Long Noncoding RNA KIF9-AS1 Regulates Transforming Growth Factor-β and Autophagy Signaling to Enhance Renal Cell Carcinoma Chemoresistance via microRNA-497-5p

Abstract

Renal cell carcinoma (RCC) has been regarded as one of the most malignant tumor types. Chemotherapy (such as sorafenib) is used as common strategy for treating RCC. To date, whether long noncoding RNA KIF9-AS1 is involved in RCC progression and drug resistance remains unknown. In this investigation, we detected gene expression levels by western blot and RT-qPCR. MTT and TUNEL experiments were used to show cell viability and apoptosis, respectively. KIF9-AS1 overexpression led to enhanced cell viability, increased IC₅₀ value of sorafenib, and decreased apoptosis. miR-497-5p acted as key interaction factor for KIF9-AS1 in RCC. More importantly, we found that transforming growth factor-β and autophagy signaling pathways were both critical effectors for mediating KIF9-AS1/miR-497-5p axis-induced drug resistance phenotypes (cell viability, IC₅₀, apoptosis) of RCC. In conclusion, our study revealed that KIF9-AS1 played a positive role in drug resistance of RCC cells to sorafenib, potentially driving the development of targeted diagnostic and therapeutical approaches.

Introduction

Renal cell carcinoma (RCC) makes up 2–3% of all types of cancers (Turajlic et al., 2015). Most cases of RCC patients are found at advanced stage with metastatic property. Advanced RCC is inherently refractory to chemotherapy (e.g., sorafenib) (Heinzer et al., 2001; Buti et al., 2013). However, the molecular mechanism underlying sorafenib resistance has not been clarified till now. Long noncoding RNAs (lncRNAs) are characterized by ∼200 nt lncRNAs (Yang et al., 2013). LncRNAs are found to be aberrantly regulated in multiple types of cancers, including RCC (Qu et al., 2016). LncRNA MEG3 modulated p53 and Bcl-xl expressions to induce cisplatin resistance in lung adenocarcinoma cells (Liu et al., 2015). Recently, it has been reported that lncRNA SRLR evokes sorafenib resistance via IL-6/STAT3 in RCC (Xu et al., 2017). To date, KIF9-AS1 has not been investigated under cancer circumstance, which prompts us to link KIF9-AS1 to RCC.

microRNAs are defined as ∼22 nt short noncoding RNAs (Bartel, 2004). They could induce degradation or translational suppression by binding 3′-untranslated region of putative target mRNAs (de Planell-Saguer and Rodicio, 2011). A number of evidences suggested that abnormal expression of microRNAs was associated with various biological processes (for instance, tumorigenesis and drug resistance) (Esquela-Kerscher and Slack, 2006; Bartel, 2009; Krol et al., 2010). MiR-497 has been reported to be implicated in lung cancer (Han et al., 2015), colorectal cancer (Guo et al., 2013), breast carcinoma (Li et al., 2011), prostate (Kong et al., 2015), or osteosarcoma cancer (Shao et al., 2015). More notably, miR-497 level was reduced in RCC tissues. Pengcheng et al. (2017) indicated that miR-497 inhibited RCC tumorigenesis by targeting VEGFR-2 (Pengcheng et al., 2017).

Autophagy is conserved in eukaryotic cells and makes positive contributions to drug resistance of cancer (Kondo et al., 2005; Sui et al., 2013). Although autophagy is a class of cell death, some researches find out that autophagy enhances chemoresistance of cancer cells (Liu et al., 2011a, 2011b). Inhibition of autophagy sensitized tumors to the treatments. In this study, we sought to discover whether autophagy was an important factor for KIF9-AS1/miR-497 in RCC.

In this study, our research aims to point out the mechanisms of KIF9-AS1-induced chemoresistance of RCC. Our conclusions may deepen our understandings of RCC progression and drug resistance, which will contribute to development of novel treatment strategy by targeting KIF9-AS1/miR-497/autophagy.

Materials and Methods

Cell culture and treatment

Our group obtained human RCC cells (Caki-1 and 786-O) from ATCC. We maintained these two cells in RPMI1640 media (Gibco) in culture dishes (Corning). The media were supplemented with fetal bovine serum (FBS, 10%) to fresh RPMI1640 media. After 24 h of plating, the cells were treated with 5 μM of sorafenib (Selleck).

Cell transfection

The SMAD3 cDNAs and KIF9-AS1 were cloned and inserted into pCMV and pcDNA6 vectors, respectively. We utilized lipofectamine 2000 (Invitrogen) to introduce recombinant constructs into the Caki-1 or 786-O cells. Besides, siNC (50 μM), siKIF9-AS1 (50 μM), NC mimic (20 μM), NC inhibitor (20 μM), miR-497-5p mimic (20 μM), or miR-497-5p inhibitor (20 μM) alone was transfected into Caki-1 or 786-O cells with Lipofectamine RNAiMAX Reagent (Invitrogen). Around 24–36 h of transfection, the cells were subject to the subsequent experiments.

MTT assay

Transfected cells were seeded in 96-well culture plates (∼2000 cells/well). After harvesting, 10 μL MTT (5 mg/mL) was added and then incubated for 4 h. Dimethyl sulfoxide (DMSO; 100 μL) was then used to treat cells. We examined the signal at OD490 nm using Microplate Reader. The MTT experiments were performed for three biological replicates.

TUNEL

RCC cells were transfected with oligonucleotides and seeded on coverslips in 24-well plate. The cells were subject to fix using 4% paraformaldehyde for 10 min. Next, TUNEL assays were performed according to manufacturer's instructions (In Situ Cell Death Detection kit; Roche Molecular Biochemicals). The cell nuclei were stained with DAPI solution (Sigma). TUNEL-positive cells were observed in three random fields ( × 200 magnification). The apoptosis rate was expressed as TUNEL-positive cells/total cells (%). The TUNEL experiments were performed for three biological replicates.

Protein extraction and western blot

The whole cells were lysed by RIPA buffer (Thermo Fisher). The proteins of supernatant were fractionated by SDS-PAGE gel and then transferred to PVDF membrane. Next, membrane was blocked with 5% nonfat milk. The immunoblotted membrane was incubated with antibodies. Antibodies are described below: ATG9A (Proteintech; CL488-67096, 1:1000), p62 (Cell Signaling Technology; #16177, 1:1000), SMAD3 (Invitrogen; 51–1500, 1:1000), SMAD5 (Cell Signaling Technology; #12534, 1:1000), GAPDH (Abcam; ab9485, 1:1000), anti-mouse IgG (Abcam; ab6728, 1:2000), and anti-rabbit IgG (Abcam; ab97051, 1:2000). Western blot experiments were performed for three biological replicates.

RT-quantitative polymerase chain reaction

Total RNAs were extracted from RCC cells using TRIzol reagent (Invitrogen). Approximately one microgram RNA was reverse transcribed according to the kit (TaKaRa, Japan) to generate cDNA. Real-time quantitative PCR was done using SYBR Green PCR Master Mix on ABI 7500. The relative gene expression was calculated using 2^−ΔΔCT method. RT-qPCR experiments were performed for three biological replicates. The primer sequences are:

KIF9-AS1-Forward: GCACCTTCCTTTCTTGCCAA;

KIF9-AS1-Reverse: TCTTCCTCCACATCTGCCTG;

miR-497-5p-Forward: CTGTGGTTTGTACGGCACTG;

miR-497-5p-Reverse: CCTCGCTCTAACACCACAGT;

SMAD3-Forward: GAGGTCTGCGTGAATCCCTA;

SMAD3-Reverse: AATATTGCTCTGGGGCTCGA;

GAPDH-Forward: TCGTGGAAGGACTCATGACC;

GAPDH-Reverse: ATGATGTTCTGGAGAGCCCC;

U6-Forward: CTCGCTTCGGCAGCACA;

U6-Reverse: AACGCTTCACGAATTTGCGT;

Statistical analysis

We carried out statistical analysis by GraphPad Prism 8. All experiments were performed for three biological replicates unless otherwise stated. The data were expressed as mean ± SD. Two or multiple group comparisons were performed by two-tailed Student's t-test or one-way ANOVA method (Tukey's test). *p < 0.05 was regarded as statistically significant in our study.

Results

KIF9-AS1 promoted chemoresistance of RCC

To date, KIF9-AS1 has not been shown to be involved in cancer progression. To investigate the function of KIF9-AS1 in RCC, we ectopically overexpressed KIF9-AS1 in Caki-1 and 786-O cells (Fig. 1A). MTT experiment showed that sorafenib treatment markedly decreased cell viability of RCC cells. KIF9-AS1 overexpression resulted in relatively enhanced cell viability of RCC cells under sorafenib treatment (Fig. 1B). We measured IC₅₀ value of sorafenib in RCC cells. IC₅₀ of empty vector (EV) RCC cell was lower (∼50%) than that of KIF9-AS1-overexpressed cells (Fig. 1C). Besides, we used TUNEL assay to examine apoptosis of Caki-1 or 786-O cells treated with or without sorafenib. In the result, we found that sorafenib caused higher apoptosis level of cells, while KIF9-AS1 reduced apoptosis rate of RCC cells compared to EV group (Fig. 1D, E). Taken together, KIF9-AS1 played a stimulatory role in chemoresistance of RCC.

FIG. 1.

KIF9-AS1 promoted chemoresistance of RCC. (A) KIF9-AS1 levels were examined by RT-qPCR in Caki-1 or 786-O cells. ***p < 0.001. (B) Cell viability of Caki-1 or 786-O cells were measured by MTT assay. *p < 0.05; **p < 0.01. (C) IC₅₀ value of sorafenib was determined in Caki-1 or 786-O cells transfected with EV or pcDNA6-KIF9-AS1. *p < 0.05; **p < 0.01. (D, E) TUNEL and statistics show apoptosis of Caki-1 or 786-O cells with indicated treatments or constructs. *p < 0.05; **p < 0.01. EV, empty vector; RCC, renal cell carcinoma.

miR-497-5p mediated KIF9-AS1-enhanced chemoresistance of RCC

To search for putative interacting miRNAs for KIF9-AS1, we predicted and selected the well-studied miRNA in RCC. Therefore, we identified miR-497-5p as potential effector for KIF9-AS1-enhanced chemoresistance of RCC. Prediction program showed that KIF9-AS1 might interact with miR-497-5p (Fig. 2A). RT-qPCR result demonstrated that miR-497-5p negatively regulated KIF9-AS1 expression in Caki-1 cells (Fig. 2B).

FIG. 2.

miR-497-5p mediated KIF9-AS1-enhanced chemoresistance of RCC. (A) Interaction of miR-497-5p with KIF9-AS1 was predicted by StarBase2.0. (B) KIF9-AS1 and miR-497-5p levels were detected by RT-qPCR in Caki-1 cells with indicated oligonucleotides. **p < 0.01; ***p < 0.001. (C) miR-497-5p levels were detected by RT-qPCR in Caki-1 cells with indicated constructs. **p < 0.01; ***p < 0.001. (D) Cell viability of Caki-1 cells was measured by MTT assay under 5 μM sorafenib treatment. *p < 0.05; **p < 0.01. (E) IC₅₀ value of sorafenib was determined in Caki-1 cells with indicated constructs. **p < 0.01; ***p < 0.001. (F, G) TUNEL and statistics show apoptosis of Caki-1 cells with indicated treatments or constructs under 5 μM sorafenib treatment. *p < 0.05.

To explore whether miR-497-5p was important for KIF9-AS1-enhanced chemoresistance of RCC, we transfected miR-497-5p mimic into KIF9-AS1-overexpressed Caki-1 cells (Fig. 2C). MTT showed that KIF9-AS1-enhanced cell viability was significantly reduced by miR-497-5p mimic (Fig. 2D). In addition, we observed that miR-497-5p mimic decreased sorafenib IC₅₀ value of Caki-1 cells comparable to EV group (Fig. 2E). On the contrary, we sought to determine the apoptosis of Caki-1 cells by transfecting KIF9-AS1 and miR-497-5p. Expectedly, miR-497-5p mimic contributed to the number of TUNEL-positive KIF9-AS1-harboring cells (Fig. 2F, G). In conclusion, miR-497-5p was crucial for KIF9-AS1-induced chemoresistance of RCC.

Transforming growth factor-β signaling was responsible for KIF9-AS1/miR-497-5p-regulated chemoresistance of RCC

As transforming growth factor (TGF)-β signaling was involved in chemoresistance of a variety of cancers, we investigated whether TGF-β signaling-associated gene (SMADs) expression was modulated by miR-497-5p in Caki-1 cells. Furthermore, the prediction program TargetScan showed that SMAD3 was potential target of miR-497-5p (Fig. 3A). Western blot result indicated that miR-497-5p mimic inhibited SMAD3 and SMAD5 proteins level (Fig. 3B).

FIG. 3.

TGF-β signaling was responsible for miR-497-5p-regulated chemoresistance of RCC. (A) Interaction of miR-497-5p with ATG9A was predicted by TargetScan. (B) SMAD3 and SMAD5 levels were examined by western blot in Caki-1 cells. GAPDH was internal control. (C) SMAD3 mRNA levels were detected by RT-qPCR in Caki-1 cells with indicated constructs. **p < 0.01; ***p < 0.001. (D) Cell viability of Caki-1 cells were measured by MTT assay under 5 μM sorafenib treatment. *p < 0.05; **p < 0.01. (E) IC₅₀ value of sorafenib was determined in Caki-1 cells with indicated constructs. *p < 0.05; **p < 0.01. (F, G) TUNEL and statistics show apoptosis of Caki-1 cells with indicated constructs under 5 μM sorafenib treatment. **p < 0.01. (H) SMAD3 mRNA levels were detected by RT-qPCR in Caki-1 cells with indicated constructs. **p < 0.01; ***p < 0.001.

RT-qPCR result demonstrated that SMAD3 was overexpressed in Caki-1 cells (Fig. 3C). We intended to assess whether SMAD3 was critical for KIF9-AS1-enhanced chemoresistance of RCC. MTT showed that miR-497-5p mimic-modulated cell viability was partially rescued by SMAD3 (Fig. 3D). For IC₅₀ measurement, SMAD3 transfection led to higher IC₅₀ of Caki-1 cells expressing miR-497-5p (Fig. 3E). Furthermore, we determined the apoptosis of Caki-1 cells expressing miR-497-5p and SMAD3. SMAD3 greatly suppressed apoptosis of Caki-1 cells expressing miR-497-5p (Fig. 3F, G). Finally, we sought to determine whether KIF9-AS1 regulated SMAD3 via miR-497-5p. RT-qPCR showed that miR-497-5p could revert KIF9-AS1-induced SMAD3 expression (Fig. 3H). To conclude, these results indicated that TGF-β signaling acted as key effector for KIF9-AS1/miR-497-5p axis in RCC.

Autophagy was implicated in KIF9-AS1/miR-497-5p-modulated chemoresistance of RCC

In previous study, we noted that autophagy was involved in chemoresistance of RCC. Hence, we investigated whether or not autophagy-related genes were modulated by miR-497-5p. By prediction program, miR-497-5p directly targeted and regulated autophagy-related genes ATG9A (Fig. 4A). Western blot analysis revealed that ATG9A was downregulated in Caki-1 cells after transfecting miR-497-5p inhibitor, whereas p62 was upregulated (Fig. 4B).

FIG. 4.

Autophagy was implicated in miR-497-5p-modulated chemoresistance of RCC. (A) Interaction of miR-497-5p with ATG9A was predicted by TargetScan. (B) ATG9A and p62 protein levels were examined by western blot in Caki-1 cells. GAPDH was internal control. (C) Cell viability of Caki-1 cells was measured by MTT assay under 5 μM sorafenib treatment. *p < 0.05; **p < 0.01. (D) IC₅₀ value of sorafenib was determined in Caki-1 cells transfected with indicated constructs and treated with 3-MA. **p < 0.01. (E, F) TUNEL and statistics show apoptosis of Caki-1 cells under 5 μM sorafenib treatment. *p < 0.05; **p < 0.01. (G, H) ATG9A and p62 mRNA levels were detected by RT-qPCR in Caki-1 cells with indicated constructs. **p < 0.01; ***p < 0.001.

To evaluate the role of autophagy in miR-497-5p-modulated chemoresistance of RCC, we used autophagy inhibitor 3-MA to treat miR-497-5p inhibitor-transfected cells. miR-497-5p inhibitor led to increase in cell viability, while 3-MA inhibited cell viability (Fig. 4C). Likewise, IC₅₀ value was largely elevated in miR-497-5p inhibitor transfected Caki-1 cells. 3-MA significantly lowered sorafenib IC₅₀ (Fig. 4D). Finally, TUNEL was utilized to show 3-MA contributed to apoptosis rate of miR-497-5p inhibitor Caki-1 cells (Fig. 4E, F). We also found that ATG9A was upregulated and p62 was downregulated by KIF9-AS1, which were rescued by miR-497-5p mimic (Fig. 4G, H). Above all, we suggested that autophagy was critical for KIF9-AS1/miR-497-5p axis-regulated chemoresistance of RCC.

Discussion

In this research, we proposed a completely new molecular axis for elucidating RCC progression and drug resistance (Fig. 5). The results demonstrated that KIF9-AS1 strongly enhanced cell viability and attenuated apoptosis, which was reverted by miR-497-5p. As downstream effectors, TGF-β and autophagy signaling pathways were the two key factors for KIF9-AS1/miR-497-5p-mediated chemoresistance of RCC cells.

FIG. 5.

Working model for depicting the regulatory mechanism KIF9-AS1/miR-497-5p/TGF-β/autophagy for RCC chemoresistance. This model describes the promoting role of KIF9-AS1 in RCC chemoresistance via interacting with miR-497-5p. TGF-β and autophagy signaling pathways are directly regulated by miR-497-5p, which mediates KIF9-AS1-enhanced RCC chemoresistance.

Sorafenib was the well-known tyrosine kinase inhibitor and approved by FDA in 2005 (Liang et al., 2018). For early-stage RCC patients, sorafenib had encouraging effects on overall survival. Unfortunately, sorafenib resistance-induced relapse of RCC tumors is not rarely observed. Currently, there is no better treatment choice for sorafenib-resistant RCC patients. As a result, medium 5-year survival rate is less than 13% (Samuels-Lev et al., 2001). In our study, we focused on illuminating the molecular mechanism of RCC drug resistance.

LncRNAs exerted multiple effects in various types of cancers. In many articles, lncRNAs were shown to interact with microRNAs or known cellular signalings. For examples, SARCC altered miR-143-3p expression as ceRNA and regulated androgen receptor (Zhai et al., 2017). Huang et al. (2018) showed that DUXAP8 negatively regulated miR-126 to promote RCC (Huang et al., 2018). Interestingly, HOTAIR inhibited miR-217 and modulated HIF-1α/AXL signaling (Hong et al., 2017). Likewise, we also revealed that KIF9-AS1 directly interacted with miR-497-5p in Caki-1 and 786-O cells. Previous investigation indicated that miR-497 suppressed VEGFR-2 and MAPK pathway in ACHN cells (Pengcheng et al., 2017). Our data exhibited that miR-497 blocked TGF-β and autophagy signaling in RCC cells. Thus, it is hypothesized that several effectors may be targets of miR-497 in RCC, which will be the major orientation for investigating RCC.

miRNAs were reported to regulate gene expression by mediating feedback and feedforward loops (Tsang et al., 2007). Feedback loops were divided into positive and negative loops between miRNAs and upstream factors (e.g., transcription factor). Feedforward loops include coherent and incoherent loops. Coherent loops were defined as same effect of miRNA and upstream factor on target, whereas incoherent loops had opposite effect (Lai et al., 2016). Our study showed that KIF9-AS1 and miR-497-5p exhibited opposite effect on their targets (SMAD3 and ATG9A), suggesting that feedforward loop existed between KIF9-AS1 and miR-497-5p.

miRNA-based therapies were developed via two major approaches. One was inhibition of oncogenic miRNAs by miRNA antagonists and the other was upregulation of tumor suppressor miRNAs by miRNA mimic (Lai et al., 2019). For treatment of acute lymphoblastic leukemia cells of children, miR-125b, miR-99a, and miR-100 downregulated target gene expression to induce resistance to chemotherapy (Akbari Moqadam et al., 2013). Lai et al. (2018) reported that miR-205 and miR-342 overexpression led to reduction of chemoresistance through repression of E2F1 in melanoma and lung cancer.

The TGF-β signaling pathway is widely believed to be deregulated in many diseases, including cancer (Colak and ten Dijke, 2017). Activation of TGF-β signaling pathway can be initiated by interaction of TGF-β ligand with its cognate specific receptors. Then, activated receptor phosphorylates SMAD2 and SMAD3, which leads to translocation of the complex to nucleus to regulate gene expression (Schmierer and Hill, 2007). Some researches found that TGF-β signaling stimulated expression of EMT transcription factors (e.g., Snail, Slug), thereby influencing migration, invasion, and chemoresistance (Fischer et al., 2015; Nieto et al., 2016). In agreement with these findings, we also observed that SMAD3 and SMAD5 were the direct targets and downregulated by miR-497. By introducing SMAD3, miR-497-suppressed chemoresistance was rescued.

Autophagy was commonly implicated in physiological and pathological processes. Intriguingly, ATG5 deficiency in nude mice had more chances to form tumor, suggesting that autophagy played tumor suppressive role (Karantza-Wadsworth et al., 2007). By contrast, autophagy was confirmed to promote resistance of chemotherapy or radiotherapy in a vast number of cancers (Wang et al., 2011). The contradictory effects of autophagy in cancer might be due to unique cell or tissue microenvironment. We revealed that autophagy played a contributory role in sorafenib resistance of RCC. In Figure 4B, we observed that p62 expression could be regulated by miR-497-5p, suggesting that p62 was a target of miR-497-5p. Although the prediction program did not show that p62 was directly targeted by miR-497-5p, we supposed that p62 might be indirect target of miR-497-5p through other factors (e.g., transcription factors). In the future, it is another interesting project for us to explore.

Conclusions

In summary, our research group depicts a wholly new panorama to make clear the mechanism underlying KIF9-AS1-affected chemoresistance of RCC. Accordingly, we believe that our findings will advance our understanding of RCC and facilitate advent of targeted therapeutical approach.

Footnotes

Acknowledgment

We thank Lei Qin for helpful suggestions and critical reading of the article.

Authors' Contributions

Xiaojun Zhao and Xuefeng He: designed and performed experiments; Yichen Jin, Ru Huang, and Yanfu Xia: western blot experiments and RT-qPCR assay; Chen Huang and Feng Qiu: prepared figures; Jinxian Pu: wrote the article.

Disclosure Statement

No competing financial interests exist.

Funding Information

No funding was received.

References

Akbari Moqadam

, Lange-Turenhout

E.A.

, Aries

I.M.

, Pieters

, and den Boer

M.L.

(2013). MiR-125b, miR-100 and miR-99a co-regulate vincristine resistance in childhood acute lymphoblastic leukemia. Leukemia Res, 37, 1315–1321.

Bartel

D.P.

(2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell, 116, 281–297.

Bartel

D.P.

(2009). MicroRNAs: target recognition and regulatory functions. Cell, 136, 215–233.

Buti

, Bersanelli

, Sikokis

, Maines

, Facchinetti

, Bria

, et al. (2013). Chemotherapy in metastatic renal cell carcinoma today?. A systematic review. Anti Cancer Drugs, 24, 535–554.

Colak

, and ten Dijke

(2017). Targeting TGF-β signaling in cancer. Trends Cancer, 3, 56–71.

de Planell-Saguer

, and Rodicio

M.C.

(2011). Analytical aspects of microRNA in diagnostics: a review. Anal Chim Acta, 699, 134–152.

Esquela-Kerscher

, and Slack

F.J.

(2006). Oncomirs - microRNAs with a role in cancer. Nat Rev Cancer, 6, 259–269.

Fischer

K.R.

, Durrans

, Lee

, Sheng

, Li

, Wong

S.T.

, et al. (2015). Epithelial-to-mesenchymal transition is not required for lung metastasis but contributes to chemoresistance. Nature, 527, 472–476.

Guo

S.T.

, Jiang

C.C.

, Wang

G.P.

, Li

Y.P.

, Wang

C.Y.

, Guo

X.Y.

, et al. (2013). MicroRNA-497 targets insulin-like growth factor 1 receptor and has a tumour suppressive role in human colorectal cancer. Oncogene, 32, 1910–1920.

10.

Han

, Zhang

, Yang

, Liu

, Wu

, Zhang

, et al. (2015). miR-497 and miR-34a retard lung cancer growth by co-inhibiting cyclin E1 (CCNE1). Oncotarget, 6, 13149–13163.

11.

Heinzer

, Huland

, and Huland

(2001). Systemic chemotherapy and chemoimmunotherapy for metastatic renal cell cancer. World J Urol, 19, 111–119.

12.

Hong

, Li

, Zheng

, Xiao

W.Z.

, Zhang

, Wu

, et al. (2017). LncRNA HOTAIR regulates HIF-1alpha/AXL signaling through inhibition of miR-217 in renal cell carcinoma. Cell Death Dis, 8, e2772.

13.

Huang

, Wang

, Yang

, Ji

, Wang

, Yue

, et al. (2018). Long Non-Coding RNA DUXAP8 Enhances Renal Cell Carcinoma Progression via Downregulating miR-126. Med Sci Monit, 24, 7340–7347.

14.

Karantza-Wadsworth

, Patel

, Kravchuk

, Chen

, Mathew

, Jin

, et al. (2007). Autophagy mitigates metabolic stress and genome damage in mammary tumorigenesis. Genes Dev, 21, 1621–1635.

15.

Kondo

, Kanzawa

, Sawaya

, and Kondo

(2005). The role of autophagy in cancer development and response to therapy. Nat Rev Cancer, 5, 726–734.

16.

Kong

X.J.

, Duan

L.J.

, Qian

X.Q.

, Xu

, Liu

H.L.

, Zhu

Y.J.

, et al. (2015). Tumor-suppressive microRNA-497 targets IKKbeta to regulate NF-kappaB signaling pathway in human prostate cancer cells. Am J Cancer Res, 5, 1795–1804.

17.

Krol

, Loedige

, and Filipowicz

(2010). The widespread regulation of microRNA biogenesis, function and decay. Nat Rev Genet, 11, 597–610.

18.

Lai

, Eberhardt

, Schmitz

, and Vera

(2019). Systems biology-based investigation of cooperating microRNAs as monotherapy or adjuvant therapy in cancer. Nucleic acids Res, 47, 7753–7766.

19.

Lai

, Gupta

S.K.

, Schmitz

, Marquardt

, Knoll

, Spitschak

, et al. (2018). MiR-205-5p and miR-342-3p cooperate in the repression of the E2F1 transcription factor in the context of anticancer chemotherapy resistance. Theranostics, 8, 1106–1120.

20.

Lai

, Wolkenhauer

, and Vera

(2016). Understanding microRNA-mediated gene regulatory networks through mathematical modelling. Nucleic acids Res, 44, 6019–6035.

21.

, Zhao

, Liu

, Chen

, Qi

, Jiang

, et al. (2011). Analysis of MiR-195 and MiR-497 expression, regulation and role in breast cancer. Clin Cancer Res, 17, 1722–1730.

22.

Liang

Y.Y.

, Deng

X.B.

, Zeng

L.S.

, Lin

X.T.

, Shao

X.F.

, Wang

, et al. (2018). RASSF6-mediated inhibition of Mcl-1 through JNK activation improves the anti-tumor effects of sorafenib in renal cell carcinoma. Cancer Lett, 432, 75–83.

23.

Liu

, Wan

, Lu

, Sun

, Pan

, Zhang

, et al. (2015). The long noncoding RNA MEG3 contributes to cisplatin resistance of human lung adenocarcinoma. PLoS One, 10, e0114586.

24.

Liu

, Yang

, Kang

, Wang

, Zhao

, Yu

, et al. (2011a). HMGB1-induced autophagy promotes chemotherapy resistance in leukemia cells. Leukemia, 25, 23–31.

25.

Liu

, Yang

, Kang

, Wang

, Zhao

, Yu

, et al. (2011b). DAMP-mediated autophagy contributes to drug resistance. Autophagy, 7, 112–114.

26.

Nieto

M.A.

, Huang

R.Y.

, Jackson

R.A.

, and Thiery

J.P.

(2016). Emt: 2016. Cell, 166, 21–45.

27.

Pengcheng

, Ziqi

, Luyao

, Xiangwei

, Liang

, Yuwei

, et al. (2017). MicroRNA-497 suppresses renal cell carcinoma by targeting VEGFR-2 in ACHN cells. Biosci Rep, 37, BSR20170270.

28.

, Ding

, Chen

, Wu

Z.J.

, Liu

, Gao

, et al. (2016). Exosome-transmitted lncARSR promotes sunitinib resistance in renal cancer by acting as a competing endogenous RNA. Cancer Cell, 29, 653–668.

29.

Samuels-Lev

, O'Connor

D.J.

, Bergamaschi

, Trigiante

, Hsieh

J.K.

, et al. (2001). ASPP proteins specifically stimulate the apoptotic function of p53. Mol Cell, 8, 781–794.

30.

Schmierer

, and Hill

C.S.

(2007). TGFbeta-SMAD signal transduction: molecular specificity and functional flexibility. Nat Rev Mol Cell Biol, 8, 970–982.

31.

Shao

X.J.

, Miao

M.H.

, Xue

, Ji

X.Q.

, and Zhu

(2015). The Down-Regulation of MicroRNA-497 Contributes to Cell Growth and Cisplatin Resistance Through PI3K/Akt Pathway in Osteosarcoma. Cell Physiol Biochem, 36, 2051–2062.

32.

Sui

, Chen

, Wang

, Huang

, Kong

, Zhang

, et al. (2013). Autophagy and chemotherapy resistance: a promising therapeutic target for cancer treatment. Cell Death Dis, 4, e838.

33.

Tsang

, Zhu

, and van Oudenaarden

(2007). MicroRNA-mediated feedback and feedforward loops are recurrent network motifs in mammals. Mol Cell, 26, 753–767.

34.

Turajlic

, Larkin

, and Swanton

(2015). SnapShot: Renal cell carcinoma. Cell, 163, 1556–1556 e1.

35.

Wang

, Liu

, Li

, Mao

, Lei

, Wu

, et al. (2011). Quercetin induces protective autophagy in gastric cancer cells: involvement of Akt-mTOR- and hypoxia-induced factor 1alpha-mediated signaling. Autophagy, 7, 966–978.

36.

, Yang

, Wei

, Liu

, Chen

, Bao

, et al. (2017). Long noncoding RNA-SRLR elicits intrinsic sorafenib resistance via evoking IL-6/STAT3 axis in renal cell carcinoma. Oncogene, 36, 1965–1977.

37.

Yang

, Lin

, Jin

, Yang

J.C.

, Tanasa

, Li

, et al. (2013). lncRNA-dependent mechanisms of androgen-receptor-regulated gene activation programs. Nature, 500, 598–602.

38.

Zhai

, Sun

, Guo

, Hu

, Wang

, Zheng

, et al. (2017). LncRNA-SARCC suppresses renal cell carcinoma (RCC) progression via altering the androgen receptor(AR)/miRNA-143-3p signals. Cell Death Differ, 24, 1502–1517.