Effect of the Mitogen-Activated Protein Kinase Pathway on the Erastin-Induced Ferroptosis of Molt-4 Cells

Abstract

The role of ferroptosis in human acute lymphoblastic leukemia and its possible molecular mechanisms of action are still unknown. In this study, harvested Molt-4 cells were exposed to different concentrations of erastin, and their proliferation capacity was tested by using the cell counting kit-8 assay. Lipid peroxidation levels were detected through flow cytometry. Mitochondrial alterations were observed through transmission electron microscopy. The expression levels of SLC7A11, glutathione peroxidase 4 (GPX4), and mitogen-activated protein kinase (MAPK) were detected by using quantitative real-time PCR and Western blot analysis. This study found that erastin inhibited the growth of Molt-4 cells. This inhibitory effect could be partially reversed by the ferroptosis inhibitor Ferrostatin-1 and the p38 MAPK inhibitor. The mitochondria of Molt-4 cells treated with erastin shortened and condensed. Compared with those in the control group, the levels of reactive oxygen species and malondialdehyde had increased, whereas the levels of glutathione had decreased in the treatment group. The treatment of Molt-4 cells with erastin decreased the levels of SLC7A11 and GPX4 mRNA and increased the expression levels of p38 MAPK, extracellular signal–regulated kinase (ERK), and c-Jun N-terminal kinase. These findings suggested that erastin caused the ferroptosis of Molt-4 cells. This process may be correlated with the inhibition of the cystine/glutamate antiporter system and GPX4 and the activation of p38 MAPK and ERK1/2.

Introduction

Acute lymphoblastic leukemia (ALL) is one of the most common malignant tumors of the blood system. Although the survival rate of patients with childhood ALL is close to 90% (Hunger et al., 2012; Inaba et al., 2013), the relative survival rates of patients aged 15–69 years in Germany and the United States are only 43% and 35%, respectively (Pulte et al., 2014). These epidemiological data emphasize that the thorough exploration of new therapeutic targets is the primary task in the research on ALL treatment.

Reports have shown that many forms of cancer cells develop into iron overload (Bystrom and Rivella, 2015). Epidemiological studies have found that patients with ALL suffer from high serum iron and excess intracellular iron before and after receiving chemotherapy (Olcay et al., 2014). Iron overload can stimulate the growth and proliferation of cancer cells and thus has an important value in the progression of leukemia (Richardson et al., 2009; Kovacevic et al., 2011). Moreover, iron overload plays a vital role in ferroptosis. Wang et al. (2022) found that the regulation of ferroptosis in leukemic cells could improve the effect of chemotherapy in patients with acute myeloid leukemia (AML). In addition to this, ferroptosis suppressor protein 1 (FSP1) is a ferroptosis protective mechanism. However, in ALL cell lines, FSP1 is silenced by DNA methylation, making it susceptible to ferroptosis (Pontel et al., 2022). These findings suggested that triggering ferroptosis might be an effective approach to the treatment of ALL.

In 2003, researchers discovered that in various cancer cell lines, erastin could trigger ferroptosis, a nonapoptotic form of cell death (Dolma et al., 2003; Yagoda et al., 2007; Yang and Stockwell, 2008; Dixon et al., 2012). In contrast to autophagy and apoptosis, ferroptosis is characterized by the accumulation of iron-dependent lethal lipid peroxides (Li and Li, 2020). Erastin could accumulate reactive oxygen species (ROS) of leukemia cells by inhibiting the cystine/glutamate antiporter system (System $X_{c}^{-}$ ) and glutathione peroxidase 4 (GPX4); the accumulation of ROS is essential for triggering ferroptosis (Hangauer et al., 2017; Birsen et al., 2022).

It has been shown that mitogen-activated protein kinase (MAPK) is a downstream signaling of ROS, and that ROS accumulation leads to activation and phosphorylation of MAPK pathway members, which in turn induces apoptosis (Mantzaris et al., 2016). Subsequently, Hattori et al. (2017) found that in a certain cell line (A549), ROS could trigger ferroptosis by activating the MAPK pathway. This suggests to us that the MAPK pathway plays an important role not only in apoptosis but also in ferroptosis. p38 MAPK, extracellular signal–regulated kinase 1/2 (ERK1/2), and c-Jun N-terminal kinase (JNK) are the major MAPKs (Chang et al., 2021). In human mammary epithelial cells, the activation of ERK1/2 induces sensitivity to ferroptosis (Poursaitidis et al., 2017). In AML cells, the use of JNK and p38 inhibitors would cause resistance to erastin-induced ferroptosis (Yu et al., 2015). Although MAPK has been proven to be related to the ferroptosis of cancer cells, its contribution to the ferroptosis of ALL cells has not been clearly defined. Clarifying the erastin-triggered interaction between MAPK and ferroptosis is therefore critical for the development of ALL treatment strategies.

In this study, we compared the cell viability; mitochondrial morphological variations; oxidation levels; and System $X_{c}^{-}$ , GPX4, and MAPK expression levels in Molt-4 cells under erastin treatment to clarify whether erastin could be a potential treatment for ALL by triggering ferroptosis and whether System $X_{c}^{-}$ , GPX4, and MAPK are associated with this process.

Materials and Methods

Cell culture

Molt-4 cells, a kind of T cell acute lymphoblastic leukemia (T-ALL) cell line, were incubated in RPMI-1640 (Biological Industries, Israel) containing 10% fetal bovine serum (Biological Industries), 100 U/mL penicillin (Hyclone), and 100 U/mL streptomycin (Hyclone), then cultured in a humid atmosphere containing 5% CO₂ at 37°C.

Cell viability measurements

The cells were harvested in the logarithmic growth period (5 × 10⁵), plated into 96-well plates with erastin and various inhibitors, and incubated for 24 h at 37°C and 5% CO₂. A total of 10 μL of Cell Counting Kit-8 (Dojindo) reagent was added to each well. The cells were then cultivated for 2–3 h. Subsequently, their optical density values were measured at the absorbance of 450 nm by using a microplate reader (Biotek). Erastin and Ferrostain-1 were purchased from (MedChemExpress), and z-vad-fmk, Nec-1, and 3-MA were procured from Meilunbio (China).

Observation of mitochondria by transmission electron microscopy

Molt-4 cells were seeded into a six-well plate, treated with erastin, and cultured for 24 h. Then, the cells were collected for centrifugation. The cell precipitate was fixed with 1 mL of 2.5% glutaraldehyde at 4°C, washed three times with 0.1 M phosphate buffer, fixed with 1% osmium acid at 4°C, and washed again three times. Subsequently, the cells were dehydrated in an alcohol gradient before being embedded. After curing, the sample was cut into ultrathin sections (Leica, Germany). After the sample was successively stained with uranyl acetate and lead citrate, its mitochondrial ultrastructure was observed with a transmission electron microscope (Hitachi, Japan).

ROS, malondialdehyde, and glutathione assays

The content of ROS in cells was measured using flow cytometry (CytoFLEX S). The cells were harvested, centrifuged for supernatant collection, dyed with 10 μM 2′,7′-dichlorodihydrofluorescein diacetate (DFCH-DA), and incubated in the dark for 30 min. Then, cells were washed with RPMI-1640 two to three times and finally added with 500 μL of phosphate-buffered saline (PBS). Fluorescence intensity of the cells was detected at the excitation wavelength of 488 nm and the emission wavelength of 525 nm. Glutathione (GSH) and malondialdehyde (MDA) contents were measured by using GSH and MDA assay kits from Nanjing Jiancheng Bioengineering Institute (China).

Total RNA extraction, reverse transcription, and quantitative real-time PCR

The total RNA was extracted from erastin-treated Molt-4 cells by using Trizol reagent (Beyotime, China). RNA quantification was performed with a micro ultraviolet–visible spectrophotometer. T100™ Thermal Cycler (Bio-Rad) was used to reverse transcribe 1 μg of total RNA in a 20 μL volume. CFX Connect real-time fluorescence quantitative PCR (qPCR; Bio-Rad) was used for real-time PCR with a 20 μL volume. β-Actin was used as a housekeeping gene. The primer sequences are presented in Table 1. The relative mRNA expression level was calculated using the 2^−△△CT method in Excel.

Table 1.

Sequences of the Primers Used for Real Time Quantitative PCR Analysis

Gene	Forward primer sequence	Reverse primer sequence
β-Actin	CATGTACGTTGCTATCCAGGC	CTCCTTAATGTCACGCACGAT
SLC7A11	GGTCCATTACCAGCTTTTGTACG	AATGTAGCGTCCAAATGCCAG
GPX4	TTTCCGCCAAGGACATC	TCCCGAACTGGTTACACG

Protein extraction and Western blot analysis

Cells were harvested and washed twice with ice-cold PBS then lysed on ice for 15 min with RIPA lysate buffer (Beyotime) containing protease and phosphatase inhibitors. Then, proteins were uniformly mixed with 5 × sodium dodecyl sulfate (SDS) loading buffer and boiled at 100°C for 5 min. Equal amounts of protein (30–40 μg) were loaded and separated by 10% SDS–polyacrylamide gel electrophoresis (SDS-PAGE) and then electrotransferred onto polyvinylidene fluoride (PVDF) membranes. The PVDF membranes were blocked in 5% nonfat milk for 80 min and incubated with p38MAPK, ERK1/2, JNK, p-p38MAPK, p-ERK1/2, p-JNK, and β-actin primary antibodies at 4°C overnight and subsequently incubated with the matching secondary antibodies at room temperature for 2 h. Electrochemiluminescence (ECL) reagent was used to visualize bands. ImageJ software was used to quantify the relative protein contents, and the final results were the target protein/β-actin ratios. The primary antibodies, secondary antibodies, and ECL mentioned above were all from Beyotime.

Statistical analysis

SPSS 22.0 software was used for statistical analysis of data. One-way analysis of variance was performed to compare the difference between multiple groups. Dunnett's t-test was used to analyze the difference between the experimental and control groups. Differences were statistically significant when p < 0.05.

Results

Effect of erastin on Molt-4 cell activity

To test whether erastin can inhibit the ALL cells viability, we treated Molt-4 cells with 0, 2.5, 5, 10, 20, and 40 μM erastin for 12, 24, and 48 h. The results showed that cell viability decreased not only with the increase in erastin concentration, but also with the prolongation of treatment time (Fig. 1). These results revealed that erastin could inhibit the proliferation of Molt-4 cells in a dose- and time-dependent manner.

FIG. 1.

Changes in the viability of Molt-4 cells treated with different concentrations of erastin for different durations. SPSS 22.0 software calculated that the half-inhibitory concentration of Molt-4 cells treated with erastin for 12, 24, and 48 h were 65.23, 27.68, and 7.69 μM, respectively. Erastin concentrations of 0, 5, 10, and 20 μM were selected for treatment and incubation for 24 h in subsequent experiments. **p < 0.01 (vs. 12 h control group); ^# p < 0.01 (vs. 24 h control group); ^& p < 0.01 (vs. 48 h control group); n = 5.

Effects of different cell death inhibitors on cell viability

Early experimental results confirmed that erastin triggered cell death, but whether the mode of death was ferroptosis was still unclear. We treated Molt-4 cells with erastin and inhibitors regulating cell death to further identify the mode of cell death. As given in Figure 2E, cell viability was restored, although not entirely, by the ferroptosis inhibitor Fer-1, indicating that Fer-1 partially reversed the cell death induced by erastin, whereas z-vad-fmk, Nec-1, and 3-MA failed to maintain the viability of Molt-4 cells. The results mentioned above preliminarily indicated that the erastin-induced death pathway of Molt-4 cells was ferroptosis rather than apoptosis, necroptosis, or autophagy.

FIG. 2.

Changes in cell viability after treatment with different cell death inhibitors and erastin. (A–D) Changes in the viability of Molt-4 cells after treatment with Fer-1, z-vad-fmk (apoptosis inhibitor), Nec-1 (necroptosis inhibitor), and 3-MA (autophagy inhibitor) for 24 h. Concentrations of Fer-1, z-vad-fmk, Nec-1, and 3-MA used in subsequent experiments were 1, 2.5, 2.5 μM, and 5 mM, respectively; *p < 0.05 (vs. control group); **p < 0.01 (vs. control group); n = 5. (E) Cell viability changes after treatment with erastin. Concentration of erastin was 10 μM. **p < 0.01 (vs. control group); ^## p < 0.01 (vs. erastin group); n = 3.

Ultrastructure of mitochondria in erastin-treated Molt-4 cells

The above experiments have preliminarily provided that erastin-induced ferroptosis is distinct from other forms of death. However, the dramatic morphological changes of mitochondria in ferroptosis are convincing proof to distinguish ferroptosis from other forms of cell death. The typical morphological changes associated with ferroptosis include volume reduction in mitochondria, reduction or disappearance of mitochondrial cristae, and increase in bilayer membrane density (Dixon et al., 2012).

As given in Figure 3A, a, the mitochondria of untreated Molt-4 cells had a regular shape, size, complete structure, and orderly cristae. Erastin-treated cells exhibit increased mitochondrial membrane density and corresponding volume reduction (Fig. 3B–D, b–d). These changes in erastin-treated Molt-4 cells were the same as the characteristics of ferroptosis, and no characteristic morphological features associated with necroptosis (swelling of cytoplasm, rupture of plasma membrane), apoptosis (condensation and margination of chromatin), or autophagy (formation of double membrane–enclosed vesicles) (Dehart et al., 2018). The mode of erastin-induced death is preliminarily shown to be ferroptosis.

FIG. 3.

Ultrastructure of mitochondria in Molt-4 cells under transmission electron microscopy. The red box in (A–D) shows mitochondria observed under low-power microscopy (4000 × ), and (a–d) show their corresponding amplification regions under high-power microscopy (12,000 × ). The red arrow indicates normal mitochondria, whereas the white arrow indicates mitochondria that have shrunk or exhibit crista reduction or disappearance. Erastin was administered at concentrations of 0, 5, 10, and 20 μM.

Erastin inhibits antioxidant defense in Molt-4 cells

The dominant feature of ferroptosis is the lethal accumulation of lipid peroxides and ROS (Li and Li, 2020). In our study, we used DCFH-DA assay to measure the level of ROS. This assay is based on the diffusion of DCFH-DA into the cells. Then it is deacetylated by cellular esterases to a nonfluorescent compound, which is later oxidized by ROS into DCF. DCF is highly fluorescent and its fluorescence intensity could represent the level of ROS in cells. In Figure 4A, as the concentration of erastin was increased, the ROS peak curve shifted to the right, and the 2′,7′-dichlorofluorescein (DFC) fluorescence intensity of Molt-4 cells gradually increased (Fig. 4B).

FIG. 4.

Lipid peroxidation levels of Molt-4 cells under erastin treatment. (A) DFC fluorescence intensity was measured by flow cytometry to respond to ROS levels. (B) Average DFC fluorescence intensity of cells in each group; **p < 0.01 (vs. control group); n = 3. (C) Change in MDA content in Molt-4 cells treated with different concentrations of erastin; *p < 0.05 (vs. control group); **p < 0.01 (vs. control group); n = 3. (D) Changes in GSH content in Molt-4 cells after treatment with different concentrations of erastin; **p < 0.01 (vs. control group); n = 4. DFC, 2′,7′-dichlorofluorescein; GSH, glutathione; MDA, malondialdehyde; ROS, reactive oxygen species.

MDA is the main product of lipid peroxidation reactions and is indicative of the level of intracellular peroxides to some extent. In accordance with the levels of ROS, the MDA levels in the 10 and 20 μM erastin-treated groups showed a significant increase (Fig. 4C), indicating that erastin induced lipid peroxidation. The level of GSH, an important intracellular antioxidant, reflects the capacity of an organism to clear ROS (Yang et al., 2014). Erastin caused a dose-dependent decrease in GSH levels after 24 h of exposure (Fig. 4D). The suppression of the antioxidant system and the elevation of oxidative damage further confirmed that erastin triggered ferroptosis in Molt-4 cells.

Regulation of System $X_{c}^{-}$ , GPX4, and MAPK in erastin-triggered ferroptosis

It has been suggested that both inhibition of System $X_{c}^{-}$ and GPX4 are required for the formation of ROS (Forcina and Dixon, 2019). Moreover, activation of MAPK, the downstream pathway of ROS, has also been proven to regulate ferroptosis (Nakamura et al., 2019). SLC7A11 is one of the components of System $X_{c}^{-}$ (Dixon et al., 2012). We examined the variations in SLC7A11 and GPX4 mRNA expression using real time quantitative PCR to investigate whether System $X_{c}^{-}$ and GPX4 participate in erastin-induced ferroptosis. The results showed that the expression levels of SLC7A11 and GPX4 mRNA were reduced in all treatment groups relative to those in the control group (Fig. 5). This finding suggested that erastin may induce the sensitivity of Molt-4 to ferroptosis by suppressing the effects of System $X_{c}^{-}$ and GPX4.

FIG. 5.

Expression levels of SLC7A11 and GPX4 mRNA after erastin treatment; **p < 0.01 (vs. control group); n = 4. GPX4, glutathione peroxidase 4.

The results mentioned above showed that erastin inhibited the action of System $X_{c}^{-}$ and GPX4. However, whether MAPK engages in ferroptosis has not been clarified. Subsequently, we examined the expression levels of p38 MAPK, ERK1/2, and JNK and their phosphorylated proteins after erastin treatment. Compared with those in the control group, the protein expression levels of p38 MAPK, ERK1/2, and JNK gradually increased in the 10 and 20 μM groups (Fig. 6A–C); the protein expression levels of p-p38 MAPK slowly increased in the 5 and 10 μM groups; and the protein expression levels of p-ERK1/2 and p-JNK increased only in the 20 μM group (Fig. 6D–F).

FIG. 6.

Expression levels of p38 MAPK, ERK1/2, and JNK and their phosphorylated proteins in Molt-4 cells under erastin treatment. (A–F) Quantitative analysis results of the relative expression levels of p38 MAPK, ERK1/2, JNK, p-p38 MAPK, p-ERK, and p-JNK proteins. (G) Western blot analysis was used to detect the levels of protein expression; **compared with the corresponding control groups, p < 0.01; n = 3. Cell viability changes under treatment with p38-, MAPK-, ERK1/2-, and JNK-specific inhibitors and erastin. (H) SB203580 (p38 MAPK inhibitor), PD98059 (ERK1/2 inhibitor), and SP600125 (JNK inhibitor). The pretreatment concentrations of each inhibitor were selected in reference to the literature as 10, 50, and 20 μM, and the pretreatment time was 2 h. Erastin concentration was selected as 10 μM in accordance with the results of the previous cell viability assay. Compared with the cell viability of the erastin-alone group, that of the erastin+SB203580 group recovered (p < 0.05), that of the erastin+PD98059 group decreased (p < 0.05), and that of the erastin+SP600125 group did not change significantly (p > 0.05). **p < 0.01 (vs. control group); ^# p < 0.05 (vs. ersatin group); ^## p < 0.01 (vs. ersatin group); n = 5. ERK1/2, extracellular signal–regulated kinase 1/2; JNK, c-Jun N-terminal kinase; MAPK, mitogen-activated protein kinase.

The cells were treated with p38 MAPK, ERK1/2, and JNK inhibitors to further elucidate the effects of p38 MAPK, ERK1/2, and JNK. Cell viability assays showed that in Molt-4 cells, the inhibition of p38 MAPK rescued erastin-induced ferroptosis. By contrast, ERK1/2 inhibitors exacerbated erastin-induced ferroptosis (Fig. 6H). These findings, combined with the results of Western blot analysis, indicated that p38 MAPK is involved in erastin-induced ferroptosis.

Discussion

A growing number of studies have shown that ferroptosis is associated with tumor suppression (Jiang et al., 2015; Viswanathan et al., 2017; Tang et al., 2021). Nevertheless, the application of ferroptosis induction in hematological malignancies is limited. Treatment with a low dose of erastin in combination with cytarabine and adriamycin results in a more favorable prognosis for AML than conventional chemotherapy alone (Yu et al., 2017). However, little is known about ALL. In the present study, we found that Molt-4 cells are sensitive to erastin-induced ferroptosis and that this process also involves the inhibition of System $X_{c}^{-}$ and GPX4 and the activation of MAPK.

Ferroptosis is a form of cell death that is different from autophagy, apoptosis, and necroptosis (Dixon et al., 2012). It can be triggered in cancer cell lines by a number of small molecules, including (1S,3R)-RSL3 and erastin (Dachert et al., 2016). Recent researches have shown that erastin triggered ferroptosis in human hepatocellular cells and human promyelocytic leukemia cells (HL60) (Yuan et al., 2016; Ye et al., 2019). To investigate the effect of erastin on ALL cells, we treated Molt-4 cells with different concentrations of erastin. Unrestrained lipid peroxidation is the hallmark of ferroptosis (Li and Li, 2020; Jiang et al., 2021); we detected the oxidative damage-related markers. The levels of ROS and MDA were increased.

Alterations of mitochondrial, condensed mitochondrial membrane densities and smaller volume, as well as the diminished or vanished of mitochondria crista and outer membrane ruptured, were consistent with the ferroptosis characteristics (Dixon et al., 2012; Li et al., 2021). Furthermore, only Fer-1 restored cell viability after treatment with the Fer-1, z-vad-fmk, Nec-1, and 3-MA in combination with erastin. These findings confirmed that erastin has triggered ferroptosis in Molt-4 cells, which is consistent with previous studies (Dachert et al., 2016; Pontel et al., 2022).

Ferroptosis is regulated by multiple mechanisms, the model of action of erastin-triggered ferroptosis is distinct from that of RSL3 that directly inhibit GPX4 (Yang et al., 2014). It depletes GSH by preventing cystine uptake by regulating System $X_{c}^{-}$ and this depletion is dose dependent (Dixon et al., 2012). One of the consequences of GSH depletion is the inactivation of GPX4, in turn, triggering ferroptosis (Yang et al., 2014). We observed that erastin caused a dose-dependent decrease in GSH levels and decreased expression of SLC7A11 and GPX4 genes in Molt-4 cells. This suggests that ferroptosis triggered by erastin in Molt-4 cells is associated with the inhibition of System $X_{c}^{-}$ and GPX4.

Studies have proved that erastin-induced ferroptosis is closely associated with the accumulation of ROS (Yagoda et al., 2007; Dixon et al., 2012). ROS of erastin-treated Molt-4 cells is significantly increased. It has been suggested MAPK is tightly linked to ferroptosis in multiple types of diseases (Gao et al., 2018). Li et al. (2018) found that the inhibition of p38 MAPK activation in germ cells with high ROS prevents ferroptosis. Codenotti et al. (2018) suggested that erastin triggers ferroptosis in highly proliferating myogenic lines through ERK pathway-dependent manner. Along with the ferroptosis feature of ROS accumulation in Molt-4 cells, we further explored the role of MAPK in erastin-induced ferroptosis. Erastin promoted p38 MAPK, ERK1/2, and JNK protein expression and phosphorylation of p38 MAPK, ERK1/2, and JNK in Molt-4 cells. The cell viability results showed that p38 MAPK inhibitors alleviated erastin-induced ferroptosis, in agreement with previous findings (Yu et al., 2015; Hattori et al., 2017).

It is notable that although ERK1/2 was activated, the inhibitor of ERK1/2 exacerbated erastin-induced ferroptosis. This is not consistent with previous studies (Codenotti et al., 2018; Gao et al., 2018). After intensive investigation, we speculated that, first, 50 μM of ERK1/2 inhibitor does not affect other cells (de Rooij et al., 2022), but it may reduce the metabolic ability of Molt-4 cells or trigger other forms of cell death. Second, Su et al. (2019) reported that panx1 knockdown inhibits erastin-induced ferroptosis by activating the MAPK/ERK pathway, and this protective effect is associated with increased expression of antioxidant gene HO-1.

It might be thought, in Molt-4 cells, p38 MAPK and ERK1/2 simultaneously regulate erastin-induced ferroptosis. But the positive regulation of p38 MAPK has a greater effect than the negative regulation of ERK1/2. That would explain why the cell viability is diminished after being treated with ERK1/2 inhibition, although ERK1/2 is activated when Molt-4 cells undergo ferroptosis. This controversy deserves further thorough investigation and exploration. In consideration of the above results, we suggest that the activation of p38 MAPK and ERK1/2 is associated with erastin-induced ferroptosis in Molt-4 cells. The specific mechanism involving the upstream and downstream molecules of the p38 MAPK and ERK1/2 pathway in the regulation of ferroptosis remains unclear and will be further explored in well-designed experiments in the future.

Conclusions

The findings of this study included confirmation of the role of erastin in inducing ferroptosis in T-ALL cells and a preliminary investigation of the putative mechanisms regulating ferroptosis via the MAPK pathway (Fig. 7). System $X_{c}^{-}$ and GPX4 action inhibition and p38 MAPK and ERK1/2 activation were found to be correlated with erastin-triggered ferroptosis. This work lays a theoretical foundation for exploring the mechanism of ferroptosis in Molt-4 cells and finding novel targets for T-ALL therapy. Nevertheless, numerous epidemiological and animal studies are needed to determine the positive effect of erastin on T-ALL treatment and the specific mechanism of MAPK in erastin-induced ferroptosis.

FIG. 7.

Schematic of proposed mechanisms for erastin regulating ferroptosis in Molt-4 cells. When Molt-4 cells are exposed to erastin, the System $X_{c}^{-}$ on the membrane will be inhibited. The decrease of intracellular cystine affects the synthesis of GSH, which subsequently inhibits GPX4, leading to the dysregulation of the antioxidant system and the accumulation of high levels of ROS. The accumulation of ROS may lead to ferroptosis in Molt-4 cells and the activation of the MAPK signaling pathway is related to this process.

Footnotes

Disclosure Statement

No competing financial interests exist.

Funding Information

This study was supported by the Natural Science Foundation of Hubei Province (2019CFB500).

References

Birsen

, Larrue

, Decroocq

, Johnson

, Guiraud

, Gotanegre

, et al. (2022). Apr-246 induces early cell death by ferroptosis in acute myeloid leukemia. Haematologica, 107, 403–416.

Bystrom

L.M.

, and Rivella

(2015). Cancer cells with irons in the fire. Free Radic Biol Med, 79, 337–342.

Chang

W.T.

, Bow

Y.D.

, Fu

P.J.

, Li

C.Y.

, Wu

C.Y.

, Chang

Y.H.

, et al. (2021). A marine terpenoid, heteronemin, induces both the apoptosis and ferroptosis of hepatocellular carcinoma cells and involves the ros and mapk pathways. Oxid Med Cell Longev, 2021, 7689045.

Codenotti

, Poli

, Asperti

, Zizioli

, Marampon

, and Fanzani

(2018). Cell growth potential drives ferroptosis susceptibility in rhabdomyosarcoma and myoblast cell lines. J Cancer Res Clin Oncol, 144, 1717–1730.

Dachert

, Schoeneberger

, Rohde

, and Fulda

(2016). Rsl3 and erastin differentially regulate redox signaling to promote smac mimetic-induced cell death. Oncotarget, 7, 63779–63792.

de Rooij

, Thus

Y.J.

, Swier

, Beijersbergen

R.L.

, Pals

S.T.

, and Spaargaren

(2022). A loss-of-adhesion crispr-cas9 screening platform to identify cell adhesion-regulatory proteins and signaling pathways. Nat Commun, 13, 2136.

Dehart

D.N.

, Fang

, Heslop

, Li

, Lemasters

J.J.

, and Maldonado

E.N.

(2018). Opening of voltage dependent anion channels promotes reactive oxygen species generation, mitochondrial dysfunction and cell death in cancer cells. Biochem Pharmacol, 148, 155–162.

Dixon

S.J.

, Lemberg

K.M.

, Lamprecht

M.R.

, Skouta

, Zaitsev

E.M.

, Gleason

C.E.

, et al. (2012). Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell, 149, 1060–1072.

Dolma

, Lessnick

S.L.

, Hahn

W.C.

, and Stockwell

B.R.

(2003). Identification of genotype-selective antitumor agents using synthetic lethal chemical screening in engineered human tumor cells. Cancer Cell, 3, 285–296.

10.

Forcina

G.C.

, and Dixon

S.J.

(2019). Gpx4 at the crossroads of lipid homeostasis and ferroptosis. Proteomics, 19, e1800311.

11.

Gao

, Bai

, Jia

, Zhao

, Kang

, Tang

, et al. (2018). Ferroptosis is a lysosomal cell death process. Biochem Biophys Res Commun, 503, 1550–1556.

12.

Hangauer

M.J.

, Viswanathan

V.S.

, Ryan

M.J.

, Bole

, Eaton

J.K.

, Matov

, et al. (2017). Drug-tolerant persister cancer cells are vulnerable to gpx4 inhibition. Nature, 551, 247–250.

13.

Hattori

, Ishikawa

, Sakauchi

, Takayanagi

, Naguro

, and Ichijo

(2017). Cold stress-induced ferroptosis involves the ask1–p38 pathway. Embo Rep, 18, 2067–2078.

14.

Hunger

S.P.

, Lu

, Devidas

, Camitta

B.M.

, Gaynon

P.S.

, Winick

N.J.

, et al. (2012). Improved survival for children and adolescents with acute lymphoblastic leukemia between 1990 and 2005: a report from the children's oncology group. J Clin Oncol, 30, 1663–1669.

15.

Inaba

, Greaves

, and Mullighan

C.G.

(2013). Acute lymphoblastic leukaemia. Lancet, 381, 1943–1955.

16.

Jiang

, Kon

, Li

, Wang

S.J.

, Su

, Hibshoosh

, et al. (2015). Ferroptosis as a p53-mediated activity during tumour suppression. Nature, 520, 57–62.

17.

Jiang

, Stockwell

B.R.

, and Conrad

(2021). Ferroptosis: mechanisms, biology and role in disease. Nat Rev Mol Cell Biol, 22, 266–282.

18.

Kovacevic

, Kalinowski

D.S.

, Lovejoy

D.B.

, Yu

, Suryo

R.Y.

, Sharpe

P.C.

, et al. (2011). The medicinal chemistry of novel iron chelators for the treatment of cancer. Curr Top Med Chem, 11, 483–499.

19.

, and Li

(2020). The interaction between ferroptosis and lipid metabolism in cancer. Signal Transduct Target Ther, 5, 108.

20.

, Hao

, Zhao

, Wang

, Zhao

, Jiang

, et al. (2018). Ferroptosis is associated with oxygen-glucose deprivation/reoxygenation-induced sertoli cell death. Int J Mol Med, 41, 3051–3062.

21.

, Zeng

, Lu

, Yin

, Shan

, and Gao

(2021). Erastin induces ferroptosis via ferroportin-mediated iron accumulation in endometriosis. Hum Reprod, 36, 951–964.

22.

Mantzaris

M.D.

, Bellou

, Skiada

, Kitsati

, Fotsis

, and Galaris

(2016). Intracellular labile iron determines h2o2-induced apoptotic signaling via sustained activation of ask1/jnk-p38 axis. Free Radic Biol Med, 97, 454–465.

23.

Nakamura

, Naguro

, and Ichijo

(2019). Iron homeostasis and iron-regulated ros in cell death, senescence and human diseases. Biochim Biophys Acta Gen Subj, 1863, 1398–1409.

24.

Olcay

, Hazirolan

, Yildirmak

, Erdemli

, Terzi

Y.K.

, Arda

, et al. (2014). Biochemical, radiologic, ultrastructural, and genetic evaluation of iron overload in acute leukemia and iron-chelation therapy. J Pediatr Hematol Oncol, 36, 281–292.

25.

Pontel

L.B.

, Bueno-Costa

, Morellato

A.E.

, Carvalho

S.J.

, Roue

, and Esteller

(2022). Acute lymphoblastic leukemia necessitates gsh-dependent ferroptosis defenses to overcome fsp1-epigenetic silencing. Redox Biol, 55, 102408.

26.

Poursaitidis

, Wang

, Crighton

, Labuschagne

, Mason

, Cramer

S.L.

, et al. (2017). Oncogene-selective sensitivity to synchronous cell death following modulation of the amino acid nutrient cystine. Cell Rep, 18, 2547–2556.

27.

Pulte

, Jansen

, Gondos

, Katalinic

, Barnes

, Ressing

, et al. (2014). Survival of adults with acute lymphoblastic leukemia in germany and the united states. PLoS One, 9, e85554.

28.

Richardson

D.R.

, Kalinowski

D.S.

, Lau

, Jansson

P.J.

, and Lovejoy

D.B.

(2009). Cancer cell iron metabolism and the development of potent iron chelators as anti-tumour agents. Biochim Biophys Acta, 1790, 702–717.

29.

, Jiang

, Yang

, Zhang

, Chen

, Li

, et al. (2019). Pannexin 1 mediates ferroptosis that contributes to renal ischemia/reperfusion injury. J Biol Chem, 294, 19395–19404.

30.

Tang

, Chen

, Kang

, and Kroemer

(2021). Ferroptosis: molecular mechanisms and health implications. Cell Res, 31, 107–125.

31.

Viswanathan

V.S.

, Ryan

M.J.

, Dhruv

H.D.

, Gill

, Eichhoff

O.M.

, Seashore-Ludlow

, et al. (2017). Dependency of a therapy-resistant state of cancer cells on a lipid peroxidase pathway. Nature, 547, 453–457.

32.

Wang

, Liu

, and Wang

(2022). Combination regimen of granulocyte colony-stimulating factor and recombinant human thrombopoietin improves the curative effect on elderly patients with leukemia through inducing pyroptosis and ferroptosis of leukemia cells. Cancer Gene Ther, 29, 1742–1750.

33.

Yagoda

, von Rechenberg

, Zaganjor

, Bauer

A.J.

, Yang

W.S.

, Fridman

D.J.

, et al. (2007). Ras-raf-mek-dependent oxidative cell death involving voltage-dependent anion channels. Nature, 447, 864–868.

34.

Yang

W.S.

, Sriramaratnam

, Welsch

M.E.

, Shimada

, Skouta

, Viswanathan

V.S.

, et al. (2014). Regulation of ferroptotic cancer cell death by gpx4. Cell, 156, 317–331.

35.

Yang

W.S.

, and Stockwell

B.R.

(2008). Synthetic lethal screening identifies compounds activating iron-dependent, nonapoptotic cell death in oncogenic-ras-harboring cancer cells. Chem Biol, 15, 234–245.

36.

, Chai

, Xie

, Yang

, Yu

, Cao

, et al. (2019). Hmgb1 regulates erastin-induced ferroptosis via ras-jnk/p38 signaling in hl-60/nras(q61l) cells. Am J Cancer Res, 9, 730–739.

37.

, Guo

, Xie

, Wang

, and Chen

(2017). Ferroptosis, a new form of cell death, and its relationships with tumourous diseases. J Cell Mol Med, 21, 648–657.

38.

, Xie

, Cao

, Yang

, Lotze

M.T.

, et al. (2015). The ferroptosis inducer erastin enhances sensitivity of acute myeloid leukemia cells to chemotherapeutic agents. Mol Cell Oncol, 2, e1054549.

39.

Yuan

, Li

, Zhang

, Kang

, and Tang

(2016). Identification of acsl4 as a biomarker and contributor of ferroptosis. Biochem Biophys Res Commun, 478, 1338–1343.

Effect of the Mitogen-Activated Protein Kinase Pathway on the Erastin-Induced Ferroptosis of Molt-4 Cells

Abstract

Introduction

Materials and Methods

Cell culture

Cell viability measurements

Observation of mitochondria by transmission electron microscopy

ROS, malondialdehyde, and glutathione assays

Total RNA extraction, reverse transcription, and quantitative real-time PCR

Protein extraction and Western blot analysis

Statistical analysis

Results

Effect of erastin on Molt-4 cell activity

Effects of different cell death inhibitors on cell viability

Ultrastructure of mitochondria in erastin-treated Molt-4 cells

Erastin inhibits antioxidant defense in Molt-4 cells

Regulation of System X c − , GPX4, and MAPK in erastin-triggered ferroptosis

Discussion

Conclusions

Footnotes

Disclosure Statement

Funding Information

References

Regulation of System $X_{c}^{-}$ , GPX4, and MAPK in erastin-triggered ferroptosis