The DNA Protection During Starvation Protein (Dps) Influences Attachment of Escherichia coli to Abiotic Surfaces

Abstract

The attachment of bacterial species such as Escherichia coli to abiotic materials is of concern to the food industry. This study investigated the role of DNA protection during starvation protein (Dps) in cell surface hydrophobicity and attachment of E. coli to glass, stainless steel, and Teflon surfaces. The Dps was not found to influence hydrophobicity, but did have a putative role in attachment in a strain- and substrate-dependent manner.

Introduction

T he attachment of bacterial species such as Escherichia coli to food contact surfaces could contribute to the contamination of food products, ultimately causing foodborne disease (Goulter et al., 2009). An understanding of the mechanism of attachment may allow for the modification of cleaning practices to prevent contamination of surfaces (Goulter et al., 2009). Factors such as hydrophobicity, outer membrane proteins (OMPs), and mode of growth appear to play a role in the way in which E. coli attaches to surfaces (Kumar and Anand, 1998). The complexity of interacting factors makes it difficult to assess the effects of individual components on attachment (Goulter et al., 2009). One way to do this is to generate deletion mutants in bacteria with different genetic backgrounds and monitor their attachment behavior (Saldana et al., 2009).

Our laboratory has previously characterized the ability of E. coli to attach to glass, stainless steel (SS), and Teflon surfaces under a number of growth conditions (Goulter et al., 2010). The expression of OMPs for the same strains and under the same growth conditions has also been investigated. A cluster of proteins in the 5.8–6.7 pH range that were strongly upregulated (greater than threefold) under sessile (attached) as opposed to planktonic growth conditions were identified (Rivas et al., 2008). The study described here aimed to determine the role of the proteins contained in this cluster and their relevance to attachment of E. coli to abiotic surfaces.

The dominant protein in the cluster was identified as DNA protection during starvation protein (Dps), which has been shown to reduce acid stress of DNA in E. coli (Jeong et al., 2008). Recent studies have indicated that this cytoplasmic protein may also be present in the outer membrane of E. coli (Lacqua et al., 2006; Wu et al., 2009). In addition, Dps-like proteins have also been shown to play a role in adhesion for bacteria such as Salmonella Typhimurium (Haikarainen and Papageorgiou, 2010). The role of Dps in cell surface hydrophobicity (CSH) and attachment of E. coli to abiotic surfaces is not known. The construction of dps knockout strains in this study was used to investigate the influence of Dps on CSH and attachment to glass, SS, and Teflon surfaces.

Materials and Methods

Bacterial strains and culture conditions

Three strains were selected for this study based on their differing abilities to attach to glass, SS, and Teflon when cultured under planktonic culture in nutrient broth (NB; Oxoid) or sessile culture on nutrient agar (NA; Oxoid) (Rivas et al., 2007; Goulter et al., 2010) (Table 1). The strains were EC614, an O157:H12 strain isolated from cattle, EDL933, an O157:H7 outbreak strain, and ATCC 11775, an O1:H7 control strain sourced from the American Type Culture Collection.

Table 1.

Levels of Attachment to Three Materials and Hydrophobicity of Six Escherichia coli Strains and Their Isogenic Dps Null Mutants

Strain and growth media	Glass ^a	Teflon ^a	Stainless steel ^a	Hydrophobicity ^b
EC614 NB^c	4.21±0.10^A	3.47±0.24^A	3.86±0.04^B	15.4±0.7^A
EC614 Δdps::cat NB	4.00±0.14^A	3.63±0.20^A	4.40±0.01^A	14.6±0.3^A
EC614 NA^c	3.92±0.07^A	3.87±0.09^A	2.93±0.16^B	14.4±0.3^A
EC614 Δdps::cat NA	3.67±0.19^A	2.81±0.15^B	4.10±0.10^A	13.9±0.4^A
EDL933 NB^c	3.96±0.12^B	3.59±0.19^A	2.20±0.28^B	14.7±0.5^A
EDL933 Δdps::cat NB	4.44±0.08^A	2.21±0.27^B	3.92±0.06^A	13.9±1.5^A
EDL933 NA^c	3.69±0.18^A	4.20±0.11^A	2.76±0.12^B	15.3±0.8^A
EDL933 Δdps::cat NA	2.79±0.52^B	1.95±0.00^B	4.14±0.08^A	15.6±1.2^A
ATCC11775 NB^c	3.74±0.08^B	3.22±0.20^A	2.79±0.08^B	20.8±0.5^A
ATCC11775 Δdps::cat NB	5.01±0.17^A	2.39±0.17^B	3.28±0.08^A	19.7±0.7^A
ATCC11775 NA^c	3.56±0.02^A	3.35±0.18^A	2.66±0.15^B	16.5±1.1^A
ATCC11775 Δdps::cat NA	2.78±0.11^B	2.37±0.37^B	3.53±0.12^A	15.8±0.6^A

Attachment (log colony-forming units per cm²). Means and standard deviations of three independent assays are given.

Contact angle measurements (θ). Means and standard deviations of three independent measurements are given.

Attachment values as reported by Goulter et al. (2010) and Rivas et al. (2007).

A,B

Different superscripts indicate significant differences for parent and Δdps::cat pairs for that growth media (p<0.05).

NA, nutrient agar; NB, nutrient broth.

OMP expression

Changes in expression of OMPs (isoelectric point within the pH range of 5.8–6.7) were investigated between cells grown in planktonic (NB) and sessile (NA) culture using methods described by Rivas et al. (2008), with slight modifications. Briefly, immobilized pH gradient strips (Biorad Laboratories) of pH 5.8–6.7 and the corresponding 5.8–6.7 biolytes (Biorad Laboratories) in the rehydration buffer were used. Protein spots of interest were identified using methods described by Rivas et al. (2008).

Knockout strains

The dps gene in all strains was replaced with a chloramphenicol antibiotic resistance cassette (cat) using the Lambda Red system described by Datsenko and Wanner (2000). Primers dps-mut-F (ATGAGTACCGCTAAATTAGTTAAATCAAAAGCGACCAATCGTGTAGGCTGGAGCTGCTTC) and dps-mut-R (TTATTCGATGTTAGACTCGATAAACCACAGGAATTTATCCATGGGAATTAGCCATGGTCC) were used to amplify cat from the plasmid pKD3. Knockout strains were confirmed using primers flanking the dps gene to amplify a PCR fragment of reduced size due to cat replacement of dps.

Hydrophobicity

The CSH of all strains was determined using contact angle measurements (CAM) as described by Rivas et al. (2005). Measurements were taken in triplicate with three independent cultures.

Attachment

The attachment of bacterial strains to glass, SS, and Teflon surfaces were conducted as described by Goulter et al. (2010). Assays were conducted in triplicate with three independent cultures.

Statistical analysis

One-way analysis of means and comparison of means (Tukey's method) were performed using Minitab software (MINITAB 15; Minitab, Inc.).

Results and Discussion

Previously unidentified differentially expressed OMPs (Rivas et al., 2008) in the pH range of 5.8–6.7 were identified as Dps in this study. This cluster of Dps was found to be upregulated (greater than threefold) when the strains investigated were cultured on agar as opposed to broth. Dps knockout strains were constructed and attachment to all surfaces was studied following growth in NB and NA (Table 1). Differences in the attachment ability of parent and dps-negative pairs were seen for all strains but in a strain- and substrate-dependant manner. Specifically, the loss of Dps increased the ability of EDL933 and ATCC11775 to attach to glass following growth in NB (p<0.05), but decreased the attachment ability following growth on NA (p<0.05). No significant difference (p>0.05) was seen between EC614 and its dps-negative counterpart following growth in either of media on attachment to glass. Attachment of strains lacking Dps to Teflon was shown to decrease significantly (p<0.05) for all isolates following growth in both media, with the exception of EC614 when cultured in NB. Strains lacking Dps were shown to have an increased ability to attach to SS following growth in both broth and agar culture when compared with parent strains (p<0.05). In the study by Lacqua et al. (2006), a dps-negative strain of E. coli K12 was not shown to differ in its ability to attach or form biofilms compared with its parent strain. Together with the results of this study, this suggests that Dps may play a role in attachment for E. coli O157 and O1 strains, but not for K12.

These results suggest that the attachment behavior of E. coli varies depending on the properties of the substrate as well as the properties of the bacterial cells. The CSH was not found to be significantly different (p>0.05) between parent and knockout strains (Table 1), indicating that other surface properties may influence attachment. Other OMPs and properties such as surface charge may also be involved in the attachment process (Kumar and Anand, 1998). The positive role of Dps-like proteins in adhesion has been studied for bacteria such as Salmonella Typhimurium and was reviewed by Haikarainen and Papageorgiou (2010). The results of the present study suggest that Dps may also play a role in attachment for some strains of E. coli to some abiotic surfaces. Attachment of bacteria to surfaces is a complex process and may involve several factors including, but not limited to, OMPs and mode of growth.

Conclusions

The location of Dps in the outer membrane of E. coli may influence the ability of some strains to attach to a variety of abiotic surfaces. However, Dps does not appear to influence CSH for E. coli. Further work is required to confirm the presence of this protein in the outer membrane.

Footnotes

Acknowledgments

R.M.G.-T. acknowledges the financial support of the Department of Employment, Economic Development and Innovation of the Queensland Government, Australia, through the Smart State Ph.D. Scholarships Program and the support of the Australian Government through the Australian Postgraduate Award. This work was supported through funding by CSIRO.

Disclosure Statement

No competing financial interests exist.

References

Datsenko

, Wanner

. One-step inactivation of chromosomal genes in Escherichia coli K12 using PCR products. Proc Natl Acad Sci U S A, 2000; 97:6640–6645.

Goulter

, Gentle

, Dykes

. Characterisation of curli production, cell surface hydrophobicity, autoaggregation and attachment behaviour of Escherichia coli O157. Curr Microbiol, 2010; 61:157–162.

Goulter

, Gentle

, Dykes

. Issues in determining factors influencing bacterial attachment: a review using the attachment of Escherichia coli to abiotic surfaces as an example. Lett Appl Microbiol, 2009; 49:1–7.

Haikarainen

, Papageorgiou

. Dps-like proteins: structural and functional insights into a versatile protein family. Cell Mol Life Sci, 2010; 67:341–351.

Jeong

, Hung

, Baumler

, Byrd

, Kaspar

. Acid stress damage of DNA is prevented by Dps binding in Escherichia coli O157: H7. BMC Microbiol, 2008; 8:13.

Kumar

, Anand

. Significance of microbial biofilms in food industry: a review. Int J Food Microbiol, 1998; 42:9–27.

Lacqua

, Wanner

, Colangelo

, Martinotti

, Landini

. Emergence of biofilm forming subpopulations upon exposure of Escherichia coli to environmental bacteriophages. Appl Environ Microbiol, 2006; 72:956–959.

Rivas

, Fegan

, Dykes

. Attachment of shiga toxigenic Escherichia coli to stainless steel. Int J Food Microbiol, 2007; 115:89–94.

Rivas

, Fegan

, Dykes

. Expression and putative roles in attachment of outer membrane proteins of Escherichia coli O157 from planktonic and sessile culture. Foodborne Pathog Dis, 2008; 5:155–164.

10.

Rivas

, Fegan

, Dykes

. Physicochemical properties of shiga toxigenic Escherichia coli. J Appl Microbiol, 2005; 99:716–727.

11.

Saldana

, Xicohtencatl-Cortes

, Avelino

et al. Synergistic role of curli and cellulose in cell adherence and biofilm formation of attaching and effacing Escherichia coli and identification of Fis as a negative regulator of curli. Environ Microbiol, 2009; 11:992–1006.

12.

, Lin

, Peng

. From proteome to genome for functional characterization of pH dependent outer membrane proteins in Escherichia coli. J Proteome Res, 2009; 8:1059–1070.