protein was decreased compared with WT-CITED2.

Discussion

CITED2, a transcriptional activator which cooperates with many transcription factors through its CR2 binding to P300-CH1, has been identified significantly in the normal development of cardiovascular tissue and anatomical structure. CITED2 knockout mice showed various kinds of cardiovascular malformations, including ASD, VSD, left–right axis abnormity, and CTDs. Many variants in CITED2 have been identified to take the responsibility of CTDs in recent years.

Six hundred five Chinese CTD patients and 300 unrelated controls were involved in our study. We screened the coding region of CITED2 and found two mutations (Q117L and T257A) in CTD patients and predicted disease-causing. Q117L locates in CITED family conserved region 1 and T257A in conserved region 2. Multiple sequence alignments also found that these two mutations were highly conserved among different species. This result indicates that the two amino acids may be of great importance in the evolutionary process; mutations at these sites are likely to result in decreased biological function of protein.

We carried out western blotting and found that the protein expression of T257A was obviously lower than WT-CITED2 by calculating the gray intensity ratio of CITED2/β-actin. Meanwhile, Q117 also had reduced expression level. Glutanine (Q) and threonine (T) are classified as polar hydrophilic amino acids, and their replacements leucine (L) and alanine (A) are nonpolar hydrophobic amino acids. Fluctuations in the nature of these amino acids lead to decline in protein stability and might activate the endogenous protein degradation pathway, leading to reduced protein expression.

In vivo, CITED2 recruits TFAP2C by binding to P300 and increases the expression of TFAP2C-downstream PITX2C. PITX2C controls cell proliferation and is involved in morphogenesis during embryonic development (Dagle et al., 2003). PITX2C knockout mice showed valve defects, body wall dysraphism, gastroschisis, ectopia cordis, and other multiple organs polymorphous defects (Bamforth et al., 2004). CITED2 also competes with HIF1A for binding to P300 to reduce the expression of HIF1A and HIF1A-induced gene VEGF; both HIF1A and VEGF are closely related to cardiovascular growth. Previous study showed that overexpression of VEGF may lead to leaky, tortuous, dilated, and saccular vessels of OFT and interventricular septum (Xu et al., 2007). To further explore if the mutants could impact the ability of CITED2 cooperative function, we performed dual-luciferase reporter assay. Our study showed that both Q117L and T257A had lower abilities to coactivate TFAP2C, as a result, expression of PITX2C was reduced. Meanwhile, T257A weakened the inhibitory effect of CITED2 on HIF1A, leading to increased expression of downstream VEGF. Q117L showed little difference with WT-CITED2. So, we draw the conclusion that CITED2 mutations may influence CITED2 transcriptional activity, leading to abnormal expression of downstream genes, and we speculated that the impaired biological function had a relationship with a decline in CITED2 protein expression.

CITED2 is an unstable nuclear protein; almost all the CITED2 must combine with the P300 to play its biological function. David M. Livingston's study indicated that the carboxy-terminal region of CITED2, extending from aa215 to 270, with a core region of 32 amino acids (224–255), was necessary for p300–CH1 binding (Bhattacharya et al., 1999). The stability of CR2 domain protein, in particular the core region (224–255), relates to the normal biological function of CITED2. 3D structure analysis of CITED2 aa216–259 showed that Thr257 binds with Asp254 through two hydrogen bonds, while mutant Ala257 and Asp254 have only one. Hydrogen bond is a kind of secondary bond and is widespread in biological macromolecules. Hydrogen bond has been seen to play an important role in maintaining the secondary and tertiary structures and some physicochemical properties of protein. Changes in the spatial structure and physicochemical properties of CR2 proteins might not only give rise to T257A decreased protein stability but also damage its ability to bind with p300.

The declined protein stability found in our study may be due to physicochemical property alteration and molecular conformation variety of conserved region amino acids. Unstable proteins could start up protein degradation pathway, resulting in a decrease in the expression of CITED2. Reduced protein products along with spatial structure alterations weaken biological function of CITED2, leading to aberrant expression of CITED2-modulated genes such as PITX2C and VEGF. Recent studies indicated that CITED2 can also act as a cofactor of ISL1, another gene associated with cardiovascular development and CTDs (Osoegawa et al., 2014). CITED2 and ISL1 proteins interact physically and coordinate with each other to promote ESC differentiation toward cardiomyocytes (Pacheco-Leyva et al., 2016). It is worthwhile to explore whether CITED2 mutation could affect the interaction between CITED2 and ISL1 and lead to CTDs.

Summarily, by analyzing the biological and functional changes of two CITED2 mutations (Q117L and T257A), our study provided potent evidence that CITED2 gene is related to CTDs and CITED2 mutations in conserved regions contribute to the occurrence of CTDs.

Footnotes

Acknowledgments

The study was supported by National Natural Science Foundation of China (81670210); Shanghai Municipal Commission of Health and Family Planning three-year action plan (GWIV-23); the Science Committee of Shanghai (13J1401705).

Disclosure Statement

No competing financial interests exist.

References

Abdul Samad

, Suliman

, Basha

S.H.

, Manivasagam

, and Essa

M.M.

(2016). A comprehensive in silico analysis on the structural and functional impact of SNPs in the congenital heart defects associated with NKX2-5 gene-A molecular dynamic simulation approach. PLoS One, 11, e0153999.

Andrews

J.E.

, O'Neill

M.J.

, Binder

, Shioda

, and Sinclair

A.H.

(2000). Isolation and expression of a novel member of the CITED family. Mech Dev, 95, 305–308.

Bamforth

S.D.

, Braganca

, Farthing

C.R.

, Schneider

J.E.

, Broadbent

, Michell

A.C.

, et al. (2004). Cited2 controls left-right patterning and heart development through a Nodal-Pitx2c pathway. Nat Genet, 36, 1189–1196.

Bentham

, and Bhattacharya

(2008). Genetic mechanisms controlling cardiovascular development. Ann N Y Acad Sci, 1123, 10–19.

Bhattacharya

, Michels

C.L.

, Leung

M.K.

, Arany

Z.P.

, Kung

A.L.

, and Livingston

D.M.

(1999). Functional role of p35srj, a novel p300/CBP binding protein, during transactivation by HIF-1. Genes Dev, 13, 64–75.

Braganca

, Swingler

, Marques

F.I.

, Jones

, Eloranta

J.J.

, Hurst

H.C.

, et al. (2002). Human CREB-binding protein/p300-interacting transactivator with ED-rich tail (CITED) 4, a new member of the CITED family, functions as a co-activator for transcription factor AP-2. J Biol Chem, 277, 8559–8565.

Chen

C.M.

, Bentham

, Cosgrove

, Braganca

, Cuenda

, Bamforth

S.D.

, et al. (2012). Functional significance of SRJ domain mutations in CITED2. PLoS One, 7, e46256.

Conti

, Grifone

, Sarkozy

, Tandoi

, Marino

, Digilio

M.C.

, et al. (2003). DiGeorge subtypes of nonsyndromic conotruncal defects: evidence against a major role of TBX1 gene. Eur J Hum Genet, 11, 349–351.

Dagle

J.M.

, Sabel

J.L.

, Littig

J.L.

, Sutherland

L.B.

, Kolker

S.J.

, and Weeks

D.L.

(2003). Pitx2c attenuation results in cardiac defects and abnormalities of intestinal orientation in developing Xenopus laevis . Dev Biol, 262, 268–281.

10.

, Pan

, Guan

, Su

, and Ma

(2012). CITED2 mutation links congenital heart defects to dysregulation of the cardiac gene VEGF and PITX2C expression. Biochem Biophys Res Commun, 423, 895–899.

11.

Liu

, Wang

, Wu

, Tan

, Wen

, Wang

, et al. (2014). Variations of CITED2 are associated with congenital heart disease (CHD) in Chinese population. PLoS One, 9, e98157.

12.

Lopes Floro

, Artap

S.T.

, Preis

J.I.

, Fatkin

, Chapman

, Furtado

M.B.

, et al. (2011). Loss of Cited2 causes congenital heart disease by perturbing left-right patterning of the body axis. Hum Mol Genet, 20, 1097–1110.

13.

Nakajima

(2010). Second lineage of heart forming region provides new understanding of conotruncal heart defects. Congenit Anom, 50, 8–14.

14.

Osoegawa

, Schultz

, Yun

, Mohammed

, Shaw

G.M.

, and Lammer

E.J.

(2014). Haploinsufficiency of insulin gene enhancer protein 1 (ISL1) is associated with d-transposition of the great arteries. Mol Genet Genomic Med, 2, 341–351.

15.

Pacheco-Leyva

, Matias

A.C.

, Oliveira

D.V.

, Santos

J.M.

, Nascimento

, Guerreiro

, et al. (2016). CITED2 cooperates with ISL1 and promotes cardiac differentiation of mouse embryonic stem cells. Stem Cell Reports, 7, 1037–1049.

16.

Sperling

, Grimm

C.H.

, Dunkel

, Mebus

, Sperling

H.P.

, Ebner

, et al. (2005). Identification and functional analysis of CITED2 mutations in patients with congenital heart defects. Hum Mutat, 26, 575–582.

17.

, Doughman

, Turakhia

, Jiang

, Landsettle

C.E.

, Agani

F.H.

, et al. (2007). Partial rescue of defects in Cited2-deficient embryos by HIF-1alpha heterozygosity. Dev Biol, 301, 130–140.

18.

, Wu

, Li

, Yang

, Hu

, Zheng

, et al. (2014). CITED2 mutation and methylation in children with congenital heart disease. J Biomed Sci, 21, 7.

19.

Yagi

, Furutani

, Hamada

, Sasaki

, Asakawa

, Minoshima

, et al. (2003). Role of TBX1 in human del22q11.2 syndrome. Lancet, 362, 1366–1373.

20.

Yin

, Haynie

, Yang

, Han

, Kiatchoosakun

, Restivo

, et al. (2002). The essential role of Cited2, a negative regulator for HIF-1alpha, in heart development and neurulation. Proc Natl Acad Sci U S A, 99, 10488–10493.

21.

Zhang

, Wang

, Chen

, Fu

, and Sun

(2016). A novel missense mutation of GATA4 in a Chinese family with congenital heart disease. PLoS One, 11, e0158904.

22.

Zhang

, Shen

, Deng

, Ding

, Mo

, Xu

, et al. (2014). Novel missense variants of ZFPM2/FOG2 identified in conotruncal heart defect patients do not impair interaction with GATA4. PLoS One, 9, e102379.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.03 MB

0.06 MB