Hsa_ Circ_0005044 Promotes Osteo/Odontogenic Differentiation of Dental Pulp Stem Cell Via Modulating miR-296-3p/FOSL1

Abstract

Circular RNAs (circRNAs) are a form of RNAs that lack coding potential. The role of such circRNAs in dental pulp stem cell (DPSC) osteo/odontogenic differentiation remains to be determined. In this study, circRNA expression profiles in DPSC osteo/odontogenic differentiation process were analyzed by RNA-seq. qRT-PCR was used to confirm the differential expression of circ_0005044, miR-296-3p, and FOSL1 in DPSC osteogenic differentiation process. Circ_0005044, miR-296-3p, and FOSL1 were knocked down or overexpressed. Osteoblastic activity and associated mineral activity were monitored via alkaline phosphatase (ALP) and alizarin red S (ARS) staining. Interactions between miR-296-3p, circ_0005044, and FOSL1 were assessed through luciferase reporter assays. Finally, an in vivo system was used to confirm the relevance of circ_0005044 to osteoblastic differentiation. As results, we detected significant circ_0005044 and FOSL1 upregulation in DPSC osteo/odontogenic differentiation process, as well as concomitant miR-296-3p downregulation. When knocking down circ_0005044 or overexpressed miR-296-3p, this significantly inhibited osteogenesis. Luciferase reporter assay confirmed that miR-296-3p was capable of binding to conserved sequences in the wild-type forms of both the circ_0005044 and FOSL1. Furthermore, knocking down circ_0005044 in vivo significantly attenuated bone formation. Therefore, the circ_0005044/miR-2964-3p/FOSL1 axis regulates DPSC osteo/odontogenic differentiation, which may provide potential molecular targets for dental-pulp complex regeneration.

Introduction

Many stem-like precursor cells reside within the dental pulp tissue and are capable of regenerating this tissue in response to injury by migrating to the damaged region, proliferating, undergoing odontoblastic differentiation, and producing reparative dentin (Lambrichts et al, 2017; Wang et al, 2011). When these stem-like cells are isolated and grown in vitro, they are referred to as dental pulp stem cells (DPSCs) (Hilkens et al, 2013). These DPSCs are relatively heterogeneous in composition, containing a range of adipocytes, chondrocytes, and odontoblast-, osteoblast-, and neural-like cells (Lambrichts et al, 2017; Wang et al, 2011). DPSC odontoblastic differentiation is vital to mineralized matrix production during the regeneration of the dental pulp and during the dentinogenic process. Earlier studies have characterized some of the mechanisms regulating DPSC differentiation (Geng et al, 2017; Qin et al, 2012), but further clarification of the underlying molecular mechanisms is still required.

The odontoblastic differentiation of DPSCs has been shown to be regulated by miRNAs (Sun et al, 2014). In one study, for example, the let-7b miRNA was shown to suppress MMP1 expression so as to post-transcriptionally regulate DPSC osteogenesis (Wang et al, 2018b). One prominent theory proposes that such miRNAs are in turn regulated by competing endogenous RNAs (ceRNAs), forming a complex network of coregulatory noncoding and coding RNA molecules (Huang et al, 2015). These ceRNAs are able to bind miRNAs through their competitive miRNA response elements, effectively sequestering them and thereby modulating any normal or disease-associated processes linked to these miRNAs (Song et al, 2017).

Circular RNAs (circRNAs) are a form of ceRNA that were originally thought to be a product of splicing errors (Nigro et al, 1991), but that have more recently been shown to be functional and widespread throughout animal cell types (Memczak et al, 2013). These circRNAs are most often composed of highly conserved exon sequences that are often expressed in patterns that are specific to a given tissue or stage of development (Barrett et al, 2015; Salzman et al, 2013). Owing to their circular nature, circRNAs are extremely stable and can resist the degradative activity of RNases (Memczak et al, 2013; Salzman et al, 2013). This stability makes circRNAs potentially ideal as a diagnostic tool in numerous pathological contexts.

At a functional level, many circRNAs have also been found to modulate intracellular signaling in a number of different cancer types (Qi et al, 2015). Of note, one recent study identified 24 differentially regulated circRNAs that were specifically linked to stages of osteoblastic differentiation, suggesting that these particular circRNAs may play a role in this differentiation process (Dou et al, 2016). The specific function of circRNAs in the context of human DPSC odontogenic differentiation, however, remains unclear. To date, a single study found that 1314 and 1780 circRNAs were up- and downregulated, respectively, during this process (Li and Jiang, 2019), and no studies to date have generated a functional circRNA/miRNA/mRNA network associated with this process.

In this study, we used an RNA-seq approach in an effort to identify circRNAs that were differentially regulated in the context of DPSC osteo/odontogenic differentiation. This led us to identify circ_0005044 as an important regulator of this differentiation process in human DPSCs. Together, our findings offer valuable new insights into the mechanistic basis for DPSC osteo/odontogenic differentiation, potentially highlighting novel therapeutic avenues for future tissue regeneration-based studies.

Materials and Methods

Cell culture

The Ethics Committee of the Stomatological Hospital, Southern Medical University approved all human protocols described herein (Approval No.: 2016006). For this study, we utilized premolars and third molars without any carious lesions that had been extracted from eight healthy donors (five female, three male; age: 12–25 years) in July 2016. These teeth were extracted for orthodontic or impacted third molar reason the Department of Oral and Maxillofacial Surgery at the Stomatological Hospital, Southern Medical Hospital (Guangzhou, China). All patients provided informed consent. Using these samples, we isolated and cultured human DPSCs as in previous analyses (Liu et al, 2020).

HEK-293T cells were obtained from the American Type Culture Collection (ATCC). Both hDPSCs and HEK293T cells were grown in a 5% CO₂ humidified incubator using general medium (GM), which is α-MEM (Gibco) containing 15% FBS (Gibco) and penicillin/streptomycin (Sigma-Aldrich). DPSCs were cultured until 70–80% confluent, at which time odontogenic differentiation was induced by culturing cells in osteo/odontogenic induction medium (OM) that had been supplemented with 100 nM dexamethasone, 200 μM l-ascorbic acid, and 10 mM β-glycerophosphate (Sigma-Aldrich). During culture, this OM was replaced with fresh media every other day.

RNA-seq and bioinformatic analyses

DPSCs cultured in GM (control group) or OM (osteo/odontogenic group) for 14 days were used for RNA-seq, each group contained three samples. An Illumina HiSeqseq™ 2000 instrument (Illumina, Inc.) was used to sequence RNA samples. Raw data were initially filtered, after which circRNA predictions were made using the CIRI software (v1.2), and the annotation of these circRNAs based on their source was conducted with circBase (www.circbase. org). We then identified circRNAs that were differentially expressed during osteogenesis based on the following criteria: p < 0.05 and fold-change ≥2.0. The profiles of DPSC mRNA and miRNA expression during osteogenesis have previously been published (Liu et al, 2020), and we utilized these data to examine correlations between differentially expressed circRNAs, miRNAs, and mRNAs in these DPSC samples. We then constructed coexpression networks using MIRANDA and the Cytoscape 3.5.1 application.

qRT-PCR

TRIzol (Invitrogen) was used to extract cellular RNA based on provided instructions, after which a SuperScript III^®kit (Invitrogen) was used for reverse transcription. All qRT-PCR were conducted with an ABI PRISM 7500 Sequence Detection System (Life Technologies) together with the Power SYBR Green Master Mix (Applied Biosystems). Relative mRNA expression was normalized based on GAPDH levels, whereas U6 was used for circRNA and miRNA normalization. Thermocycler settings were as follows: 95°C for 3 min; 40 cycles of 95°C for 15 s, 60°C for 40 s. Sangon Biotech (Guangzhou, China) synthesized all primers used in this study (Table 1). The 2^−resenmethod was used to quantify relative gene expression from triplicate assays (Livak and Schmittgen, 2001).

Table 1.

Primers Used in This Study

	Forward	Reverse
circ_0005044	5′- CCTGGAACAGCGTTCAGACT -3′	5′-ACTCATGCCCTTGATGTTTCTCT -3′
GAPDH	5′- CGACAGCAGCCGCATCTT -3′	5′- CCAATACGACCAAATCCGTTG -3′
RUNX2	5′- ACTACCAGCCACCGAGACCA -3′	5′- ACTGCTTGCAGCCTTAAATGACTCT -3′
BSP	5′- CACTGGAGCCAATGCAGAAGA -3′	5′- TGGTGGGGTTGTAGGTTCAAA -3′
ALP	5′- GAACGTGGTCACCTCCATCCT -3′	5′- TCTCGTGGTCACAATGC -3′
miR-296-3p	5′- CCTCTCGGAGGTGGGTTGGGAG -3′
miR-296-3p RT	5′- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAACAA -3′

RNA oligoribonucleotides

GenePharma Co. (Shanghai, China) was the source of all RNA oligoribonucleotides used in this study, including miRNA mimics, miRNA inhibitors, siRNAs specific for cir_0005044 or FOSL1 (si-FOSL1), and appropriate control constructs (Table 2).

Table 2.

RNA Oligoribonucleotide Sequences Used in This Study

	Forward	Reverse
siFOSL1	5′- UCAUCUUCCAGUUUGUCAGUC -3′	5′- CUGACAAACUGGAAGAUGAG -3′
si-circ_0005044	5′- AGAAGAAGGUGAUAUGGAGAC-3′	5′- CUCCAUAUCACCUUCUUCUCU-3′
miR-296-3p mimic	5′- GAGGGUUGGGUGGAGGCUCUCC-3′	5′- AGAGCCUCCACCCAACCCUCUU-3′
miR-296-3p inhibitor	5′-GGAGAGCCUCCACCCAACCCUC-3′
miR-NC	5′- CAGUACUUUUGUGUAGUACAA-3′
si-NC	5′- UUCUCCGAACGUGUCACGUTT-3′	5′- ACGUGACACGUUCGGAGAATT -3′

Cellular transfection

Cells were allowed to grow until reaching 70–80% confluence, at which time they were transfected with appropriate constructs (miR-296-3p mimic, miR-296-3p inhibitor, si-circRNA, si-FOSL1, or appropriate controls; 100 nM) using Lipofectamine 2000 (Invitrogen) according to the instructions provided. Cells were then allowed to rest for 48 or 72 h, after which mRNA and protein expression was analyzed.

ARS and ALP staining

DPSCs were initially plated into 24-well plates in a 500 μL volume and were allowed to grow until 70% confluent. Cells were then cultured in OM for either 7 or 14 days for ALP or ARS staining, respectively. Following these culture periods, cells were fixed for 20 min using 4% paraformaldehyde, after which they were stained using 2% ARS or BCIP/NBT ALP Color Development Kit (Beyotime) based on provided directions, the manufacturer's instructions. ALP activity was additionally quantified using a colorimetric assay kit (BioVision). For this approach, cells were washed using PBS before lysis in 1% Triton X-100 (Sigma-Aldrich) and addition to distilled water. Absorbance at 405 nm was then quantified. A BCA kit was used to measure total cellular protein (Thermo Fisher Scientific), with ALP activity being determined based on the ratio of absorbance to protein levels. Mineralized nodule formation was quantified by dissolving the ARS stain for 1 h using 1 mL 10% cetylpyridinium chloride (Sigma-Aldrich), after which absorbance at 570 nm was quantified and normalized to total protein levels.

Western blotting

Protein was extracted from DPSCs via RIPA lysis buffer (Solarbio, Beijing, China). BCA protein assay kit (Pierce, Rockford, IL) was used to identify the total concentration of the proteins. Next, the loading buffer was added with the extracted protein (30 μg), followed by denaturation of the protein in boiling water (for 5 min). Ten percent (w/v) SDS-PAGE was used for the protein separation. Then the protein was transmitted to the PVDF membrane.

For blockage purposes, BSA (5% w/v; Sangon Biotech) was used for 60 min at ∼25°C, followed by membrane probing with anti-RUNX2 (Cell Signaling Technology), anti-FOSL1 (Cell Signaling Technology), or anti-GAPDH (Cell Signaling Technology), and anti-rabbit secondary antibody (Cell Signaling Technology) for 24 h at 4°C. After washing with Tris-buffered saline with Tween-20 (TBST), the incubation of membranes was carried out with the secondary antibodies (Cell Signaling Technology) at ∼25°C for 60 min and these antibodies were conjugated with horseradish peroxidase with 1: 3000 dilution. TBST was used to wash unbound antibodies. The ECL imaging kit (Thermo Fisher Scientific) was used to generate the chemiluminescent signal. The internal control was GAPDH (Supplementary Fig. S1).

Luciferase activity assay

Direct interactions between miR-296-3p and either circ_0005044 or FOSL1 were assessed via a luciferase reporter assay approach. In brief, we synthesized WT or mutant (MU) versions of the miR-296-3p complementary sequences in circ_0005044 or FOSL1 and we inserted these constructs into the pmirGLO luciferase vector (Promega). We then conducted a reporter assay by cotransfecting 293T cells with WT or MU forms of these reporters together with miR-296-3p mimic or control constructs using Lipofectamine 2000 as mentioned previously. After 48 h, a Dual-Luciferase Reporter Assay System (Promega) was used to quantify luciferase activity in triplicate samples based on provided directions.

In vivo bone formation assay

To assess ectopic in vivo osteo/odontogenic bone formation, we mixed together 2 × 10⁶ DPSCs that been transfected using si-circRNA or si-NC constructs together with 40 mg of deproteinized bovine bone tissue (Bio-Oss, Wolhusen, Switzerland). These mixtures were then implanted subcutaneously on the backs of nude mice (6 weeks old). At 8 weeks postimplantation, these samples were collected, fixed, and subjected to demineralization and paraffin embedding, and were cut into 2-μm-thick sections that were subjected to hematoxylin and eosin staining. In addition, RUNX2 expression was assessed by immunohistochemical staining. The Ethics Committee of Stomatological Hospital, Southern Medical University approved this study.

Statistical analysis

SPSS v16.0 (SPSS, Inc.) was used for all statistical testing. Differences between groups were compared via one-way ANOVAs and Student's t-tests as appropriate (*p < 0.05; **p < 0.01).

Results

Differential circRNA expression during DPSC osteo/odontogenic differentiation

We began by identifying circRNAs that were differentially expressed over the course of DPSC osteo/odontogenic differentiation. At 14 days postinduction of differentiation, we conducted the RNA-seq analysis of induced and control noninduced DPSC culture samples. When circRNA expression profiles were compared between these samples, we found that 87 circRNAs were differentially expressed as a function of differentiation status (log2FC ≥1, p < 0.05). Of these, 65 and 22 were up- and downregulated, respectively, in induced DPSCs (Fig. 1A).

FIG. 1.

RNA-seq results. (A) Clustered heatmap of RNA-seq, with columns representing different transcripts, and rows representing three biological replicates of osteogenic induction medium treated and untreated DPSCs samples. (B) The circRNAs that were differentially regulated over the course of osteogenesis are arranged in a volcano plot (Light grey: downregulated; Dark grey: upregulated). (C) Confirmation of circRNA expression via qRT-PCR. (D) A putative circRNA–miRNA–mRNA interaction network, with circRNAs, miRNAs, and mRNAs represented by triangles, circles, and squares, respectively (Llight grey: downregulated; Dark Grey: upregulated). *p < 0.05, **p < 0.01, ***p < 0.001. DPSC, dental pulp stem cell.

We then selected 5 of the identified differentially regulated circRNAs for qRT-PCR validation. We were able to confirm that the expression of these circRNAs changed significantly in response to osteo/odontogenic differentiation, consistent with our RNA-seq findings (Fig. 1B). We then leveraged previously published mRNA and miRNA profiles from DPSCs in the context of osteogenesis (Liu et al, 2020) to conduct a correlation analysis of differentially expressed circRNAs, miRNAs, and mRNAs. Following this analysis, we constructed a coexpression network (Fig. 1C). This network suggests that circ_0005044 has the potential to serve as a ceRNA for miR-296-3p, sequestering it and thereby preventing it from suppressing the expression of its target gene FOSL1. This suggested that the circ_0005044/miR-296-3p/FOSL1 axis may be involved in the osteogenic differentiation of DPSCs.

DPS osteoblastic differentiation is associated with circ_0005044 and FOSL1 upregulation and miR-296-3p downregulation

We next sought to confirm that miR-296-3p and FOSL1 expression were altered during DPSC osteo/odontogenic differentiation as predicted in the above bioinformatic analyses. To that end, we performed a qRT-PCR analysis of DPSCs following culture in OM. These cells exhibited significant upregulation of the osteogenic markers ALP, DSPP, and RUNX2 (Fig. 2A–C), indicating successful osteo/odontogenic induction of DPSCs. We found that circ_0005044 and FOSL1 expression rose over the course of this differentiation process, reaching maximum levels that were approximately six-fold higher than baseline after 14 days. In contrast, miR-296-3p expression fell significantly over this same time period in a manner negatively correlated with the expression of circ_0005044 and FOSL1 (Fig. 2D–F).

FIG. 2.

The expression of circ_0005044, miR-296-3p, and FOSL1 during DPSC osteogenic differentiation. (A–D) qRT-PCR was used to assess ALP, DSPP, RUNX2, and FOSL1 mRNA levels at the indicated time points, with GAPDH being used for normalization purposes. (E) qRT-PCR was used to assess circ_0005044 expression on days 0, 4, 7, and 14 of DPSC osteoblastic differentiation, with expression levels being normalized to day 0 baseline levels. (F) qRT-PCR was used to assess miR-296-3p expression at the indicated time points. *p < 0.05, **p < 0.01, ***p < 0.001.

DPSC osteogenic differentiation is inhibited by the knockdown of circ_0005044

We next explored the biological impact of siRNA-mediated circ_0005044 knockdown after confirming the success of this approach via qRT-PCR (Fig. 3C). At 7 days postosteogenic induction, ALP staining was reduced in circ_0005044 knockdown cells (Fig. 3A), with a similar reduction in ARS staining after 14 days consistent with reduced matrix mineralization (Fig. 3B). We further confirmed via Western blotting that circ_0005044 knockdown resulted in reduced RUNX2 expression in DPSCs (Fig. 3D), with similar knockdown-associated reductions in the mRNA level expression of ALP, DSPP, and RUNX2 as well as a concomitant increase in levels of miR-296-3p (Fig. 3C). We confirmed using the RegRNA 2.0 database that circ_0005044 and miR-296-3p share a complementary sequence region. We then conducted a luciferase reporter assay, which revealed that miR-296-3p was able to interact with the WT but not MU version of this circ_0005044 sequence, consistent with the ability of these two nucleic acids to interact with one another within cells (Fig. 3E, F).

FIG. 3.

Circ_0005044 sequesters miR-296-3p and thereby regulates DPSC osteogenic differentiation. (A) Cells were treated with an siRNA specific for circ_0005044 (si-circRNA) or a control construct (si-NC), after which they were grown for 7 days in OM and ALP activity was then visualized. Absorbance of OD 405 nm was used to quantified ALP staining. (B) ARS staining images following 14 days of cellular culture in OM, together with absorbance of OD 570 nm was used to quantified ARS staining. (C) At 3 days postosteogenic induction, levels of circ_0005044, miR296–3p, ALP, DSPP, and RUNX2 were quantified via qRT-PCR with GAPDH as a normalization control. (D) RUNX2 protein levels were assessed via automated western blot on day 3 of osteogenesis, with corresponding histograms corresponding to band densities. (E) Complementary sequence overlap between miR-296-3p and circ_0005044. (F) WT or MU luciferase reporter constructs were cotransfected into cells together with miR-296-3p mimics or control constructs, and luciferase activity was then analyzed after 48 h with Renilla luciferase activity being used for normalization purposes. *p < 0.05, **p < 0.01, ***p < 0.001. ALP, alkaline phosphatase; ARS, alizarin red S; OM, osteogenic media; MU, mutant.

miR-296-3p impairs DPSC osteo/odontogenic differentiation

We next sought to evaluate the role played by miR-296-3p in the context of DPSC osteo/odontogenic differentiation by knocking down or overexpressing this miRNA in these cells. Our overexpression approach led to a roughly four-fold increase in the expression of miR-296-3p in transfected cells, whereas knockdown efficiency was confirmed to be ∼70%. When this miRNA was overexpressed we observed reduced ALP staining, whereas the opposite phenotype was detected when it was instead knocked down (Fig. 4A). Comparable trends with respect to ARS staining were also observed at 14 days postosteogenic differentiation in treated cells (Fig. 4B). At the mRNA level, we found that miR-296-3p mimic transfection markedly reduced the expression of FOSL1, ALP, DSPP, and RUNX2, whereas miR-296-3p had the opposite impact (Fig. 4C). This was also consistent with protein level changes in FOSL1 and RUNX2 expression as assessed by Western blotting (Fig. 4D).

FIG. 4.

miR-296-3p inhibits DPSC osteogenic differentiation. (A) Cells were treated with miR-296-3p inhibitors, mimics, or appropriate controls, followed by culture for 7 days in OM after which ALP staining was conducted, absorbance of OD 405 nm was used to quantified ALP staining. (B) Cells were treated as in (A), cultured for 14 days in OM, and then assessed for matrix mineralization via ARS staining, absorbance of OD 570 nm was used to quantified ARS staining. (C) Relative miR-296-3p, ALP, DSPP, RUNX2, and FOSL1 expression were quantified after 3 days of osteogenesis via qRT-PCR with GAPDH as a normalization control. (D) RUNX2 and FOSL1 protein levels were assessed via automated western blot on day 3 of osteogenesis. *P < 0.05, **P < 0.01, ***P < 0.001.

circ_0005044/miR-296-3p axis regulates FOSL1 expression

Consistent with our above predictive analyses and measurements, we used the MIRANDA database to confirm that miR-296-3p shares sequence complementarity with a portion of the 3′-untranslated region (UTR) of FOSL1 (Fig. 5A). Using a luciferase reporter assay system as mentioned previously, we then verified that miR-296-3p was able to directly bind to the WT but not the MU version of this 3′-UTR sequence, thereby confirming that this miRNA is capable of targeting this gene within cells so as to suppress its expression (Fig. 5B).

FIG. 5.

The circ_0005044/miR-296-3p axis controls FOSL1 expression. (A) Complementary sequence overlap between miR-296-3p and the FOSL1 3′-UTR. (B) WT or MU FOSL1 luciferase reporter constructs were cotransfected into cells together with miR-296-3p mimics or control constructs, and luciferase activity was then analyzed after 48 h with Renilla luciferase activity being used for normalization purposes. (C) FOSL1 levels in NC cells or cells transfected with miR-296-3p mimics, inhibitors, and/or siRNAs specific for circ_0005044 were assessed via qRT-PCR, with GAPDH as a normalization control. (D) RUNX2 and FOSL1 protein levels were assessed via automated western blot in cells treated as in (C). *p < 0.05, **p < 0.01, ***p < 0.001. NC, normal control.

To further establish FOSL1 as a target downstream of the circ_0005044/miR-296-3p axis in DPSCs, we next assessed the expression of FOSL1 at the mRNA and protein level in DPSCs that had been transfected with an miR-296-3p mimic, an miR-296-3p inhibitor, an siRNA specific for circ_0005044, or appropriate control constructs. We observed significant reductions in FOSL1 expression in response to circ_0005044 knockdown or miR-296-3p mimic transfection, whereas it was significantly upregulated in response to miR-296-3p inhibitor transfection (Fig. 5C, D). We additionally cotransfected cells with both si-circ_0005044 and miR-296-3p mimics or inhibitors, and we found that compared with cells transfected with only si-circ_0005044, FOSL1 levels were markedly reduced in cells cotransfected with si-circ_0005044 and a miR-296-3p mimic, whereas they were increased in cells cotransfected with si-circ_0005044 and miR-296-3p inhibitor (Fig. 5C, D). Together these findings confirm that circ_0005044 functions upstream of miR-296-3p, thereby interfering with the ability of this miRNA to suppress FOSL1 expression in DPTs during osteogenesis.

FOSL1 knockdown suppresses DPSC osteo/odontogenic differentiation and limits the ability of circ_0005044 to promote this process

To confirm that FOSL1 plays a role in DPSC osteo/odontogenic differentiation, we used an siRNA to knock it down with 70–80% efficiency in these cells. At appropriate time points, we observed significantly impaired ALP and ARS staining in cells in which FOSL1 had been knocked down (Fig. 6A, B). In line with this result, we detected significant decreases in the upregulation of ALP, DSPP, and RUNX2 in these FOSL1 knockdown cells (Fig. 6C). This similarly coincided with protein level reductions in RUNX2 and FOSL1 (Fig. 6D). To verify the relevance of circ_0005044/miR-296-3p-mediated FOSL1 regulation during DPSC osteogenesis, we next cotransfected these cells with both an miR-296-3p inhibitor and an FOSL1-specific siRNA before osteogenic induction. Cells that had also been transfected with the only miR-296-3p inhibitor exhibited increased ALP staining, whereas such staining was significantly reduced if cells had been cotransfected with the FOSL1-specific siRNA. Consistent with this, FOSL1 siRNA cotransfection partially disrupted matrix mineralization in miR-296-3p inhibitor-transfected DPSCs (Fig. 6E–I).

FIG. 6.

FOSL1 knockdown impaired DPSC osteogenesis and overcomes the impact of miR-296-3p inhibition. (A) Cells were treated with an siRNA specific for FOSL1 or with a control construct (si-NC) and were cultured for 7 days in OM, after which ALP staining was conducted. Absorbance of OD 405 nm was used to quantified ALP staining. (B) Cells were treated as in (A), cultured for 14 days in OM, and ARS staining was then conducted. Absorbance of OD 570 nm was used to quantified ARS staining. (C) On day 3 of osteogenesis, si-FOSL1 transfection efficiency and relative ALP, DSPP, and RUNX2 expression were quantified via qRT-PCR with GAPDH used as a normalization control. (D) Cells were treated with control constructs or with si-FOSL1 and/or miR-296-3p inhibitors, after which RUNX2 and FOSL1 protein levels were assessed via automated western blot. (E–H) Cells were treated as in (D), after which ALP and ARS staining were conducted. (I) The expression of ALP, DSPP, and RUNX2 was assessed via qRT-PCR in cells treated as in (D). *P < 0.05, **P < 0.01.

Osteogenesis is inhibited by circ_0005044 knockdown in vivo

Finally, we sought to confirm that circ_0005044 plays a key role in DPSC osteoblastic differentiation in vivo but using a murine model system. After an 8-week period, we found that bone formation was significantly reduced in samples in which circ_0005044 had been knocked down relative to control samples (Fig. 7A). Consistent with this, the RUNX2 staining intensity in circ_0005044 knockdown samples was markedly reduced relative to that in control samples (Fig. 7B).

FIG. 7.

The role of circ_0005044 in the context of in vivo DPSC differentiation. (A, B) Osteogenesis in animals treated with control or circRNA-specific siRNA constructs was monitored via H&E staining, demonstrating reduced osteogenesis in the latter group. (C, D) IHC reveals a reduction in the expression of RUNX2 in animals treated with a circRNA-specific siRNA relative to controls. Scale bar = 100 μm. *p < 0.05, **p < 0.01. H&E, hematoxylin and eosin; IHC, immunohistochemistry.

Discussion

Several studies to date have provided strong evidence that circRNAs can both regulate gene expression and serve as ideal biomarkers for the diagnosis of particular disease states (Hansen et al, 2013; Li et al, 2015b; Lukiw, 2013). For example, one recent analysis determined that both circ19142 and circ5846 were closely linked to the differentiation of osteoblasts (Qian et al, 2017), whereas BMP2 has been suggested to modulate this same osteogenic process via a circ19142/circ5846-targeted miRNA–mRNA axis. Another analysis aimed at clarifying circRNA expression profiles in periodontal ligament stem cells during osteogenesis revealed that these expression patterns varied in a defined manner over the course of differentiation and subsequent biomineralization, suggesting that these circRNAs play defined roles during this process (Zheng et al, 2017).

Few studies to date, however, have specifically examined the functional role of circRNAs during the osteo/odontogenic differentiation of DPSCs. In this study, we used an RNA-seq-based approach to identify 87 differentially expressed circRNAs (65 upregulated; 22 downregulated) associated with this differentiation process by comparing control cells with those that were actively differentiating. We further identified circ_0005044 as a highlight expressed upregulated circRNA that functionally regulated the DPSC osteo/odontogenic differentiation process. This was confirmed by the fact that circ_0005044 knockdown interfered with ALP and ARS staining, consistent with a disruption in normal DPSC osteoblastic differentiation in vitro. This was further validated through mRNA and protein level analyses of key osteogenesis-related genes. We additionally utilized an in vivo model system to confirm that circ_0005044 regulates osteogenesis in a more physiological environment. Overall, our findings highlight circ_0005044 as a possible regulator of DPSC osteo/odontogenic differentiation.

Within cells, circRNAs can function as ceRNAs capable of binding and sequestering specifying target miRNAs so as to modulate gene expression (Salmena et al, 2011). This functionality has led some authors to refer to circRNAs as miRNA “sponges,” given that they often contain multiple miRNA binding sites and can thus broadly regulate mRNA transcription and protein translation (Li et al, 2015a). In line with such functionality, we were able to demonstrate a strong correlation between circ_0005044 miR-296-3p, and we found that miR-296-3p overexpression led to a marked reduction in the expression of key osteo/odontogenic marker gene expression in DPSCs, whereas inhibition of this miRNA had the opposite effect. Together these results further support a model wherein circ_0005044 promotes DPSC osteo/odontogenic differentiation via the negative regulation of miR-296-3p.

Previous work has also highlighted roles for miR-296-3p in tumor metastasis in a number of different cancer types (Bai et al, 2013; Fu et al, 2017; Liu et al, 2013; Wang et al, 2018a). The specific role of this miRNA appears to be tumor specific, given that it has been shown to favor prostate cancer invasion and metastasis (Liu et al, 2013), but to suppress this same metastatic activity in the case of lung adenocarcinoma (Schodel et al, 2016). The role of this miRNA in osteogenesis has not previously been explored, and as such further research and validation of our results are warranted.

Through further work, we determined that circ_0005044/miR-296-3p regulate the osteo/odontogenic process at least in part via controlling FOSL1 expression levels within DPSCs. This was supported by complementary miR-296-3p binding sites within the FOSL1 3′-UTR, and a direct binding interaction was confirmed through the use of a luciferase reporter assay system. Of importance, we found that overexpressing miR-296-3p and knocking down circ_0005044 both reduced FOSL1 protein levels within DPSCs, whereas these levels were increased when miR-296-3p was knocked down. When cells were cotransfected using both a miR-296-3p mimic and an siRNA specific for circ_0005044, this led to a more profound reduction in FOSL1 levels relative to siRNA transfection alone, whereas cotransfecting cells with both a miR-296-3p inhibitor and si-circ_0005044 partially disrupted the intracellular activity of circ_0005044 knockdown. Together these findings provided strong evidence that circ_0005044 functions upstream of miR-296-3p and thereby indirectly modulates the levels of FOSL1 expressed within cells.

FOSL1 (also known as Fra-1) is an AP-1 family transcription factor protein that is known to be a key regulator of osteogenic processes (Jochum et al, 2000; Yu et al, 2013). In murine model systems, lack of c-Fos expression can result in the development of osteoporosis (Wang et al, 1992), but this phenotype can be reversed when FOSL1 is overexpressed (Fleischmann et al, 2000), as this gene functions downstream of c-Fos in osteoclast progenitor cells (Matsuo et al, 2000). Mice that overexpress FOSL1 constitutively have been shown to suffer from progressive osteosclerosis (Jochum et al, 2000) and severe lipodystrophy (Luther et al, 2011), whereas knockout of this gene in embryonic mice is associated with an osteopenic phenotype (Eferl et al, 2004).

In our analysis, the knockdown of FOSL1 significantly impaired DPSC osteo/odontogenic differentiation in a manner consistent with the phenotypes observed when cells were transfected using either a circ_0005044 siRNA or an miR-296-3p mimic. When we knocked down FOSL1, this partially overcame the ability of miR-296-3p inhibition to promote DPSC osteogenesis. These findings therefore further supported a model wherein the circ_0005044/miR-296-3p pathway regulates DPSC differentiation through FOSL1.

When FOSL1 was inhibited, we observed mRNA and protein level reductions in the expression of RUNX2. The mechanistic basis for this finding, however, remains to be clarified. Prior work, however, has shown that FOSL1 upregulation can lead to changes in PI3K/AKT pathway activation in gastric cancer cells (He et al, 2015). This PI3K/AKT pathway has also been associated with RUNX2 expression levels in osteoblasts (Chen et al, 2019). As such, changes in FOSL1 expression within differentiating DPSCs may lead to changes in RUNX2 expression levels via a mechanism associated with PI3K/AKT signaling. Further studies will be essential to test this hypothesis.

Osteo/odontogenic differentiation of DPSCs is very important in dentin–pulp complex repair process. Our results suggest that hsa_circ_0005044 might be a novel biomarker or therapeutic target for regulating dentin–pulp complex repair. And one challenge is that the limited resources of DPSCs in permanent teeth will retard the application in the future. To solve the question, the DPSCs may be produced with the capabilities of immortalization or increased the number of cell passages. And we believe that DPSCs will be used not only for research but also for the clinical application in the future.

Conclusions

In summary, in this study we provide novel evidence that circ_0005044 is associated with DPSC osteo/odontogenic differentiation. We found that circ_0005044 is capable of regulating miR-296-3p, leading to a consequent increase in the expression of FOSL1. As such, circ_0005044 may be a viable biomarker or therapeutic target in the context of efforts aimed at modulating the osteoblastic differentiation of DPSCs.

Footnotes

Data Availability Statement

The RNA-seq data is openly available in NCBI Sequence Read Archive (https://www.ncbi.nlm.nih.gov/sra/?term=SRP214747). All data generated or analyzed during this study are included in this article.

Acknowledgment

Zhongjun Liu and Siwei Li contributed equally to this study.

Disclosure Statement

No competing financial interests exist.

Funding Information

This study was supported by grants from the National Natural Science Foundation of China (81800957), Natural Science Foundation of Xinjiang Uygur Autonomous region (2019D01C00), Guangzhou Municipal Science and Technology Project (201904010068, 202201011515) and Guangdong Medical Research Fund (A2019567, A2017572, B2018065 and B2018121).

Supplementary Material

Supplementary Figure S1

References

Bai

, Liao

, Liu

, et al. MiR-296-3p regulates cell growth and multi-drug resistance of human glioblastoma by targeting ether-a-go-go (EAG1). Eur J Cancer, 2013; 49(3):710–724; doi: 10.1016/j.ejca.2012.08.020

Barrett

, Wang

, Salzman

. Circular RNA biogenesis can proceed through an exon-containing lariat precursor. Elife, 2015; 4:e07540; doi: 10.7554/eLife.07540

Chen

, Liu

, Fong

, et al. CCN3 Facilitates Runx2 and osterix expression by Inhibiting miR-608 through PI3K/Akt signaling in osteoblasts. Int J Mol Sci, 2019; 20(13):3300; doi: 10.3390/ijms20133300

Dou

, Cao

, Yang

, et al. Changing expression profiles of lncRNAs, mRNAs, circRNAs and miRNAs during osteoclastogenesis. Sci Rep, 2016; 6:21499; doi: 10.1038/srep21499

Eferl

, Hoebertz

, Schilling

, et al. The Fos-related antigen Fra-1 is an activator of bone matrix formation. EMBO J, 2004; 23(14):2789–2799; doi: 10.1038/sj.emboj.7600282

Fleischmann

, Hafezi

, Elliott

, et al. Fra-1 replaces c-Fos-dependent functions in mice. Genes Dev, 2000; 14(21):2695–2700; doi: 10.1101/gad.187900

, Song

, Liu

, et al. miRomics and Proteomics Reveal a miR-296-3p/PRKCA/FAK/Ras/c-Myc feedback loop modulated by HDGF/DDX5/beta-catenin complex in lung adenocarcinoma. Clin Cancer Res, 2017; 23(20):6336–6350; doi: 10.1158/1078-0432.CCR-16-2813

Geng

, Zhang

, Liu

, et al. Differentiation of human dental pulp stem cells into neuronal by resveratrol. Cell Biol Int, 2017; 41(12):1391–1398; doi: 10.1002/cbin.10835

Hansen

, Jensen

, Clausen

, et al. Natural RNA circles function as efficient microRNA sponges. Nature, 2013; 495(7441):384–388; doi: 10.1038/nature11993

10.

, Zhu

, Gao

, et al. Fra-1 is upregulated in gastric cancer tissues and affects the PI3K/Akt and p53 signaling pathway in gastric cancer. Int J Oncol, 2015; 47(5):1725–1734; doi: 10.3892/ijo.2015.3146

11.

Hilkens

, Gervois

, Fanton

, et al. Effect of isolation methodology on stem cell properties and multilineage differentiation potential of human dental pulp stem cells. Cell Tissue Res, 2013; 353(1):65–78; doi: 10.1007/s00441-013-1630-x

12.

Huang

, Zheng

, Jia

, et al. Long Noncoding RNA H19 Promotes Osteoblast Differentiation Via TGF-beta1/Smad3/HDAC Signaling Pathway by Deriving miR-675. Stem Cells, 2015; 33(12):3481–3492; doi: 10.1002/stem.2225

13.

Jochum

, David

, Elliott

, et al. Increased bone formation and osteosclerosis in mice overexpressing the transcription factor Fra-1. Nat Med, 2000; 6(9):980–984; doi: 10.1038/79676

14.

Lambrichts

, Driesen

, Dillen

, et al. Dental pulp stem cells: Their potential in reinnervation and angiogenesis by using scaffolds. J Endod, 2017; 43(9S):S12–S16; doi: 10.1016/j.joen.2017.06.001

15.

, Jiang

. Altered expression of circular RNA in human dental pulp cells during odontogenic differentiation. Mol Med Rep, 2019; 20(2):871–878; doi: 10.3892/mmr.2019.10359

16.

, Yang

, Zhou

, et al. Circular RNAs in cancer: Novel insights into origins, properties, functions and implications. Am J Cancer Res, 2015a;5(2):472–480.

17.

, Huang

, Bao

, et al. Exon-intron circular RNAs regulate transcription in the nucleus. Nat Struct Mol Biol, 2015b;22(3):256–264; doi: 10.1038/nsmb.2959

18.

Liu

, Chen

, Yan

, et al. MiRNA-296-3p-ICAM-1 axis promotes metastasis of prostate cancer by possible enhancing survival of natural killer cell-resistant circulating tumour cells. Cell Death Dis, 2013; 4:e928; doi: 10.1038/cddis.2013.458

19.

Liu

, Xu

, Dao

, et al. Differential expression of lncRNA/miRNA/mRNA and their related functional networks during the osteogenic/odontogenic differentiation of dental pulp stem cells. J Cell Physiol, 2020; 235(4):3350–3361; doi: 10.1002/jcp.29223

20.

Livak

, Schmittgen

. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 2001; 25(4):402–408; doi: 10.1006/meth.2001.1262

21.

Lukiw

. Circular RNA (circRNA) in Alzheimer's disease (AD). Front Genet, 2013; 4:307; doi: 10.3389/fgene.2013.00307

22.

Luther

, Driessler

, Megges

, et al. Elevated Fra-1 expression causes severe lipodystrophy. J Cell Sci, 2011; 124(Pt 9):1465–1476; doi: 10.1242/jcs.079855

23.

Matsuo

, Owens

, Tonko

, et al. Fosl1 is a transcriptional target of c-Fos during osteoclast differentiation. Nat Genet, 2000; 24(2):184–187; doi: 10.1038/72855

24.

Memczak

, Jens

, Elefsinioti

, et al. Circular RNAs are a large class of animal RNAs with regulatory potency. Nature, 2013; 495(7441):333–338; doi: 10.1038/nature11928

25.

Nigro

, Cho

, Fearon

, et al. Scrambled exons. Cell, 1991; 64(3):607–613; doi: 10.1016/0092-8674(91)90244-s

26.

, Zhang

, Wu

, et al. ceRNA in cancer: Possible functions and clinical implications. J Med Genet, 2015; 52(10):710–718; doi: 10.1136/jmedgenet-2015-103334

27.

Qian

, Yan

, Bai

, et al. Differential circRNA expression profiles during the BMP2-induced osteogenic differentiation of MC3T3-E1 cells. Biomed Pharmacother, 2017; 90:492–499; doi: 10.1016/j.biopha.2017.03.051

28.

Qin

, Yang

, Deng

, et al. Smad 1/5 is involved in bone morphogenetic protein-2-induced odontoblastic differentiation in human dental pulp cells. J Endod, 2012; 38(1):66–71; doi: 10.1016/j.joen.2011.09.025

29.

Salmena

, Poliseno

, Tay

, et al. A ceRNA hypothesis: The Rosetta Stone of a hidden RNA language?. Cell, 2011; 146(3):353–358; doi: 10.1016/j.cell.2011.07.014

30.

Salzman

, Chen

, Olsen

, et al. Cell-type specific features of circular RNA expression. PLoS Genet, 2013; 9(9):e1003777; doi: 10.1371/journal.pgen.1003777

31.

Schodel

, Grampp

, Maher

, et al. Hypoxia, hypoxia-inducible transcription factors, and renal cancer. Eur Urol, 2016; 69(4):646–657; doi: 10.1016/j.eururo.2015.08.007

32.

Song

, Sun

, Zhao

, et al. Non-coding RNAs participate in the regulatory network of CLDN4 via ceRNA mediated miRNA evasion. Nat Commun, 2017; 8(1):289; doi: 10.1038/s41467-017-00304-1

33.

Sun

, Wan

, Xu

, et al. Crosstalk between miR-34a and notch signaling promotes differentiation in apical papilla stem cells (SCAPs). J Dent Res, 2014; 93(6):589–595; doi: 10.1177/0022034514531146

34.

Wang

, Ma

, Jin

, et al. The effect of scaffold architecture on odontogenic differentiation of human dental pulp stem cells. Biomaterials, 2011; 32(31):7822–7830; doi: 10.1016/j.biomaterials.2011.04.034

35.

Wang

, Hu

, Cui

, et al. Coordinated targeting of MMP-2/MMP-9 by miR-296-3p/FOXCUT exerts tumor-suppressing effects in choroidal malignant melanoma. Mol Cell Biochem, 2018a;445(1–2):25–33; doi: 10.1007/s11010-017-3248-x

36.

Wang

, Pang

, Wu

, et al. MicroRNA hsa-let-7b suppresses the odonto/osteogenic differentiation capacity of stem cells from apical papilla by targeting MMP1. J Cell Biochem, 2018b;119(8):6545–6554; doi: 10.1002/jcb.26737

37.

Wang

, Ovitt

, Grigoriadis

, et al. Bone and haematopoietic defects in mice lacking c-fos. Nature, 1992; 360(6406):741–745; doi: 10.1038/360741a0

38.

, Geng

, Sun

, et al. Osteogenic differentiation of C2C12 myogenic progenitor cells requires the Fos-related antigen Fra-1 - a novel target of Runx2. Biochem Biophys Res Commun, 2013; 430(1):173–178; doi: 10.1016/j.bbrc.2012.11.033

39.

Zheng

, Li

, Huang

, et al. The circular RNA landscape of periodontal ligament stem cells during osteogenesis. J Periodontol, 2017; 88(9):906–914; doi: 10.1902/jop.2017.170078

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.04 MB