Histone Lactylation-Driven GPD2 Mediates M2 Macrophage Polarization to Promote Malignant Transformation of Cervical Cancer Progression

Abstract

Cervical cancer (CC) is the most common cancer in women. This study aims to explore the molecular mechanism of lactate secreted by CC cells modulating macrophage polarization in CC via histone lactylation. Normal cervical epithelium (NCE), low-grade squamous intraepithelial lesion (LSIL), high-grade squamous intraepithelial lesion (HSIL), and cervical squamous cell carcinoma (CESC) were collected to assess H3K18la level and macrophage infiltration. Macrophages were incubated with SiHa cell-derived conditioned medium to detect M1 and M2 markers. NCE, HSIL, and CESC samples were used for ChIP-seq of H3K18la. Histone lactylation-dirven GPD2 was knocked down in macrophages. Compared to NCE, H3K18la level and M2 macrophage abundance were increased in LSIL, HSIL, and CESC. Lactate secreted by CC cells upregulated H3K18la and M2 markers but downregulated M1 markers in macrophages. ChIP-seq revealed that upregulated pathways in HSIL vs. NCE and CESC vs. HSIL were commonly enriched in lipid metabolism. Notably, lactate upregulated H3K18la-modified GPD2 expression in macrophages, and GPD2 knockdown reversed lactate induction to M2 macrophages. Collectively, lactate secreted by CC cells upregulates GPD2 via histone lactylation, thereby promoting M2 macrophage polarization in CC. This study provides new insights into the role of histone lactylation in macrophage polarization in the malignant transformation of CC.

Introduction

Cervical cancer (CC) is one of the most prevalent gynecological tumors and the fourth leading cause of female cancer-related mortality (Liu et al., 2023). More than 90% of CC is caused by human papillomavirus infection (Voelker, 2023). Cervical precancer can progress to CC if not treated. Thereby, timely inhibition of cervical precancer lesion is necessary for prevention of malignancy transition and CC treatment. However, the molecular mechanism underlying the malignant transformation of CC is still unknown, which limits the explorations of CC prevention.

In the malignant transformation from cervical precursor lesions to CC, immune microenvironment undergoes a transition from immune activation to exhaustion, finally leading to immune suppression (Guo et al., 2023). Macrophage is one of the most abundant immune cell subsets in tumor microenvironment. Activated macrophages are classified into M1 and M2 phenotypes. M2 macrophages play a vital role in CC. Previous study indicates that a shift from the M1 to the M2 polarization phenotype occurs during the transition from HPV-positive cervix to CC (Guo et al., 2023). M2 macrophages also facilitate the proliferation, migration, and invasion of CC cells and tumor angiogenesis to aggravate CC progression (Du et al., 2022b, Sui et al., 2023, Zhou et al., 2022). Macrophage polarization in CC can be regulated by multiple factors (Cortes-Morales et al., 2023, Ren et al., 2022). For example, the lack of BST2 suppressed M2 macrophage polarization but induced M1 macrophage polarization and depressed CC cell growth (Liu et al., 2021). Similarly, the overexpression of SOCS2 not only inhibited the polarization of M2 macrophages but also the proliferation, migration, and invasion of CC cells (Li et al., 2024). Therefore, further investigation of the regulatory mechanism of macrophage polarization enables us to develop more attractive targets for antitumor therapy through properly enhanced antitumor features.

Previous studies have shown that CC cells express markers of glycolysis and secrete abundant lactate (Colbert et al., 2023, Li and Sui, 2021, Stone et al., 2019). Lactate is recognized as a molecule capable of mediating macrophage polarization changes. Colegio et al. (2014) indicated that hypoxia-inducible factor 1α can mediate lactate produced by tumor cells to induce the expression of Arg-1 and the M2-like polarization of tumor-associated macrophages. Chen et al. (2017) also reported that lactate activates macrophage Gpr132 to promote the alternatively activated M2-like phenotype. There is an increasing number of studies suggest that intracellular lactate production affects the lactylation level of histone lysine residues and confers macrophage homeostatic gene expression signatures via transcriptional regulation (Cui et al., 2021, Wang et al., 2022). For example, increased histone lactylation induces the expression of M2-like genes in the late phase of M1 macrophage polarization (Zhang et al., 2019). Importantly, Stone et al. (Stone et al., 2019) demonstrated that secreted lactate by CC cells contributes to the expression of characteristics present in M2 macrophages. These studies demonstrate the underlying significance of lactylation in macrophage polarization. However, whether lactate-mediated histone lactylation is involved in CC progression via modulating macrophage polarization remains unclear.

Histone lactylation in CC progression was explored to reveal the molecular mechanism of lactylation regulating macrophage polarization. Our results suggested dynamic changes of histone lactylation and emphasized the significance of histone lactylation-driven GPD2-mediated macrophage polarization. This study provides a novel insight into lactylation in CC and a therapeutic target for patients with CC.

Methods

Collection of clinical CC samples

We collected seven normal cervical epithelium (NCE) tissues, seven low-grade squamous intraepithelial lesion (LSIL) tissues, eight high-grade squamous intraepithelial lesion (HSIL) tissues, and six cervical squamous cell carcinoma (CESC) tissues from patients who visited the First Affiliated Hospital of Jinan University. Subjects’ characteristics are shown in Supplementary Table S1. This study complied with all the relevant ethical regulations, and the protocols were approved by the Scientific Research Ethics Committee of the First Affiliated Hospital of Jinan University (approval number: KY-2024-030). All patients had informed consent and signed the informed consent form.

Reverse transcription-quantitative polymerase chain reaction

Total RNA was extracted from tissues and cells using TRIzol LS reagent (10296028CN, Invitrogen). RNA was subsequently reverse-transcribed to complementary DNA using a RevertAid First Strand cDNA Synthesis Kit (K1622, Thermo) according to the manufacturer’s instructions. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was carried out using FastStart SYBR Green Mix (4673484001, Roche), and the analysis was performed on an ABI Q6 real-time PCR system (Applied Biosystems Inc.). The relative expression levels of genes were standardized as those of the housekeeping gene actin or glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The RT-qPCR primers are shown in Table 1.

Table 1.

RT-qPCR Primers

Name	Primers (5′ to 3′)
HK2-F	TTGACCAGGAGATTGACATGGG
HK2-R	CAACCGCATCAGGACCTCA
PKM2-F	TTTGCTAGTGAGGCCAAGGA
PKM2-R	TCCAGGAATGTGTCAGCCAT
LDHA-F	TAATGAAGGACTTGGCAGATGAAC
LDHA-R	TTTGGTGTTCTAAGGAAAAGGCT
LDHB-F	CCTCAGATCGTCAAGTACAGTCC
LDHB-R	ATCACGCGGTGTTTGGGTAAT
IDH1-F	CCAAGTGACGGAACCCAAAA
IDH1-R	CCAACCCTTAGACAGAGCCA
SDHB-F	TGCAGTCCATAGAAGAGCGT
SDHB-R	TTTGTCTCCGTTCCACCAGT
Actin-F	AGCACAGAGCCTCGCCTTTG
Actin-R	CTTCTGACCCATGCCCACCA
GAPDH-F	ACAACTTTGGTATCGTGGAAGG
GAPDH-R	GCCATCACGCCACAGTTTC
CD206-F	AGGGATCGGGTTTATGGAGC
CD206-R	GAACGGGAATGCACAGGTTG
iNOS-F	AGGGACAAGCCTACCCCTC
iNOS-R	CTCATCTCCCGTCAGTTGGT
Arg-1-F	TGGACAGACTAGGAATTGGCA
Arg-1-R	CCAGTCCGTCAACATCAAAACT
CD86-F	CTGCTCATCTATACACGGTTACC
CD86-R	GGAAACGTCGTACAGTTCTGTG
SPP1#1-F	GGTCACTGATTTTCCCACGG
SPP1#1-R	ACCTCGGCCATCATATGTGT
SPP1#2-F	ACAATGACAAAATGGACGTCC
SPP1#2-R	CTCCCTTGCTTCCCTCCAAT
RNF43#1-F	GAATCTCTTAGAATGTGGCCGC
RNF43#1-R	AAGTCATAGATAAGCCGAAGACA
RNF43#2-F	TGGCACACACAAACAAGATTAA
RNF43#2-R	GATATTAGCGTGCATCCAAAGG
GPD2#1-F	TATTTTCCCTTGGCACTGCAC
GPD2#1-R	CAAGAGAGTTTCGGCAAGGA
GPD2#2-F	TGATCCTGGAGAACTGTGTGT
GPD2#2-R	ACCAAAGAGCCAAAACACAGG
ITGB4#1-F	GGCACAGAGGGAGGTATGAG
ITGB4#1-R	GGACTAGAACCGAAGCCCTT
ITGB4#2-F	TGAGTGGGATTACAGGCTCC
ITGB4#2-R	AGGACTAGCTGTGGTTTGGG
ITGB4#3-F	CTTCAATGTGAGGGCAGCTC
ITGB4#3-R	ACCCATTTCTCCACCGTGAT
MAPK13#1-F	GGGGAATTGCTGCAGACAAA
MAPK13#1-R	GCCCACCCAGCTCTAAAATG
MAPK13#2-F	AGACTGATGGCGATTCC CTC
MAPK13#2-R	TGCTGTGGATGGTGAGGATT

GAPDH, glyceraldehyde 3-phosphate dehydrogenase; RT-qPCR, reverse transcription-quantitative polymerase chain reaction.

Western blot

Proteins were extracted from samples using RIPA reagent (89900, Thermo). After separation with electrophoresis gels, the protein was transferred onto polyvinylidene fluoride. Then the membranes were incubated with the anti-H3K18la (1/1000, PTM-1406RM, PTM Bio), anti-GPD2 (1/4000, 17219-1-AP, Proteintech), anti-CD86 (1/1000, PA5-88284, Invitrogen), and anti-CD206 (1/4000, 18704-1-AP, Proteintech) at 4°C overnight with anti-histone H3 (1/1000, ab8896, Abcam) and anti-GAPDH (1/10000, 60004-1-Ig, Proteintech) as the internal reference, respectively. After incubation with the corresponding secondary antibodies HRP-conjugated goat anti-rabbit IgG (1/5000, SA00001-2, Proteintech) or HRP-conjugated Goat Anti-mouse IgG (1/5000, SA00001-1, Proteintech) for 1 h at ambient temperature, an ECL Substrate Kit (Thermo) was applied to visualize the target protein bands.

Immunofluorescence

Clinical CC tissues were embedded in paraffin, and cells were fixed with methanol for 30 min, followed by sealing with the 3% BSA for 30 min. Primary antibodies anti-CD86 (1/200, PA5-88284, Invitrogen), anti-CD206 (1/200, 18704-1-AP, Proteintech; or 1/500, PA5-101657, Invitrogen), and anti-H3K18la (1/100, PTM-1406RM, PTM Bio) were used to identify macrophages and H3K18la protein in CC samples. The primary antibodies were incubated overnight at 4°C, whereas the secondary antibodies (1/200, ab150077, Abcam; 1/200, GB21303, Servicebio; 1/200, GB22403, Servicebio) were incubated at ambient temperature for 1 h in a dark room. The 4′,6-diamidino-2-phenylindole (DAPI, C1006, Beyotime) was used to stain nuclei. Images were observed using a fluorescence microscope (Nikon Eclipse C1).

Cells were first washed three times with PBS. Then, the cells were sequentially treated with precooled methanol and 3% BSA. The primary antibodies anti-CD86 (1/500, PA5-88284, Invitrogen) and anti-CD206 (1/500, PA5-101657, Invitrogen) were used to incubate cells overnight at 4°C, followed by incubation with the secondary antibody goat antirabbit IgG H&L (Alexa Fluor® 488, 1/200, ab150077, Abcam) for 1 h at room temperature. The cell nuclei were stained by DAPI. The fluorescence microscope (Nikon Eclipse C1) was used to observe the fluorescent images.

Cell culture and treatment

SiHa cells (iCell-h213, iCell Bioscience) and THP-1 cells (iCell-h188, iCell Bioscience) were purchased from iCell Bioscience and were cultured in RPMI 1640 medium containing 10% fetal bovine serum and penicillin/streptomycin. All cells were maintained in a humidified atmosphere containing 5% CO₂ at 37°C. THP-1 cells were differentiated into macrophages by incubation with 100 nmol/L phorbol-12-myristate-13-acetate (P8139, Sigma) for 48 h. Then, a conditioned medium (CM) isolated from SiHa cells was used to incubate macrophages for 24 h. The fresh CM is considered as the negative control (NC).

According to the previous study (Stone et al., 2019), SiHa cells were first treated with oxamate (S6871, Selleck) and fresh medium for 24 h, respectively. Then, the CM of SiHa cells and oxamate-treated SiHa cells were mixed in a 1:1 volume ratio and incubated with macrophages for 24 h. Similarly, macrophages were treated with the CM of SiHa cells in the presence or absence of MCT1 inhibitor SR13800 (5.09663, Merck) for 24 h, as revealed in the previous study (Song et al., 2018).

Plasmid construction and cell transfection

For knockdown of GPD2, specific small interference RNAs were synthesized by Generay (Shanghai) using primers (Table 2) and were transfected into macrophages with Lipofectamine™ 2000 (11668019, Invitrogen) at a final concentration of 50 nM.

Table 2.

siRNA Sequences

Name	Primers (5′ to 3′)
GPD2-siRNA1-F	UGGCACUACUGAUACUCCAACUGAU
GPD2-siRNA1-R	AUCAGUUGGAGUAUCAGUAGUGCCA
GPD2-siRNA2-F	CCACACUCUACAUUAGGCUUGUGCA
GPD2-siRNA2-R	UGCACAAGCCUAAUGUAGAGUGUGG
GPD2-siRNA3-F	CAGCGUGUAUUAGAGAGUAUCAAUG
GPD2-siRNA3-R	CAUUGAUACUCUCUAAUACACGCUG
GPD2-siRNA-NC-F	UUCUCCGAACGUGUCACGUTT
GPD2-siRNA-NC-R	ACGUGACACGUUCGGAGAATT

Chromatin immunoprecipitation (ChIP)

One chromatin immunoprecipitation (ChIP) sample per group was performed for ChIP assay according to the manufacturer’s instruction of Magnetic ChIP Kit (17-10086, Millipore). Cell lysis was collected and was sonicated to get soluble sheared DNA (average DNA length of 100–400 bp). Then, 100 μL of DNA was mixed with 400 μL of dilution buffer, and 10 μL of samples was saved as input. A total of 1 μg anti-H3K18la antibody (PTM-1406RM, PTM Bio) was used for immunoprecipitation reactions for 2 h, and 5 μg of rabbit anti-IgG was served as the NC. Subsequently, 20 μL of protein A/G beads were subsequently added, and the samples were further incubated at 4°C overnight. DNA was eluted and harvested. After DNA purification, immunoprecipitated DNA was quantified by qPCR using primers (Table 1).

ChIP sequencing (ChIP-seq)

Immunoprecipitated DNA was sequenced on Illumina. MACS2 software (version 2.2.7.1) was used to call peaks. MEME software (https://meme-suite.org/meme/tools/meme, version 1.2.2) was performed to analyze the motif. MAnorm2 software was used to annotate the differential peaks. Enrichment analysis was performed using the Gene Ontology (GO) Resource (http://geneontology.org/) and Kyoto Encyclopedia of Genes and Genomes (KEGG, http://geneontology.org/) databases.

Statistical analysis

All experiments were independently performed at least three times. Differences were assessed using Student’s t-test (two groups) or one-way ANOVA (more than two groups). Statistical significance was set at p < 0.05.

Results

Histone lactylation level and M2 macrophage infiltration were increased during malignant transformation of CC

We first collected NCE, LSIL, HSIL, and CESC samples from participants for experiments. As depicted in Figure 1A, the expression levels of glycolysis-related genes, including hexokinase 2 (HK2), pyruvate kinase 2 (PKM2), lactate dehydrogenase A (LDHA), lactate dehydrogenase B (LDHAB), and tricarboxylic acid cycle (TAC)-related genes, including isocitrate dehydrogenase 1 (IDH1), and succinate dehydrogenase complex iron sulfur subunit B (SDHB) in NCE, LSIL, HSIL, and CESC samples were revealed. Notably, the expressions of HK2, LDHA, LDHB, and SDHB in CESC samples were significantly higher than those in LSIL and HSIL samples (Fig. 1A), suggesting an enhanced glycolysis in the histopathological grade of cervical tissues. Glycolysis can cause abundant lactate accumulation. To elucidate the impact of lactate on histone lactylation, we assessed H3K18la level in different stages of CC progression, revealing a progressive increase from NCE samples to LSIL, HSIL, and CESC samples (Fig. 1B). These results indicated that glycolysis and histone lactylation were enhanced in CC progression. M1 macrophage polarization can be regulated by histone lactylation (Zhang et al., 2019). To explore the association between histone lactylation and macrophages in CC, immunofluorescence was performed to evaluate the localization of H3K18la and the macrophages in CC samples. As expected, there was a co-localization of H3K18la with macrophages (Fig. 1C). Notably, we found that the infiltration level of M1 (CD86) macrophages was decreased during the transition from NCE, precancerous lesions to CC, which was in contrast with the M2 (CD206) macrophage (Fig. 1C), suggesting that histone lactylation might be related to macrophage polarization in CC.

FIG. 1.

Histone lactylation level and M2 macrophage infiltration were increased in CC progression. (A) The expression levels of glycolysis-related genes (HK2, PKM2, LDHA, and LDHB) and tricarboxylic acid cycle-related genes (IDH1 and SDHB) were assayed in NCE, LSIL, HSIL, and CESC cervical tissue samples using RT-qPCR, respectively. (B) Immunoblotting was used to assess H3K18la level in NCE, LSIL, HSIL, and CESC samples. Histone-H3 is used as loading control. The graph on the bottom is a statistical plot of the Western blot. (C) Detection of H3K18la, M1 macrophages (CD86), and M2 macrophages (CD206) by immunofluorescence in NCE, LSIL, HSIL, and CESC samples. Data were analyzed using a one-way ANOVA with Tukey’s multiple comparisons test (***p < 0.001; **p < 0.01; *p < 0.05). ANOVA, analysis of variance; CC, cervical cancer; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; NCE, normal cervical epithelium; LSIL, low-grade squamous intraepithelial lesion; HSIL, high-grade squamous intraepithelial lesion; CESC, cervical squamous cell carcinoma.

Lactate generated by CC cells elevated histone lactylation in macrophages and promoted M2 macrophage polarization

Lactate produced by tumor is involved in cellular processes including macrophage polarization (Chen et al., 2022, Chen et al., 2017). To explore the effect of lactate produced by CC cells on macrophages, we collected SiHa cell-derived CM (SiHa-CM) to incubate macrophages induced by THP-1 cells and observed a significant increase of lactate in the macrophages compared with the control (Fig. 2A). Correspondingly, H3K18la level was also elevated in macrophages after incubation with SiHa-CM (Fig. 2B). Oxamate, a lactate dehydrogenase inhibitor, can inhibit lactate production in tumor cells (Stone et al., 2019). SR13800 is an MCT1 inhibitor that can inhibit the transport of lactate by macrophages (Khan et al., 2020). To demonstrate that the lactate and H3K18la levels within macrophages are indeed regulated by the lactate secreted by SiHa cells, we used oxamate and SR13800 to treat SiHa cells and macrophages, respectively, before the cell co-incubation. We observed that oxamate or MCT1 inhibitor treatment significantly suppressed the lactate levels in macrophages, as well as their histone lactylation levels, suggesting that lactate produced by SiHa cells is transported into macrophages, thereby regulating intracellular histone lactylation modifications. Subsequently, we detected the impact of lactate generated by SiHa cells on macrophage polarization. The expression levels of M1-like genes (CD86 and iNOS) were found a depression in the Macro + SiHa-CM group compared with the Macro + NC group, which was the opposite of the results in M2 (CD206 and Arg-1) macrophages (Fig. 2C). The images of immunofluorescence also showed an increase of M2 macrophages by the co-incubation of macrophages with SiHa-CM compared with the control (Fig. 2D and 2E). However, these changes were reversed after treatment with oxamate and SR13800. Collectively, lactate produced by CC cells promoted histone lactylation and M2 polarization in macrophages.

FIG. 2.

Lactate generated by CC cells elevated histone lactylation level in macrophages and promoted M2 macrophage polarization. (A) SiHa cells were first treated with oxamate for 24 h. Then, oxamate-treated SiHa cell-derived CM was used to incubate macrophages for 24 h. CM of SiHa cells in the presence or absence of MCT1 inhibitor SR13800 was used to treat macrophages for 24 h. Lactate concentrations within macrophages were determined using lactate assay kit. (B) Western blot was used to analyze the expression of H3K18la and evaluate histone lactylation level in macrophages following incubation with SiHa-CM. (C) RT-qPCR revealed the relative RNA expression of M1 markers (CD86 and iNOS) and M2 markers (CD206 and Arg-1) in macrophages after incubation with SiHa-CM. (D and E) Representative images demonstrated the presence of M1 and M2 macrophage phenotypes after treatment with oxamate (D) and SR13800 (E). Statistical significances were assessed using a Student’s t-test (****p < 0.0001; ***p < 0.001; **p < 0.01; *p < 0.05; ns, no significance). Macro+SiHa-CMOxa: oxamate-treated SiHa-CM incubates with macrophages. Macro+SiHa-CMSR: SR13800-treated macrophages incubate with SiHa-CM. CC, cervical cancer. CM, conditioned medium. RT-qPCR, reverse transcription-quantitative polymerase chain reaction.

Histone lactylation was dynamically changed in CC progression

To further understand the regulatory roles of histone lactylation in CC progression, H3K18la ChIP-seq was performed in cervical tissues of NCE, HSIL, and CESC. As depicted in Figure 3A, distal intergenic sites were the preference for histone lactylation in NCE and HSIL patients. However, the histone lactylation in CESC patients frequently occurred on the promoter sites, and these binding sites were mostly <1 kb (Fig. 3A). The motif sites were indeed differential in the three samples (Fig. 3B). Subsequently, we compared the differential peaks between samples and performed the enrichment analysis. We totally obtained 4170 hypermodified peaks and 2026 hypomodified peaks between HSIL and NCE samples, 263 hypermodified peaks and 27 hypomodified peaks between CESC and NCE samples, and 6333 hypermodified peaks and 2934 hypomodified peaks between CESC and HSIL samples. Circos plot revealed the alteration of H3K18la-binded peaks across the chromatin in the comparison of HSIL vs. NCE, CESC vs. NCE, and CESC vs. HSIL (Fig. 3C). Compared with the NCE samples, the hypermodified peaks in HSIL samples were linked to cell junction-related GO terms (Fig. 3D), and the hypermodified peaks in CESC samples were involved in ERBB signaling pathway and negative regulation of phosphatidylinositol 3-kinase activity (Fig. 3E). Moreover, hypermodified peaks in the comparison of CESC vs. HSIL enriched GO terms of small GTPase-mediated signal transduction, organophosphate ester transport, and positive regulation of kinase activity (Fig. 3F). Taken together, these results indicated dynamical changes of sites and pathways regulated by histone lactylation in CC progression.

FIG. 3.

Histone lactylation was dynamically changed in CC progression. (A) One sample per group was collected for ChIP-seq. Genome-wide distributions of H3K18la binding in NCE, HSIL, and CESC samples were depicted by pie chart. (B) Motifs of H3K18la binding in NCE, HSIL, and CESC samples. (C) Distribution of peaks over the human genome in the comparison of HSIL vs. NCE, CESC vs. NCE, and CESC vs. HSIL. (D), (E), and (F) illustrated the GO enrichment analysis of differential peaks in HSIL vs. NCE, CESC vs. NCE, and CESC vs. HSIL, respectively. The redder the entries, the more significant the GO terms, and the bluer the entries, the less significant the differences. CC, cervical cancer; CESC, cervical squamous cell carcinoma; ChIP, chromatin immunoprecipitation; GO, Gene Ontology; HSIL, high-grade squamous intraepithelial lesion; NCE, normal cervical epithelium.

Histone lactylation-mediated lipid metabolism and immune dysregulation during the CC progression

Next, we intersected the differential peaks and differentially expressed genes (DEGs) contained in the differential peaks between HSIL vs. NCE and CESC vs. HSIL to explore the similarities and differences in different statuses of CC progression. The comparison of HSIL vs. NCE and CESC vs. HSIL shared 308 upregulated DEGs and 132 downregulated DEGs (Fig. 4A). These shared upregulated DEGs were enriched in lipid metabolic pathways, such as glycerophospholipid metabolism, cholesterol metabolism, sphingolipid signaling pathway, and phospholipase D signaling pathway (Fig. 4B). The downregulated DEGs were associated with immune response, including Th1 and Th2 cell differentiation, IL-17 signaling pathway, and Th17 cell differentiation (Fig. 4C). Above findings indicated that lipid metabolism and immune response in CC progression were enhanced and depressed, respectively. Subsequently, enrichment analysis was performed for the unique DEGs in HSIL vs. NCE and CESC vs. HSIL. The unique upregulated DEGs in HSIL vs. NCE were involved in cancer-related biological pathways, such as ECM–receptor interaction, Rap1 signaling pathway, and Wnt signaling pathway (Fig. 4D). These results revealed that histone lactylation-mediated pathway activities in different status of CC progression were distinctive.

FIG. 4.

Histone lactylation-mediated pathway activities were distinctive in different statuses of CC progression. (A) Venn diagram illustrated the overlapping ChIP-seq peaks between CESC vs. NCE and HSIL vs. NCE. The top Venn diagram was the intersection of upregulated DEGs, and the bottom Venn diagram was the intersection of downregulated DEGs. (B–D) B and C depicted KEGG enrichment analysis of common upregulated and downregulated DEGs between CESC vs. NCE and HSIL vs. NCE, respectively. D illustrated KEGG enrichment pathways of unique upregulated DEGs in HSIL vs. NCE compared with CESC vs. NCE. The redder the entries, the more significant the GO terms, and the bluer the entries, the less significant the differences. CC, cervical cancer; CESC, cervical squamous cell carcinoma; ChIP, chromatin immunoprecipitation; DEG, differentially expressed gene; GO, Gene Ontology; HSIL, high-grade squamous intraepithelial lesion; NCE, normal cervical epithelium.

Lactate secreted by CC cells boosted histone lactylation on GPD2 in macrophages

To dig the vital pathways and genes regulated by histone lactylation in different statuses of CC progression, the upregulated DGEs-involved pathways in HSIL vs. NCE and CESC vs. HSIL were overlapped. A total of 18 upregulated pathways were shared between HSIL vs. NCE and CESC vs. HSIL (Fig. 5A). Considering the involvement of lipid metabolic pathways and cancer-related biological pathways in CC progression, we selected glycerophospholipid metabolism, Rap1 signaling pathway, PI3K-Akt signaling pathway, and Wnt signaling pathway for further investigation (Fig. 5A). From the five pathways, we identified DEGs that appeared in both comparisons of HSIL vs. NCE and CESC vs. HSIL, including GPD2 in glycerophospholipid metabolism, MAPK3 in Rap1 signaling pathway, ITGB4 and SPP1 in PI3K-Akt signaling pathway, and RNF43 in Wnt signaling pathway (Fig. 5A). Then, ChIP tracks of the five DEGs were analyzed using IGV genome browser, which captured their different histone lactylation signals in NCE, HSIL, and CESC samples (Fig. 5B). We used GEPIA2 database to assess the expression of GPD2, RNF43, ITGB4, SPP1, and MAPK13 in CESC and found that the five DEGs exhibited significant upregulations in CESC samples compared with normal samples (Fig. 5C). Given the underlying roles of histone lactylation in macrophage polarization, we performed ChIP coupled with qPCR (ChIP-qPCR) analysis using an anti-H3K18la antibody for GPD2, RNF43, ITGB4, SPP1, and MAPK13 in macrophages (Fig. 5D–5H). As shown in Figure 5F, the H3K18la level on GPD2#1 (differential site 1 in GPD2) in macrophages was significantly boosted following co-incubation with SiHa-CM. Collectively, lactate produced by CC cells might promote histone lactylation on GPD2 to regulate macrophages.

FIG. 5.

Lactate secreted by CC cells boosted GPD2 expression in macrophages. (A) Upregulated KEGG pathways in CESC vs. NCE and HSIL vs. NCE were overlapped. Their shared enriched pathways included glycerophospholipid metabolism, Rap1 signaling pathway, PI3K-Akt signaling pathway, and Wnt signaling pathway. (B) IGV tracks for MAPK13, ITGB4, GPD2, RNF43, and SPP1 in NCE, HSIL, and CESC samples. (C) The expression levels of MAPK13, ITGB4, GPD2, RNF43, and SPP1 in CESC and normal samples were assessed using GEPIA2 database. ChIP-qPCR assays of H3K18la status in ITGB4 (D), MAPK13 (E), GPD2 (F), RNF43 (G), and SPP1 (H) in macrophages were presented after co-incubation with SiHa-CM (#1, first differential site; #2, second differential site; #3, third differential site). Statistical significances were assessed using a Student’s t-test (***p < 0.001; **p < 0.01; *p < 0.05; ns, no significance). CC, cervical cancer; CM, conditioned medium; CESC, cervical squamous cell carcinoma; GO, Gene Ontology; HSIL, high-grade squamous intraepithelial lesion; NCE, normal cervical epithelium.

Histone lactylation-driven GPD2 promoted M2 macrophage polarization

GPD2, an enzyme encoded by the GPD2 gene, is a component of the glycerol phosphate shuttle and boosts glucose oxidation (Oh et al., 2023). Previous study reported that GPD2 can regulate glucose oxidation to drive inflammatory responses in macrophages (Langston et al., 2019). In order to determine whether lactate secreted by CC cells could drive GPD2 to modulate macrophage polarization, we used SiHa-CM to incubate macrophage with GPD2 knockdown (Fig. 6A and 6B). As expected, GPD2 knockdown in macrophage reversed the result of lactate produced by SiHa cells downregulating M1 markers and upregulating the M2 markers (Fig. 6C–6E). Taken together, these results verified that lactylation-driven GPD2 facilitated M2 macrophage polarization.

FIG. 6.

Histone lactylation-driven GPD2 was involved in macrophage M2 polarization. (A) The mRNA level of GPD2 was detected by RT-qPCR after the knockdown of GPD2. (B) Protein expression in macrophages with knockdown of GPD2 was assessed using Western blot. GAPDH was used as the loading control. (C) The mRNA expression of M1 markers and M2 markers in normal or GPD2-knocked down macrophages after incubation with SiHa-CM. (D) The effect of GPD2 knockdown on macrophage polarization. GAPDH was used as the loading control. (E) Representative images of anti-CD86 and anti-CD206 immunofluorescence staining in normal or GPD2-knocked down macrophages after incubation with SiHa-CM. Statistical significances were assessed using a Student’s t-test or one-way ANOVA (***p < 0.001; **p < 0.01; *p < 0.05; ns, no significance). ANOVA, analysis of variance; CM, conditioned medium; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; RT-qPCR, reverse transcription-quantitative polymerase chain reaction.

Discussion

CC is the fourth most frequently diagnosed cancer and the fourth leading cause of cancer death in women (Guo et al., 2023). Growing evidence has shown that glycolysis plays a crucial role in CC, and lactate has been proven to regulate CC progression by histone lactylation (Meng et al., 2024). This study not only revealed the dynamic changes of histone lactylation in CC progression but also demonstrated a novel molecular mechanism of histone lactylation regulating macrophage polarization in CC. As depicted in Figure 7, lactate generated by CC cells enters macrophages via the MCT1 transporter and greatly stimulates histone lactylation, which further promotes macrophage M2-like phenotype. Mechanically, histone lactylation results in inducing transcriptional activation of the GPD2 gene, thereby facilitating the expression levels of M2 macrophage markers. This study suggests novel perspectives for CC prevention and treatment.

FIG. 7.

Histone lactylation-dirven GPD2 promotes M2 macrophage polarization. Lactate produced by CC cells enters macrophages and greatly stimulates histone lactylation, which further promotes the transcription and expression of GPD2, thereby promoting the expression of M2-like genes (CD206 and Arg-1) and downregulating expression of M1-like genes (CD86 and iNOS) in macrophages. CC, cervical cancer.

During the process of transition of NCE into CESC, glycolysis showed a gradual increase. Hypoxia can drive a tumor toward a more aggressive malignant phenotype and promotes glycolysis of tumor cells (Su et al., 2023). Glycolysis is associated with CC progression. For example, glucose transporter 1 is a high-affinity glucose transporter that regulates glucose uptake, and expression of glucose transporter 1 is progressively augmented from normal cervical tissue to intraepithelial neoplasia, then to CC (Cheng et al., 2013). Similarly, transketolase-like enzyme 1 and p-Akt, key factors in glucose metabolism, show significant increases in the histopathological grade of cervical tissues (Kohrenhagen et al., 2008). In this study, several glycolysis-related genes were progressively elevated in the process of transition of NCE into CESC. The expressions of HK2, LDHA, and LDHB in CESC samples were significantly higher than in LSIL and HSIL samples, suggesting the association of enhanced glycolysis with malignant transformation. In addition, lactate accumulation produced by glycolysis further mediated polarization phenotype of macrophages through epigenetic modifications, thereby affecting CC progression.

Different statuses of CC progression exhibited similar pathway activities under the histone lactylation, such as activation of lipid metabolic pathways in NCE, HSIL, and CESC samples. Recent evidence suggests that lipid metabolic pathways are closely related to the malignant progression of CC. Lipid reprogramming not only promotes the growth and progression of CC cells but also contributes to lymph node metastasis (Du et al., 2022a, Zhang et al., 2020). Previous studies have verified that histone lactylation mediates the regulation of lipid metabolism (Chen et al., 2023, Gao et al., 2023). In the CC progression, histone lactylation level was elevated, and lipid metabolic pathways were stimulated. We speculate that histone lactylation might promote CC development via lipid metabolism.

Interestingly, we identified a shared upregulated DEG in both comparisons of HSIL vs. NCE and CESC vs. HSIL, GPD2, which was involved in glycerophospholipid metabolism. GPD2 is responsible for the glycerol-phosphate shuttle (Mikeli et al., 2023) and converts glycerol 3-phosphate to DHAP within the mitochondrial membrane, thereby regenerating FADH₂ from FAD (Oh et al., 2024, Yao et al., 2023). Langston et.al suggest that GPD2 in macrophages regulates glucose oxidation to drive inflammatory responses (Langston et al., 2019), and our study revealed that GPD2-mediated M2 macrophage polarization. However, the molecular mechanism of histone lactylation for GPD2 transcriptional regulation requires further exploration.

Although vaccination and screening programs have been organized to decrease the CC incidence (Sahasrabuddhe, 2024, Voelker, 2023), preventing the malignant progression of CC remains a significant challenge. Thus, early detection and treatment of precancerous lesions are crucial approaches to prevent progression to CC. Macrophages play a vital role in the process of precancerous lesions. They can exert proinflammatory effects to inhibit the growth of tumor cells, as well as immunosuppressive effects to promote carcinogenesis. Currently, targeting tumor-associated macrophage has shown promising efficacy in the therapy of CC (Luo et al., 2023, Wang et al., 2024). Our study not only uncovers the molecular mechanisms of macrophage M2 polarization induced by cancer cell-derived lactate but also suggests that promoting macrophage M1 polarization or inhibiting its M2 phenotype may develope a novel therapeutic strategies for intervening in precancerous lesions of cervical tissue or preventing the malignant progression of CC.

Conclusion

This study reveals an increase of histone lactylation and M2 macrophage abundance during the malignant transformation of CC and confirms that histone lactylation-mediated pathway activities are distinctive in different statuses of CC progression. Histone lactylation is involved in the regulation of GPD2, which can further modulate M2 macrophage polarization in CC. These findings provide novel targets for the precise treatment of patients with CC.

Footnotes

Authors’ Contributions

C.H. was responsible for overall data analysis and wrote the article. L.X. and X.L. were responsible for the statistical analysis and correction of each data. C.H., Y.S., and X.W. were responsible for the study design and revised the article. All the authors read and approved the final form of the article.

Availability of Data and Materials

The dataset generated during and/or analyzed during the current study are available from NCBI, and its accession number is PRJNA1114915.

Ethics Approval

This study is approved by the Scientific Research Ethics Committee of the First Affiliated Hospital of Jinan University (approval number: KY-2024-030).

Consent to Participate

Informed consent was obtained from all individual participants included in the study.

Author Disclosure Statement

The authors have no relevant financial or nonfinancial interests to disclose.

Funding Information

The authors declare that no funds, grants, or other support were received during the preparation of this article.

Supplementary Material

Supplementary Table S1

References

Chen

, Huang

, Gu

, et al. Lactate-lactylation hands between metabolic reprogramming and immunosuppression. Int J Mol Sci, 2022; 23(19); doi: 10.3390/ijms231911943

Chen

, Huang

, Zhang

, et al. High-intensity interval training induces lactylation of fatty acid synthase to inhibit lipid synthesis. BMC Biol, 2023; 21(1):196; doi: 10.1186/s12915-023-01698-9

Chen

, Zuo

, Xiong

, et al. Gpr132 sensing of lactate mediates tumor-macrophage interplay to promote breast cancer metastasis. Proc Natl Acad Sci U S A, 2017; 114(3):580–585; doi: 10.1073/pnas.1614035114

Cheng

, Chen

, Hong

, et al. How does hypoxia inducible factor-1alpha participate in enhancing the glycolysis activity in cervical cancer? Ann Diagn Pathol, 2013; 17(3):305–311; doi: 10.1016/j.anndiagpath.2012.12.002

Colbert

, El Alam

, Wang

, et al. Tumor-resident Lactobacillus iners confer chemoradiation resistance through lactate-induced metabolic rewiring. Cancer Cell, 2023; 41(11):1945–1962.e1911; doi: 10.1016/j.ccell.2023.09.012

Colegio

, Chu

, Szabo

, et al. Functional polarization of tumour-associated macrophages by tumour-derived lactic acid. Nature, 2014; 513(7519):559–563; doi: 10.1038/nature13490

Cortes-Morales

, Chavez-Sanchez

, Rocha-Zavaleta

, et al. Mesenchymal stem/stromal cells derived from cervical cancer promote M2 macrophage polarization. Cells, 2023; 12(7); doi: 10.3390/cells12071047

Cui

, Xie

, Banerjee

, et al. Lung myofibroblasts promote macrophage profibrotic activity through lactate-induced histone lactylation. Am J Respir Cell Mol Biol, 2021; 64(1):115–125; doi: 10.1165/rcmb.2020-0360OC

, Liu

, Zhang

, et al. FASN promotes lymph node metastasis in cervical cancer via cholesterol reprogramming and lymphangiogenesis. Cell Death Dis, 2022a;13(5):488; doi: 10.1038/s41419-022-04926-2

10.

, Qian

, Tan

, et al. Tumor cell-derived exosomes deliver TIE2 protein to macrophages to promote angiogenesis in cervical cancer. Cancer Lett, 2022b;529:168–179; doi: 10.1016/j.canlet.2022.01.005

11.

Gao

, Li

, Xu

, et al. Mitochondrial pyruvate carrier 1 regulates fatty acid synthase lactylation and mediates treatment of nonalcoholic fatty liver disease. Hepatology, 2023; 78(6):1800–1815; doi: 10.1097/HEP.0000000000000279

12.

Guo

, Qu

, Tang

, et al. Spatiotemporally deciphering the mysterious mechanism of persistent HPV-induced malignant transition and immune remodelling from HPV-infected normal cervix, precancer to cervical cancer: Integrating single-cell RNA-sequencing and spatial transcriptome. Clin Transl Med, 2023; 13(3):e1219; doi: 10.1002/ctm2.1219

13.

Khan

, Valli

, Lam

, et al. Targeting metabolic activity in high-risk neuroblastoma through monocarboxylate transporter 1 (MCT1) inhibition. Oncogene, 2020; 39(17):3555–3570; doi: 10.1038/s41388-020-1235-2

14.

Kohrenhagen

, Voelker

, Schmidt

, et al. Expression of transketolase-like 1 (TKTL1) and p-akt correlates with the progression of cervical neoplasia. J Obstet Gynaecol Res, 2008; 34(3):293–300; doi: 10.1111/j.1447-0756.2008.00749.x

15.

Langston

, Nambu

, Jung

, et al. Glycerol phosphate shuttle enzyme GPD2 regulates macrophage inflammatory responses. Nat Immunol, 2019; 20(9):1186–1195; doi: 10.1038/s41590-019-0453-7

16.

, Huang

, Wei

, et al. Overexpression of SOCS2 inhibits EMT and M2 macrophage polarization in cervical cancer via IL-6/JAK2/STAT3 pathway. Comb Chem High Throughput Screen, 2024; 27(7):984–995; doi: 10.2174/1386207326666230818092532

17.

, Sui

. Metabolic reprogramming in cervical cancer and metabolomics perspectives. Nutr Metab (Lond), 2021; 18(1):93; doi: 10.1186/s12986-021-00615-7

18.

Liu

, Du

, Xiao

, et al. Activation of FGD5-AS1 promotes progression of cervical cancer through regulating BST2 to inhibit macrophage M1 polarization. J Immunol Res, 2021; 2021:5857214; doi: 10.1155/2021/5857214

19.

Liu

, Li

, Huang

, et al. Single-cell RNA-sequencing reveals radiochemotherapy-induced innate immune activation and MHC-II upregulation in cervical cancer. Signal Transduct Target Ther, 2023; 8(1):44; doi: 10.1038/s41392-022-01264-9

20.

Luo

, Chen

, Jin

, et al. The suppression of cervical cancer ferroptosis by macrophages: The attenuation of ALOX15 in cancer cells by macrophages-derived exosomes. Acta Pharm Sin B, 2023; 13(6):2645–2662; doi: 10.1016/j.apsb.2023.03.025

21.

Meng

, Sun

, Zhang

, et al. Lactylation stabilizes DCBLD1 activating the pentose phosphate pathway to promote cervical cancer progression. J Exp Clin Cancer Res, 2024; 43(1):36; doi: 10.1186/s13046-024-02943-x

22.

Mikeli

, Fujikawa

, Tanabe

. GPD2: The relationship with cancer and neural stemness. Cells Dev, 2023; 173:203824; doi: 10.1016/j.cdev.2022.203824

23.

, Jo

, Bajzikova

, et al. Non-bioenergetic roles of mitochondrial GPD2 promote tumor progression. Theranostics, 2023; 13(2):438–457; doi: 10.7150/thno.75973

24.

, Mai

, Kim

, et al. Glycerol 3-phosphate dehydrogenases (1 and 2) in cancer and other diseases. Exp Mol Med, 2024; 56(5):1066–1079; doi: 10.1038/s12276-024-01222-1

25.

Ren

, Li

, Yu

, et al. Extracellular vesicles mediated proinflammatory macrophage phenotype induced by radiotherapy in cervical cancer. BMC Cancer, 2022; 22(1):88; doi: 10.1186/s12885-022-09194-z

26.

Sahasrabuddhe

. Cervical cancer: Precursors and prevention. Hematol Oncol Clin North Am, 2024; 38(4):771–781; doi: 10.1016/j.hoc.2024.03.005

27.

Song

, Lee

, Park

, et al. Lactic acid upregulates VEGF expression in macrophages and facilitates choroidal neovascularization. Invest Ophthalmol Vis Sci, 2018; 59(8):3747–3754; doi: 10.1167/iovs.18-23892

28.

Stone

, Rossetti

RAM

, Alvarez

KLF

, et al. Lactate secreted by cervical cancer cells modulates macrophage phenotype. J Leukoc Biol, 2019; 105(5):1041–1054; doi: 10.1002/JLB.3A0718-274RR

29.

, Shan

, Gao

, et al. 2-Deoxy-D-glucose simultaneously targets glycolysis and wnt/beta-catenin signaling to inhibit cervical cancer progression. IUBMB Life, 2023; 75(7):609–623; doi: 10.1002/iub.2706

30.

Sui

, Cui

, Shi

, et al. LRRC75A-AS1 delivered by M2 macrophage exosomes promotes cervical cancer progression via enhancing SIX1 expression. Cancer Sci, 2023; 114(6):2634–2649; doi: 10.1111/cas.15780

31.

Voelker

. Cervical cancer screening. JAMA, 2023; 330(20):2030; doi: 10.1001/jama.2023.21987

32.

Wang

, Wang

, Feng

, et al. Targeting tumor-associated macrophage-derived CD74 improves efficacy of neoadjuvant chemotherapy in combination with PD-1 blockade for cervical cancer. J Immunother Cancer, 2024; 12(8); doi: 10.1136/jitc-2024-009024

33.

Wang

, Wang

, et al. Histone lactylation boosts reparative gene activation post-myocardial infarction. Circ Res, 2022; 131(11):893–908; doi: 10.1161/CIRCRESAHA.122.320488

34.

Yao

, Park

, Kurmi

, et al. Uncoupled glycerol-3-phosphate shuttle in kidney cancer reveals that cytosolic GPD is essential to support lipid synthesis. Mol Cell, 2023; 83(8):1340–1349.e1347; doi: 10.1016/j.molcel.2023.03.023

35.

Zhang

, Liao

, Liu

, et al. FABP5 promotes lymph node metastasis in cervical cancer by reprogramming fatty acid metabolism. Theranostics, 2020; 10(15):6561–6580; doi: 10.7150/thno.44868

36.

Zhang

, Tang

, Huang

, et al. Metabolic regulation of gene expression by histone lactylation. Nature, 2019; 574(7779):575–580; doi: 10.1038/s41586-019-1678-1

37.

Zhou

, Zhou

, Gu

, et al. Vaginal microbial environment skews macrophage polarization and contributes to cervical cancer development. J Immunol Res, 2022; 2022:3525735; doi: 10.1155/2022/3525735

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.11 MB