Detection of Shiga Toxin–Producing Escherichia coli O26,O45,O103,O111,O113,O121,O145,and O157 Serogroups by Multiplex Polymerase Chain Reaction of the wzx Gene of the O-Antigen Gene Cluster

Abstract

O-antigens on the surface of Escherichia coli are important virulence factors that are targets of both the innate and adaptive immune system and play a major role in pathogenicity. O-antigens that are responsible for antigenic specificity of the strain determine the O-serogroup. E. coli O26, O45, O103, O111, O113, O121, O145, and O157 have been the most commonly identified O-serogroups associated with Shiga toxin–producing E. coli (STEC) implicated in outbreaks of human illness all over the world. A multiplex polymerase chain reaction assay was developed to simultaneously detect the eight STEC O-serogroups targeting the wzx (O-antigen-flippase) genes of all O-antigen gene clusters. The sensitivity of the multiplex polymerase chain reaction was found to be 10 colony forming units for each O-group when enriched in broth and 100 colony forming units when enriched in artificially inoculated apple juice diluted with tryptic soy broth for 16 h at 37°C. The method can be used for detecting STEC O-groups simultaneously and may be exploited for improving the safety of food products.

Introduction

S higa toxin–producing Escherichia coli (STEC) have emerged as important food-borne pathogens and pose serious public health concerns. STEC strains, including E. coli O157:H7, have been implicated in diarrhea, hemorrhagic colitis, and hemolytic uremic syndrome (Karmali, 1989). Serogroups O26, O45, O103, O111, O121, and O145 have been identified as the “big six” non-O157 STEC by the U.S. Centers for Disease Control and Prevention as causative agents in human illness (Brooks et al., 2005). Beef and dairy cattle are known reservoirs of STEC strains (Hussein, 2007) that can potentially contaminate beef carcasses during processing. The overall incidence of non-O157 STEC infections is difficult to estimate since these STEC serogroups are not routinely screened (Bettelheim, 2007). Inability to ferment sorbitol has been exploited to facilitate simple and rapid detection methodology for O157:H7. However, no analogous detection procedures are yet available for non-O157 STECs. There is a need to identify predominant STEC serogroups involved in human infections. The objective was to develop a multiplex polymerase chain reaction (m-PCR) assay to detect the eight STEC O-groups—O26, O45, O103, O111, O113, O121, O145, and O157—simultaneously in a single reaction. The method can be utilized for detecting STEC O-groups in any sample by the food industry, regulatory agencies, and researchers.

Materials and Methods

Bacterial strains

E. coli strains O26 (H311b), O45 (K42), O91 (H307b), O103 (H515b), O111 (Stoke W), O113 (6182–50), O121 (39w), O145 (E1385), and O157 (A2) (Ørskov et al., 1977), K12, and reference strains belonging to all designated O-groups were used. Bacillus cereus, Citrobacter freundii, Enterobacter cloacae, Enterococcus aerogenes, Enterococcus faecalis, Hafnia alvei, Klebsiella pneumonia, Listeria monocytogenes, Pseudomonas aeroginosa, Proteus vulgaris, Salmonella enteritidis, Serratia marcescens, Shigella boydii, Staphylococcus aureus, Vibrio cholerae, and Yersinia enterocolitica were tested.

Multiplex PCR

Genomic DNA was extracted from a bacterial colony by resuspending in 150 μL of water, boiled at 100°C for 10 min and centrifuged for 2 min at 13,000 g. DNA (1 μg) from E. coli belonging to each of the serogroups O26, O45, O103, O113, and O111; 2 μg of DNA from O121; and 4 μg from O145 and from O157 were pooled and used as the positive control. The wzx gene (O-antigen flippase) in the O-antigen gene cluster was targeted for m-PCR assay.

The primer sequences for the forward (F) and reverse (R) reactions for O-groups were as follows: O26 F, caatgggcggaaattttaga and O26 R, ataattttctctgccgtcgc; O45 F, tgcagtaacctgcacgggcg and O45 R, agcaggcacaacagccactact; O103 F, ttggagcgttaactggacct and O103 R, gctcccgagcacgtataaag; O111 F, tgtttcttcgatgttgcgag and O111 R, gcaagggacataagaagcca; O113 F, tgccataattcagagggtgac and O113 R, aacaaagctaattgtggccg; O121 F, tccaacaattggtcgtgaaa and O121 R, agaaagtgtgaaatgcccgt; O145 F, ttcattgttttgcttgctcg and O145 R, ggcaagctttggaaatgaaa; O157 F, tcgaggtacctgaatctttccttctgt and O157 R, accagtcttggtgctgctctgaca.

Primers (2 μM each) were mixed with m-PCR reaction solution provided to a final volume of 47 μL according to Qiagen's multiplex kit instructions (Qiagen, Valencia, CA). Pooled DNA (3 μL) from E. coli belonging to all O-groups (positive control) was mixed with the master mix (47 μL). PCR amplification was conducted by initial denaturation at 95°C for 15 min followed by 30 cycles of denaturation at 94°C for 30 sec, primer annealing at 57°C for 1.5 min followed by extension at 72°C for 1.5 min, and a final extension for 10 min at 72°C. The amplified DNA was electrophoresed in an agarose gel (1.5%) for 45 min at 175 V. The DNA was stained with ethidium bromide and observed under ultraviolet light. The gel images were captured electronically using a gel imaging system. E. coli K12 was used as the negative control.

Sensitivity of m-PCR

All eight E. coli O-groups were grown overnight in tryptic soy broth (TSB) at 37°C. Each of the serogroups was diluted serially and enumerated on tryptic soy agar plates and grown for 24 h at 37°C. Diluted cultures of each O-group were added to TSB medium (15 mL) and to pasteurized apple juice diluted with TSB (50:50; 15 mL). Each of these cultures was immediately divided into three parts of 5 mL each. One part was not incubated, the other was incubated for 1 h at 37°C, and the third was grown overnight at 37°C. Final concentrations of the bacteria in 5 mL were calculated to be 0, 10⁴, 10⁵, and 10⁶ colony forming units (CFU) for each O-group. The bacteria were centrifuged from each of these 5 mL samples, resuspended in 1 mL sterile water, and boiled at 100°C for 10 min, and DNA was extracted as described. DNA (1 μL) was diluted to 3 μL with water for m-PCR assays. The CFU in the PCR mix was calculated based on the DNA (1 μL) that was derived from 5 mL cells in enrichment media. The sensitivity of the assay was defined as the lowest concentration of STEC that yielded positive results reproducibly for m-PCR.

Results and Discussion

The m-PCR assay targeting the wzx gene of the O-antigen gene clusters showed amplification of all eight STEC O-groups (Fig. 1) but no signal was observed for K12. The primer pairs were designed based on similar melting temperature for all O-groups and easily distinguishable amplicon sizes. The specificity of the m-PCR was tested against all designated O-groups and other bacterial species. None of the other O-groups or bacteria exhibited any positive reaction, showing that the assay was specific for the targeted STEC O-groups.

FIG. 1.

Multiplex polymerase chain reaction (m-PCR) assay for detecting Shiga toxin–producing Escherichia coli (STEC) O-groups. Lane 1, Molecular weight markers; Lane 2, Pooled amplified DNA generated from eight STEC O-groups in one m-PCR reaction; Lane 3, Negative control strain E. coli K12; Lane 4, O26 (155 bp); Lane 5, O45 (238 bp); Lane 6, O103 (321 bp); Lane 7, O111 (438 bp); Lane 8, O113 (514 bp); Lane 9, O121 (628 bp); Lane 10, O145 (750 bp); and Lane 11, O157 (894 bp).

The specificity of the m-PCR assay was evaluated in TSB and in artificially inoculated pasteurized apple juice diluted with TSB. The m-PCR signals for all eight O-groups could be detected in samples inoculated with 10⁴ CFU in TSB and 10⁵ CFU in spiked apple juice after enrichment for 16 h at 37°C and not in samples incubated for 0 and 1 h of enrichment. Therefore, the detection level of PCR was calculated to be 10 CFU/O-group in TSB and 100 CFU/O-group for spiked apple juice. The experiment was repeated twice with same results. The m-PCR assay in conjunction with established PCR targeting shiga toxin genes (stx1 and stx2) and intimin (eae) could identify the serogroup and virulence genes in isolated colonies or enrichment media. The method is rapid, sensitive, and specific and can be used for screening STEC strains in different types of samples.

Footnotes

Disclosure Statement

No competing financial interests exist.

References

Bettelheim

. The non-O157 Shiga-toxigenic (verocytotoxigenic) Escherichia coli; under-rated pathogens. Crit Rev Microbiol, 2007; 33:67–87.

Brooks

, Sowers

, Wells

, Greene

, Griffin

, Hoekstra

, Strockbine

. Non -O157 Shiga Toxin–Producing Escherichia coli Infections in the United States, 1983–2002. J Infect Dis, 2005; 192:1422–1429.

Hussein

. Prevalence and pathogenicity of shiga toxin–producing Escherichia coli in beef cattle and their products. J Anim Sci, 2007; 85:63–72.

Karmali

. Infection by Verocytotoxin-producing Escherichia coli. Clin Microbiol Rev, 1989; 2:15–38.

Ørskov

, Ørskov

, Jann

. Serology, chemistry and genetics of O and K antigens of Escherichia coli. Bacteriol Rev, 1977; 41:667–710.