Long Noncoding RNA HAND2-AS1 Suppresses Cell Proliferation,Migration,and Invasion of Bladder Cancer via miR-17-5p / KLF9 Axis

Abstract

Bladder cancer (BC) is the most common type of malignant tumor in the genitourinary system. Through the microarray analysis of clinical samples, long noncoding RNA HAND2-AS1 expression was found to be downregulated in BC tissues. However, the function of HAND2-AS1 on BC and underlying mechanism are unclear. In this study, the correlations of HAND2-AS1 with clinicopathological parameters in BC patients were determined. The gain- and loss-of-function experiments were conducted to examine the role of HAND2-AS1 in malignant behaviors of BC cells in vitro and in vivo. Then, we paid attention to miR-17-5p/KLF9 axis to illustrate the molecular mechanism. Results showed that HAND2-AS1 was downregulated in BC tissues, and its overexpression significantly inhibited cell proliferation, migration, and invasion in vitro, as well as tumor growth in vivo. Knockdown of HAND2-AS1 caused an opposite effect on BC cell malignancies. Furthermore, miR-17-5p was shown to be a direct target of HAND2-AS1, and it reversed the inhibitory effect of HAND2-AS1 on BC malignancies. Also, as a downstream factor of miR-17-5p, KLF9 silencing was demonstrated to mediate the role of miR-17-5p inhibitor in BC cell proliferation and invasion. Thus, it suggests that HAND2-AS1 acts as a suppressor in BC development through miR-17-5p/KLF9 axis.

Introduction

Bladder cancer (BC) is the most common genitourinary malignancy that exerts enormous psychological and economic burden on patients (Lenis et al., 2020). It has been indicated that >90% of BCs are characterized as bladder urothelial carcinoma with poor prognosis (Sjödahl et al., 2012; Siegel et al., 2021). Although significant progress has been made in the treatment of BC, the survival rate still remains quite low (Patel et al., 2020). Thus, more studies should be conducted to investigate the effective biomarkers for BC diagnosis and prognosis and underlying mechanisms.

Long noncoding RNA (lncRNA) is a new class of noncoding RNAs with various biological functions in tumor progression (Bhan et al., 2017). For example, LINC00941 interacts with MST1 to activate Hippo pathway and promote glycolysis in pancreatic ductal adenocarcinoma (Xu et al., 2021). Li et al. (2021) show that lncRNA inducing MHC-I and immunogenicity of tumor (LIMIT) enhances tumor immunogenicity and checkpoint therapy through the GBP/HSF1 axis.

Wang et al. (2021) suggest that lncRNA GAS6-AS1 promotes GIMAP6 expression by sponging miR-24-3p and suppresses the migration and invasion of lung adenocarcinoma. Importantly, our preliminary microarray analysis between BC tissues and adjacent normal tissues showed that the expression level of lncRNA HAND2-AS1 was downregulated in BC tissues. Thus, we made great focuses on the biological functions of HAND2-AS1 and underlying mechanisms in BC.

Numerous studies have identified that lncRNAs interact with microRNAs (miRNAs) to affect gene expression and control cellular biological processes. For example, Yan et al. (2020) indicate that HAND2-AS1 competitively binds to miR-3118 to activate SOCS5 expression, resulting in the inhibition of liver cancer cell proliferation and migration. Prior studies also demonstrate that miR-17-5p is an oncogenic factor in BC progression (Yang et al., 2018; Peng and Li, 2019).

In addition, the antioncogenic effect of KLF9 (Kruppel like factor 9) is introduced in diverse cancers, including gastric cancer (Li et al., 2019), liver cancer (Sun et al., 2014), and colorectal cancer (Brown et al., 2015). In the progression of BC, KLF9 is reported to be related to the regulation of circPTPRA/miR-636 on tumorigenicity (He et al., 2019). Our bioinformatic analysis showed that HAND2-AS1 had potential binding sites with miR-17-5p, and miR-17-5p might also be complementary with KLF9. Therefore, we proposed that HAND2-AS1 could suppress tumor growth in BC progression through miR-17-5p/KLF9 axis.

Materials and Methods

Clinic samples

The fresh bladder tumor tissues and adjacent healthy tissues were collected from The First Affiliated Hospital of Zhengzhou University. All patients did not undergo any chemotherapy or radiotherapy before surgery, and they had written informed consent form. The clinicopathological parameters of BC patients (n = 60) are given in Table 1. The expression levels of HAND2-AS1 were determined in bladder tumors and matched with adjacent nontumor tissues of BC patients (n = 30) using quantitative real time polymerase chain reaction (qRT-PCR) analysis. This study received IRB approval by the life science ethics committee of Zhengzhou University.

Table 1.

Correlation Between HAND2-AS1 Expression Level and Clinicopathological Parameters of Bladder Cancer Patients

Clinical parameters	HAND2-AS1 expression level		p
Clinical parameters	Low (30)	High (30)	p
Gender
Male	13	13	0.99999
Female	17	17
Age (years)
≤60	15	15	0.99999
>60	15	15
T
pTa-T1	19	28	0.00480^**
T2-T4	11	2
N
Positive	17	29	0.00025^**
Negative	13	1
M
M0	27	29	0.60477
M1	3	1
TNM
I–II	23	29	0.05758
III–IV	7	1
Tumor size
≤3 cm	20	27	0.02827^*
>3 cm	10	3

Chi-Square test.

p < 0.05, ^** p < 0.01.

Cell culture

Human BC cell lines (T24, 5637, UM-UC-3, SW780, and TCCSUP) and human epithelial SV40 immortalized uroepithelium cell line SV-HUC-1 were obtained from Procell in Wuhan, China. SV-HUC-1, T24, 5637, and SW780 cell lines were, respectively, cultured in Ham's F-12K (PM150910; Procell), McCoy's 5A (PM150710; Procell), RPMI-1640 (R6504; Sigma), and Leibovitz's L-15 (PM151010; Procell) medium supplemented with 10% fetal bovine serum (FBS, F8067; Sigma). UM-UC-3 and TCCSUP cell lines were cultured in minimum Eagle's medium (PM150410; Procell) supplemented with 10% FBS. All cells were cultured at 37°C in a 5% CO₂ humidified incubator.

Cell treatment and cell transfection

To determine the effect of HAND2-AS1, UM-UC-3 cells were infected with adenovirus carrying HAND2-AS1 or empty vector (ov-NC) for 72 h, and 5637 cells were infected with adenovirus carrying HAND2-AS1 shRNA (sh-HAND2-AS1) or nontargeting shRNA (sh-NC) for 72 h. In addition, si-NC, si-KLF9 NC mimics, miR-17-5p mimics, miR-17-5p inhibitor, or NC inhibitor obtained from JTS Scientific (Wuhan, China) was transfected into BC cells. Cell transfection was undertaken by Lipofectamine 2000 (11668-019; Invitrogen) according to the manufacturer's protocol.

qRT-PCR analysis

TRIpure reagent (RP1001; BioTeke, Beijing, China) was used to extract total RNAs from tissues or cells. Then, total RNAs were reverse transcribed into cDNAs using a Super Script M-MLV Reverse Transcriptase Kit (PR6502; BioTeke) or a miRNA First Strand cDNA Synthesis Kit (#B532451; Sangon, Shanghai, China). qRT-PCR was carried out using the SYBR Green reagent (SY1020; Solarbio, Beijing, China). The expression of HAND2-AS1 and KLF9 was normalized to β-actin, whereas miR-17-5p expression was normalized to U6. The primer sequences are given in Table 2. 2^−ΔΔCt method was used for calculating the relative expression of each gene.

Table 2.

The Primer Sequences

Name	Sequences (5′-3′)
HAND2-AS1 forward	CTCACCTCCCAGACCCT
HAND2-AS1 reverse	ACAAGCCAACCCGTAAT
KLF9 forward	GGACCTGAACAAGTACCGA
KLF9 reverse	CTTTGAGATGGGAGGATTTT
β-actin forward	GGCACCCAGCACAATGAA
β-actin reverse	TAGAAGCATTTGCGGTGG

Western blot analysis

Protein samples were collected using the cell lysis buffer (P0013; Beyotime, Beijing, China), and prepared to separate with the sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel. Then proteins were transferred onto polyvinylidene fluoride (PVDF) membranes (IPVH00010; Millipore). After blocking in skimmed milk for 1 h, membranes were incubated with the primary antibodies at 4°C overnight.

The primary antibodies are listed as follows: Vimentin (AF7013, Affinity, 1: 1000), PCNA (A12427, 1: 1000; ABclonal, Wuhan, China), MMP9 (10375-2-AP, 1: 1000; Proteintech), cyclin D1 (A19038, 1: 500; ABclonal), and β-actin (sc-47778, 1: 1000; Santa cruz). Then bands were probed with the secondary antibodies (A0208 or A0216, 1:5000; Beyotime) at 37°C for 45 min, and visualized through the gel image system (WD-9413B; LIU YI, Beijing, China).

Cell Counting Kit-8 assay

Cells (4 × 10³ per well) were seeded into 96-well plates, and cultured for 24, 48, or 72 h. Subsequently, the Cell Counting Kit-8 (CCK-8) reagent (10 μL, C0038; Beyotime) was added to incubate with cells for 1 h, and the optical density (OD) value was detected at 450 nm using a microplate reader (800Ts; BIOTEK).

Flow cytometry analysis

The collected cells were fixed in 70% ethanol at 4°C overnight, and incubated using a cell cycle detection kit (KGA512, Keygen, China) for 30 min in the dark. Finally, cell cycle distribution was detected suing a flow cytometer (NovoCyte, ACEA).

Wound healing assay

UM-UC-3 and 5637 cells were seeded into six-well plates and cultured in a serum-free medium. After treatment with 1 μg/mL mitomycin C (M0503, Sigma) for 1 h, cells were scratched using a 200 μL pipette tip and cultured for another 24 h. Finally, the wound field was captured using a microscope ( × 100 magnification), and the wound healing ratio was calculated.

Transwell invasion assay

Transwell inserts (3422; Corning) were precoated with the Matrigel (356234; BD). Then cell suspension was plated into the upper chamber of Transwell inserts and cultured for 24 h. The bottom chambers were filled with cell medium containing 10% FBS. After fixing in 4% paraformaldehyde (80096628; Sinopharm, China) for 20 min, cells were stained using 0.1% crystal violet (0528; Amresco) for 5 min. Finally, number of cells in five random fields was counted to assess the invasion capacity under the microscope ( × 200 magnification).

Dual-luciferase reporter assay

The wild-type (WT) or mutant (Mut) sequences of HAND2-AS1 or KLF9 containing binding sites with miR-17-5p were inserted into the pmirGLO luciferase vector (E133A; Promega). For the luciferase reporter assay, 293T cells (Zhong Qiao Xin Zhou Biotechnology, Shanghai) were cotransfected with miR-17-5p or NC mimics and the respective luciferase reporter vector (HAND2-AS1-WT/Mut or KLF9-WT/Mut) using Lipofectamine 2000. The relative luciferase activity was assessed using the Dual-Luciferase^® Reporter Assay System (E1910; Promega) after the 48-h transfection.

Animal experiments

All experiments were performed in accordance with the guide for the care and use of laboratory animals and approved by the life science ethics committee of Zhengzhou University. A total of 24 BALB/c nude mice (Huafukang, Beijing) were housed in a standard environment, and randomly divided into four groups (n = 6/group). For xenograft tumor experiments, UM-UC-3 and 5637 cells were injected into the right axillary subcutaneously. When tumor volume was ∼100–150 mm³, the adenovirus carrying HAND2-AS1/ov-NC or sh-HAND2-AS1/sh-NC (5.0 × 10⁹ PFU) was injected into tumor tissues in situ once a week. Tumor volume was measured every 3 days from day 7. Finally, mice were sacrificed, and tumor tissues were collected.

Immunohistochemistry assay

The collected tumor sections were deparaffinized and retrieved in citrate buffer for antigen retrieval. After incubating in 3% H₂O₂ for 15 min, the sections were blocked with goat serum (SL038; Solarbio) for 15 min and incubated with PCNA (1: 200) at 4°C overnight in a humidified box. Then tumor sections were incubated with HRP-labeled secondary antibody (1: 500, #31460; ThermoFisher) at 37°C for 1 h, and stained with DAB reagent (DA1010; Solarbio). After counterstaining in hematoxylin, the positive materials for PCNA in tumor tissues were observed under a microscope ( × 400 magnification).

Statistical analysis

All statistical analyses were performed using GraphPad Prism 8.0 (GraphPad, San Diego, CA). Data are shown as the means ± standard deviation. Unpaired t-test, one-way analysis of variance (ANOVA), or two-way ANOVA was used to analyze data. The associations between HAND2-AS1 and bladder tumor clinical characteristics were determined using the chi-square test. Differences were considered to be significant at p < 0.05.

Results

HAND2-AS1 was downregulated in BC tissues and cell lines

Compared with that in adjacent healthy tissues, we found that the expression of HAND2-AS1 was downregulated in BC tissues by the qRT-PCR assay (Fig. 1A). It suggests that HAND2-AS1 is likely to be associated with BC development. As given in Table 1, we further determined the associations between HAND2-AS1 expression levels and clinical status in BC patients. Results showed that the expression levels of HAND2-AS1 were correlated with tumor stage, lymph node metastasis and tumor size, but were independent of gender, age, distant metastasis or TNM (Table 1). These results show the possible role of HAND2-AS1 in BC development.

FIG. 1.

lncRNA HAND2-AS1 was downregulated in BC. (A) The expression of HAND2-AS1 in BC tissues and matched normal tissues. ^^p < 0.01, compared with normal tissues. (B) The expression of HAND2-AS1 in BC cell lines and human uroepithelial cell line SV-HUC-1. (C, D) The expression of HAND2-AS1 in UM-UC-3 and 5637 cells. **p < 0.01, compared with cells transfected with ov-NC; ^## p < 0.01 compared with cells transfected with sh-NC. BC, bladder cancer; lncRNA, long noncoding RNA. Color images are available online.

We also observed a reduction of HAND2-AS1 expression in BC cell lines (Fig. 1B). To investigate HAND2-AS1's effect on BC development, UM-UC-3 cells were infected with HAND2-AS1-overexpressing adenovirus, and 5637 cells were infected with HAND2-AS1-interfering adenovirus. qRT-PCR results demonstrated that the expression levels of HAND2-AS1 were significantly upregulated by its overexpression adenovirus, and downregulated by sh-HAND2-AS1 (Fig. 1C, D).

HAND2-AS1 suppressed BC cell proliferation

To evaluate the effect of HAND2-AS1 on cell proliferation, CCK-8 assay was first performed and results showed that overexpression of HAND2-AS1 reduced cell viability (Fig. 2A). Similarly, flow cytometry analysis indicated an increased proportion of UM-UC-3 cells at G1 phase but a reduced proportion at the S phase after HAND2-AS1 overexpression (Fig. 2B, C). The protein expression levels of PCNA and Cyclin D1 were also inhibited by HAND2-AS1 (Fig. 2D, E). In contrast, HAND2-AS1 knockdown has an opposite effect on cell proliferation (Fig. 2A–E). These data indicate that HAND2-AS1 serves as a suppressor on BC cell proliferation.

FIG. 2.

lncRNA HAND2-AS1 suppressed BC cell proliferation. (A) Cell viability of UM-UC-3 and 5637 cells was measured by CCK-8 assay. (B, C) Cell cycle distribution of UM-UC-3 and 5637 cells was examined by flow cytometry. (D, E) The protein levels of PCNA and cyclin D1 were determined by Western blot analysis. β-actin was used as a loading control. *p < 0.05, **p < 0.01, compared with cells transfected with ov-NC; ^# p < 0.05, ^## p < 0.01, compared with cells transfected with sh-NC. Color images are available online.

HAND2-AS1 inhibited BC cell migration and invasion

Then, the wound healing and transwell invasion assay were carried out to evaluate whether HAND2-AS1 affects the migration and invasion of BC cells. As shown in Figure 3A and B, we found that HAND2-AS1 overexpression significantly reduced the wound healing ratio of UM-UC-3 cells, whereas HAND2-AS1 silencing increased the migrated ability of 5637 cells.

FIG. 3.

lncRNA HAND2-AS1 suppressed BC cell migration and invasion. (A, B) Cell migration of UM-UC-3 and 5637 cells was determined by wound healing assay. (C, D) Cell invasion of UM-UC-3 and 5637 cells was assessed by transwell assay. (E, F) The protein levels of Vimentin and MMP9 were determined by Western blot analysis. β-actin was used as a loading control. **p < 0.01, compared with cells transfected with ov-NC; ^# p < 0.05, ^## p < 0.01, compared with cells transfected with sh-NC. Color images are available online.

Furthermore, transwell assay showed that the number of invasive cells was decreased by HAND2-AS1 overexpression, but increased by HAND2-AS1 knockdown (Fig. 3C, D). Western blot analysis also demonstrated that the expression levels of Vimentin and MMP-9 proteins were downregulated by HAND2-AS1, but upregulated by sh-HAND2-AS1 (Fig. 3E, F). These results suggest that HAND2-AS1 inhibits the migration and invasion of BC cells.

HAND2-AS1 had binding sites with miR-17-5p

To elucidate the specific mechanism of HAND2-AS1 in regulating the BC progression, bioinformatic analysis revealed that HAND2-AS1 served as a molecular sponge for miR-17-5p, which was confirmed by luciferase reporter analysis (Fig. 4A, B). Moreover, qRT-PCR assay showed a negative regulation of HAND2-AS1 on miR-17-5p in UM-UC-3 and 5637 cells (Fig. 4C). Rescue experiments demonstrated that miR-17-5p mimics reversed the inhibitory effect of HAND2-AS1 on BC malignant behaviors, as evidenced by increased cell viability, number of invasive cells, and PCNA and MMP9 protein levels in UM-UC-3 cells (Fig. 4D–G). This result confirms that HAND2-AS1 directly interacts with miR-17-5p to suppress BC development.

FIG. 4.

lncRNA HAND2-AS1 had the binding sites of miR-17-5p. (A) Sequence alignment of HAND2-AS1 binding to miR-17-5p. (B) The binding activity between HAND2-AS1 and miR-17-5p was measured by luciferase reporter assay. (C) The expression of miR-17-5p in UM-UC-3 cells and 5637 cells was examined by qRT-PCR assay. (D) Cell viability of UM-UC-3 cells was evaluated by CCK-8 assay. (E, F) Cell invasion of UM-UC-3 cells was determined by transwell assay. (G) Western blot analysis of PCNA and MMP9 expression in UM-UC-3 cells. β-actin was used as a loading control. **p < 0.01. qRT-PCR, quantitative real time PCR. Color images are available online.

KLF9 was a target gene of miR-17-5p

It has been reported that the upregulation of KLF9 plays suppressive effects in BC cells (He et al., 2019). Likewise, the bioinformatic analysis revealed that KLF9 was a target gene of miR-17-5p, which was confirmed by luciferase reporter analysis (Fig. 5A, B). We also demonstrated that the expression levels of KLF9 were positively regulated by HAND2-AS1 (Fig. 5C). Overexpression of miR-17-5p reduced HAND2-AS1-increased KLF9 mRNA levels (Fig. 5D). The data revealed that KLF9 is directly regulated by HAND2-AS1/miR-17-5p axis.

FIG. 5.

miR-17-5p targeted 3′-UTR of KLF9 to reduce its expression. (A) Sequence alignment of KLF9 binding to miR-17-5p. (B) The binding activity between miR-17-5p and KLF9 was measured by luciferase reporter assay. (C–E) The expression of KLF9 mRNA was detected by qRT-PCR assay. (F) Cell viability of UM-UC-3 cells was examined by CCK-8 assay. (G, H) Cell invasion of UM-UC-3 cells was assessed by transwell assay. (I) The protein levels of PCNA and MMP9 were determined by Western blot analysis. β-actin was used as a loading control. **p < 0.01. Color images are available online.

To further verify whether KLF9 mediates the regulation of miR-17-5p on BC cell development, we used UM-UC-3 cells to transfect with KLF9 siRNA. As expected, the upregulated expression levels of KLF9 by miR-17-5p inhibitor was suppressed by knockdown of KLF9 (Fig. 5E). In addition, we demonstrated that inhibition of KLF9 significantly reversed the effect of miR-17-5p inhibitor on the proliferation and invasion of UM-UC-3 cells (Fig. 5F–H). Similarly, the alterations of PCNA and MMP9 proteins by KLF9 silencing were observed in UM-UC-3 cells (Fig. 5I). These results indicate that the inhibitory effect of HAND2-AS1/miR-17-5p axis on tumor malignancies is mediated by KLF9 in BC.

HAND2-AS1 repressed tumor growth

To evaluate the effect of HAND2-AS1 on BC cell tumorgenicity, UM-UC-3 and 5637 cells were injected into nude mice in vivo. As shown in Figure 6A and B, tumor volume was obviously decreased by HAND2-AS1 overexpression, but increased by HAND2-AS1 inhibition. The significant increase of HAND2-AS1, reduction of miR-17-5p, and upregulation of KLF9 were observed in xenograft tumors with HAND2-AS1 overexpression (Fig. 6C–E). Furthermore, HAND2-AS1 reduced PCNA immunopositive cells in vivo (Fig. 6F). The opposite effect of HAND2-AS1 knockdown was also detected in vivo (Fig. 6A–F). The xenograft experiments confirm the suppressive effect of HAND2-AS1 on tumor growth of BC.

FIG. 6.

lncRNA HAND2-AS1 inhibited tumor growth in vivo. (A, B) Tumor macroscopic appearance and tumor growth curves. (C–E) The expression of HAND2-AS1, miR-17-5p, and KLF9 mRNA in tumor tissues of mice. (F) The expression of PCNA in tumor tissues of mice was determined by immunohistochemistry staining. **p < 0.01. Color images are available online.

Discussion

BC is the most common cancer in the world with high metastasis (Bray et al., 2018; Siegel et al., 2021). Although the relevant therapeutic strategies have improved, the poor prognosis and high mortality of BC patients remain to be a significant problem clinically. Therefore, it is essential to elucidate the candidate biomarker of BC malignancies and underlying mechanisms. In this study, we observed a significant downregulation of HAND2-AS1 in BC tissues in comparison with adjacent normal tissues. HAND2-AS1 might inhibit BC cell proliferation, invasion, and migration, which was mediated by the regulation of the miR-17-5p/KLF9 axis. Xenograft results further demonstrated the suppressive effects of HAND2-AS1 on tumor growth.

As noted, prior studies have indicated the significance of lncRNAs for the occurrence and development of BC (Martens-Uzunova et al., 2014). For instance, lncRNA PTENP1 from normal cell exosomes was demonstrated to inhibit biological malignant behaviors of BC cells (Zheng et al., 2018). Zhuang et al. (2019) reported that lncRNA GClnc1 functioned as an oncogenic factor in BC through regulating the LIN28B/let-7a/MYC pathway. Importantly, we observed a dramatic downregulation of HAND2-AS1 in BC tissues compared with adjacent normal tissues through microarray analysis.

As mentioned in the literature review, HAND2-AS1 is a promising tumor biomarker with multiple biological functions, such as the regulation of proliferation, apoptosis, metastasis, and energy metabolism (Da et al., 2020). In cervical cancer, HAND2-AS1 was shown to reduce proliferation and metastasis by competitively binding to miR-330-5p to activate LDOC1 expression (Chen and Wang, 2019). Jiang et al. (2020) also demonstrated that HAND2-AS1 suppressed the proliferation of colorectal cancer cells with 5-fluorouracil resistance. In addition, Wang et al. (2019) confirmed that HAND2-AS1 might recruit the INO80 complex onto the promoter of BMPR1A to activate BMP signaling, thus promoting liver cancer stem cell self-renewal and liver cancer development.

Our results demonstrated that HAND2-AS1 overexpression suppressed the proliferation, migration, and invasion of BC cells, whereas knockdown of HAND2-AS1 caused opposite effects on BC cell behaviors. This finding was consistent with that of Shan et al. (2021) who reported that HAND2-AS1 suppressed cell proliferation and apoptosis in BC progression. Moreover, another important finding for our experiments was that HAND2-AS1 had an inhibitory effect on BC cell migration and invasion, which differed from the report by Shan et al. (2021). This study provided new clues for further understanding the role of HAND2-AS1 in BC cell biological processes.

In recent years, lncRNAs have been proven to interact with miRNAs to regulate cancer biological behaviors. For example, Chen et al. (2019) demonstrated that LINC01939 directly bound to miR-17-5p to suppress gastric cancer cell malignancies. miR-17-5p, a member of the miR-17 family, has also been investigated as an oncogenic factor for tumor growth (Dellago et al., 2017). Duan et al. (2019) found that miR-17-5p facilitated the angiogenesis, proliferation, and migration of nasopharyngeal carcinoma cells. Xu et al. (2019) showed that miR-17-5p might promote colorectal cancer cell migration and invasion by inhibiting BLNK expression.

Furthermore, recent literature revealed that miR-17-5p served as an activator for the aggressive biological behaviors of BC (Yang et al., 2018; Peng and Li, 2019). However, whether miR-17-5p contributes to the role of HAND2-AS1 in BC progression remains unclear. Our results confirmed that miR-17-5p functioned as an HAND2-AS1 sponge, and overexpression of miR-17-5p reversed the inhibitory effect of HAND2-AS1 on BC cell malignant behaviors. Thus, the data suggested that HAND2-AS1 might interact with miR-17-5p to suppress the proliferation, migration, and invasion of BC cells.

A number of studies have shown that miRNA is involved in cancer biological processes through targeting downstream mRNA and regulating its expression, such as miR-1305 and miR-626 (Dong et al., 2019; Su et al., 2020). In this study, we found that miR-17-5p directly targeted KLF9 to reduce its expression. KLF9, a member of KLF family, was shown to suppress the development of gastric cancer and pancreatic cancer (Zhong et al., 2018; Li et al., 2019).

Importantly, He et al. (2019) indicated that KLF9, as a tumor suppressor, participated in the regulation of circPTPRA on tumor growth of BC. Our results identified that inhibition of KLF9 caused an enhancement of the proliferation and invasion in BC cells transfected with miR-17-5p inhibitor. Altogether, this study suggested that HAND2-AS1 suppressed biological malignant behaviors of BC cells through targeting miR-17-5p/KLF9 axis.

Despite the antioncogenic role of HAND2-AS1 that has been discovered by Shan et al. (2021), the current results present a novel regulatory mechanism that HAND2-AS1 is a sponge for miR-17-5p to upregulate KLF9, resulting in the inhibition of BC cell malignancies. It is believed that this study will be helpful to further elucidate the regulatory network of HAND2-AS1 in tumor growth. In addition, Da et al. (2020) summarized that the function of HAND2-AS1 is related to multiple molecular mechanisms, including acting as competitive endogenous RNA, regulating downstream signaling pathways, and mediating transcriptional regulation. Thus, further research should be undertaken to explore the role of HAND2-AS1 due to its complexity.

Conclusion

In summary, this study demonstrates that HAND2-AS1 is downregulated in BC tissues, and it suppresses BC cell proliferation, migration, and invasion. Furthermore, HAND2-AS1 inhibits BC progression through targeting miR-17-5p/KLF9 axis, which is summarized in Figure 7. It provides a new insight that HAND2-AS1 functions as a biomarker for BC diagnosis or prognosis.

FIG. 7.

The schematic diagram for the potential mechanism of the antioncogenic effect of HAND2-AS1 on BC progression. Color images are available online.

Data Availability Statement

Data used to support the findings of this study are available from the corresponding author upon request.

Footnotes

Authors' Contributions

X.Y. carried out validation, formal analysis, writing original draft, and investigation; X.W. was involved in methodology; C.Y. performed visualization; Y.Y. was in charge of resources; Z.F. carried out formal analysis; Y.D. was in charge of resources; Y.G. carried out formal analysis; D.S. was in charge of conceptualization, project administration, and funding acquisition.

Disclosure Statement

No competing financial interests exist.

Funding Information

This study was supported by the National Natural Science United Foundation of China (Grant No. U1904162).

References

Bhan

, Soleimani

, and Mandal

S.S.

(2017). Long noncoding RNA and cancer: a new paradigm. Cancer Res, 77, 3965–3981.

Bray

, Ferlay

, Soerjomataram

, Siegel

R.L.

, Torre

L.A.

, and Jemal

(2018). Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin, 68, 394–424.

Brown

A.R.

, Simmen

R.C.M.

, Raj

V.R.

, Van

T.T.

, MacLeod

S.L.

, and Simmen

F.A.

(2015). Krüppel-like factor 9 (KLF9) prevents colorectal cancer through inhibition of interferon-related signaling. Carcinogenesis, 36, 946–955.

Chen

, Fan

, Zhang

S.-M.

, Li

, Chen

, Peng

, et al. (2019). LINC01939 inhibits the metastasis of gastric cancer by acting as a molecular sponge of miR-17-5p to regulate EGR2 expression. Cell Death Dis, 10, 70.

Chen

, and Wang

(2019). HAND2-AS1 inhibits invasion and metastasis of cervical cancer cells via microRNA-330-5p-mediated LDOC1. Cancer Cell Int, 19, 353.

C.-M.

, Cheng

Z.-Y.

, Gong

C.-Y.

, Nan

, Zhou

K.-S.

, Zhao

G.-H.

, et al. (2020). Role of HAND2-AS1 in human tumors. Clin Chim Acta, 511, 189–197.

Dellago

, Bobbili

M.R.

, and Grillari

(2017). MicroRNA-17-5p: at the crossroads of cancer and aging—a mini-review. Gerontology, 63, 20–28.

Dong

, Bi

, Liu

, Yan

, He

, Zhou

, et al. (2019). Circular RNA ACVR2A suppresses bladder cancer cells proliferation and metastasis through miR-626/EYA4 axis. Mol Cancer, 18, 95.

Duan

, Shi

, Yue

, You

, Shan

, Zhu

, et al. (2019). Exosomal miR-17-5p promotes angiogenesis in nasopharyngeal carcinoma via targeting BAMBI. J Cancer, 10, 6681–6692.

10.

, Huang

, Yan

, Bi

, Yang

, Huang

, et al. (2019). CircPTPRA acts as a tumor suppressor in bladder cancer by sponging miR-636 and upregulating KLF9. Aging (Albany NY), 11, 11314–11328.

11.

Jiang

, Li

, Hou

, Liu

, Wang

, Zhou

, et al. (2020). LncRNA HAND2-AS1 inhibits 5-fluorouracil resistance by modulating miR-20a/PDCD4 axis in colorectal cancer. Cell Signal, 66, 109483.

12.

Lenis

A.T.

, Lec

P.M.

, Chamie

, and Mshs

M.D.

(2020). Bladder cancer: a review. JAMA, 324, 1980–1991.

13.

, Kryczek

, Nam

, Li

, et al. (2021). LIMIT is an immunogenic lncRNA in cancer immunity and immunotherapy. Nat Cell Biol, 23, 526–537.

14.

, Sun

, Jiang

, Li

, Zhang

, Xu

, et al. (2019). KLF9 suppresses gastric cancer cell invasion and metastasis through transcriptional inhibition of MMP28. FASEB J, 33, 7915–7928.

15.

Martens-Uzunova

E.S.

, Böttcher

, Croce

C.M.

, Jenster

, Visakorpi

, and Calin

G.A.

(2014). Long noncoding RNA in prostate, bladder, and kidney cancer. Eur Urol, 65, 1140–1151.

16.

Patel

V.G.

, Oh

W.K.

, and Galsky

M.D.

(2020). Treatment of muscle-invasive and advanced bladder cancer in 2020. CA Cancer J Clin, 70, 404–423.

17.

Peng

, and Li

(2019). The encouraging role of long noncoding RNA small nuclear RNA host gene 16 in epithelial-mesenchymal transition of bladder cancer via directly acting on miR-17-5p/metalloproteinases 3 axis. Mol Carcinog, 58, 1465–1480.

18.

Shan

, Liu

, and Zhan

(2021). LncRNA HAND2-AS1 exerts anti-oncogenic effects on bladder cancer via restoration of RARB as a sponge of microRNA-146. Cancer Cell Int, 21, 361.

19.

Siegel

R.L.

, Miller

K.D.

, Fuchs

H.E.

, and Jemal

(2021). Cancer statistics, 2021. CA Cancer J Clin, 71, 7–33.

20.

Sjödahl

, Lauss

, Lövgren

, Chebil

, Gudjonsson

, Veerla

, et al. (2012). A molecular taxonomy for urothelial carcinoma. Clin Cancer Res, 18, 3377–3386.

21.

, Feng

, Shi

, Chen

, Huang

, and Lin

(2020). circRIP2 accelerates bladder cancer progression via miR-1305/Tgf-β2/smad3 pathway. Mol Cancer, 19, 23.

22.

Sun

, Wang

, Liu

, Zhang

, Ma

, Yang

, et al. (2014). Transcription factor KLF9 suppresses the growth of hepatocellular carcinoma cells in vivo and positively regulates p53 expression. Cancer Lett, 355, 25–33.

23.

Wang

, Ma

, Li

, Yang

, and Wang

(2021). GAS6-AS1 overexpression increases GIMAP6 expression and inhibits lung adenocarcinoma progression by sponging miR-24-3p. Front Oncol, 11, 645771.

24.

Wang

, Zhu

, Luo

, Wang

, Liu

, Wu

, et al. (2019). LncRNA HAND2-AS1 promotes liver cancer stem cell self-renewal via BMP signaling. EMBO J, 38, e101110.

25.

, Meng

, Li

, Yang

, Xu

, Gao

, et al. (2019). Long noncoding RNA MIR17HG promotes colorectal cancer progression via miR-17-5p. Cancer Res, 79, 4882–4895.

26.

, Cui

, Ye

, Wang

, Zhang

, et al. (2021). LINC00941 promotes glycolysis in pancreatic cancer by modulating the Hippo pathway. Mol Ther Nucleic Acids, 26, 280–294.

27.

Yan

, Jin

, and Lin

(2020). lncRNA HAND2-AS1 inhibits liver cancer cell proliferation and migration by upregulating SOCS5 to inactivate the JAK-STAT pathway. Cancer Biother Radiopharm, 35, 143–152.

28.

Yang

, Yuan

, Yang

, Li

, Wang

, Han

, et al. (2018). Circular RNA circ-ITCH inhibits bladder cancer progression by sponging miR-17/miR-224 and regulating p21, PTEN expression. Mol Cancer, 17, 19.

29.

Zheng

, Du

, Wang

, Xu

, Liang

, Wang

, et al. (2018). Exosome-transmitted long non-coding RNA PTENP1 suppresses bladder cancer progression. Mol Cancer, 17, 143.

30.

Zhong

, Zhou

, Wang

, Wu

, Zhou

, Zou

, et al. (2018). Expression of KLF9 in pancreatic cancer and its effects on the invasion, migration, apoptosis, cell cycle distribution, and proliferation of pancreatic cancer cell lines. Oncol Rep, 40, 3852–3860.

31.

Zhuang

, Ma

, Zhuang

, Ye

, Zhang

, and Gui

(2019). LncRNA GClnc1 promotes proliferation and invasion of bladder cancer through activation of MYC. FASEB J, 33, 11045–11059.