Prevalence and Mechanisms of Quinolone Resistance Among Selected Nontyphoid Salmonella Isolated from Food Animals and Humans in Korea

Abstract

The aim of this study was to investigate the prevalence and mechanism of quinolone resistance among selected nontyphoid Salmonella (NTS) isolates. A total of 1279 NTS isolated from food animals (n=692) and humans (n=587) between 1995 and 2009 were investigated by serotyping, antimicrobial susceptibility testing, screening for plasmid-mediated quinolone resistance (PMQR) genes qnr, aac(6′)-Ib-cr, and qepA and mutations in the quinolone resistance-determining region (QRDR) of gyrA and parC by PCR, and DNA sequencing. Three hundred thirty (47.7%) of 692 animal isolates and 177 (30.2%) of 587 human isolates were resistant to nalidixic acid. Most animal (94.8%, 313/330) and human (99.4%, 176/177) NTS exhibited decreased ciprofloxacin susceptibility (minimum inhibitory concentration [MIC]: 0.125–2 mg/L). None of them carried qnr or qepA gene. However, aac(6′)-Ib was identified in six animal isolates, of which four carried aac(6′)-Ib-cr gene. Based on antimicrobial resistance profile, year of isolation, MIC for quinolones and fluoroquinolones, and isolation frequency of serotype, 114 animal and 83 human isolates were tested for QRDR mutations. All contained a single mutation within the QRDR of gyrA at either codon 87 or 83, and 41 of them contained an additional mutation in parC. The most prevalent mutation was Asp87-Tyr (n=107), followed by Asp87-Gly (n=28), Asp87-Asn (n=26), Ser83-Tyr (n=22), and Ser83-Phe (n=14). Point mutations in parC were observed outside the QRDR, which included 40 isolates with Thr57-Ser substitution and 1 Salmonella Typhimurium with a novel Glu51-Lys substitution. In conclusion, a point mutation within the QRDR of gyrA was primarily responsible for quinolone resistance and reduced susceptibility to fluoroquinolones in NTS in Korea. To our knowledge, this is the first report of occurrence of aac(6′)-Ib-cr gene among NTS in Korea. The spread of NTS carrying aac(6′)-Ib-cr is of serious concern and should be carefully monitored.

Introduction

S almonellosis constitutes an important public health problem in both developing and developed countries, including Korea (Weinberger and Keller, 2005). Approximately 1 million cases of Salmonellosis, causing 19,336 hospitalizations and nearly 400 deaths, occur each year in the United States (Scallan et al., 2011). Nontyphoid Salmonella (NTS) strains are the second most common cause of food poisoning in humans in Korea (Lee et al., 2001). Among these, serotypes Enteritidis and Typhimurium are the two most prevalent serotypes causing salmonellosis in humans as well as livestock (Cheong et al., 2007; Lee et al., 2009). Fluorinated quinolones are among the most extensively used antimicrobial agents for treating salmonellosis in both human and veterinary medicine because of their broad-spectrum antimicrobial activity (Angulo et al., 2000; Giraud et al., 2006). Unfortunately, extensive use of fluoroquinolones has led to increasing number of NTS isolates resistant to quinolones and reduced susceptibility to fluoroquinolones in many countries, including the Republic of Korea (Angulo et al., 2000; Choi et al., 2005; Bertrand et al., 2006; Lee et al., 2009). Reduced susceptibility to fluoroquinolones among the Salmonella species has been associated with clinical treatment failure in many parts of the world, causing significant therapeutic problems (Aarestrup et al., 2003). Further, Molbak et al. (1999) reported quinolone-resistant Salmonella infections in humans that were difficult to treat and were associated with transmission from food animals.

In Salmonella species, a single mutation in the quinolone resistance-determining region (QRDR) of gyrA can mediate resistance to quinolones such as nalidixic acid and reduced susceptibility to fluoroquinolones. Mutations in the gyrB or topoisomerase IV (parC and parE) genes are considered rare in salmonellae (Giraud et al., 2006). In the recent years, plasmid-mediated quinolone resistance (PMQR) has emerged in Salmonella and in other Enterobacteriaceae, and the prevalence of PMQR is increasing (Strahilevitz et al., 2009). Since it was first reported in 1998, three PMQR mechanisms have been described (Martínez-Martínez et al., 1998). The first PMQR mechanism includes qnr genes, which encode proteins that directly protect DNA gyrase from quinolone inhibition (Strahilevitz et al., 2009). The second mechanism consists of aac(6′)-Ib-cr gene, which encodes a new variant of the common aminoglycoside acetyltransferase that is capable of acetylating the piperazinyl substituent of some fluoroquinolones, thereby reducing their activities (Robicsek et al., 2006). The third mechanism involves qepA gene, which encodes an efflux pump belonging to the major facilitator superfamily (Yamane et al., 2007).

Korea is one of the areas with a high incidence of quinolone and/or fluoroquinolone resistance for Enterobacteriaceae (Kim et al., 2009). Recently, PMQR determinants alone or in association with plasmid-mediated extended-spectrum β-lactamase (ESBL) or AmpC β-lactamase are increasingly being reported among clinical isolates of Enterobacteriaceae from humans (Tamang et al., 2008; Kang et al., 2009; Kim et al., 2009). Similarly, resistance to nalidixic acid and ciprofloxacin in NTS has been constantly increasing in Korea in the recent years (Lee et al., 2009). However, only few studies have investigated the molecular basis of quinolone resistance in NTS isolates from Korea, and among them, majority of the studies were reported in Salmonella of human origin (Choi et al., 2005). Therefore, in the present study, the prevalence and mechanism of quinolone resistance including the three novel PMQR mechanisms (qnr, aac(6′)-Ib-cr, and qepA genes) were investigated among the nalidixic acid-resistant (Nal^r) NTS isolated from food animals and humans in Korea between 1995 and 2009.

Materials and Methods

Salmonella strains

A total of 692 NTS isolates recovered from various samples of food animals submitted to the National Veterinary Research and Quarantine Service, Korea, for diagnostic investigation between 1995 and 2009 or received from Korean Veterinary Antimicrobial Resistance Monitoring System (KVARMS) participating laboratories/centers between 2008 and 2009 were investigated. The samples or KVARMS isolates were received from all the nine provinces of Korea and were of pigs (n=455), pork (n=5), poultry (n=54), chicken meat (n=171), and cattle (n=7) origin. Around 38% of them were from healthy animals, 37% from sick animals, and 25% from meat. The material was selected to comprise only one isolate per animal. Similarly, 587 nonduplicate human isolates of NTS isolated during the study period and received from the Gwangju Research Institute of Public Health and Environment, Gwangju, Southwest Korea, were also included. These isolates were isolated from clinical samples of suspected patients with gastroenteritis. Identification and serotyping of Salmonella isolates was done as previously described (Lim et al., 2009). Among them, NTS isolates resistant to nalidixic acid were further studied in detail to elucidate their mechanism of quinolone resistance.

Antimicrobial susceptibility testing

The antimicrobial susceptibility tests were performed by standard disc diffusion method according to the guidelines of Clinical Laboratory Standards Institute (CLSI) (CLSI, 2010) on Mueller Hinton agar (Becton-Dickinson, Sparks, MD) using commercial discs (Becton-Dickinson, Cockeysville, MD). The MICs of nalidixic acid (Sigma Chemical Co., St. Louis, MO), ciprofloxacin (Sigma Chemical Co.), and enrofloxacin (Sigma Chemical Co.) for all the Nal^r NTS isolates were determined according to the CLSI guidelines (CLSI, 2010). Escherichia coli ATCC 25922 and Pseudomonas aeruginosa ATCC 27853 were used as quality control strains.

Detection of PMQR determinants

Screening of six PMQR determinants was carried out by two sets of multiplex PCR amplification, one for qnrA, qnrB, qnrC, and qnrS and the other for qnrD, aac(6′)-Ib, and qepA genes as previously described (Park et al., 2006; Jacoby et al., 2009; Kim et al., 2009). The primer set for amplification of qnrD allele was designed using the qnrD nucleotide sequence reported in the GenBank (GenBank accession number: EU692908). These primer sequences are listed in Table 1. All PCR products positive for aac(6′)-Ib were further analyzed by digestion with BtsCI (New England Biolabs, Ipswich, MA) to identify aac(6′)-Ib-cr, which lacks the BtsCI restriction site present in the wild-type gene as previously described (Park et al., 2006). Clinical isolates that had been previously confirmed to carry qnr, aac(6′)-Ib, aac(6′)-Ib-cr, and qepA genes (Tamang et al., 2008; Kang et al., 2009) were used as positive controls.

Table 1.

Sequence of Oligonucleotide Primers Used in This Study

Primers	Primer sequences (5′→3′)	Target gene	Amplicon size (bp)	Reference
QnrA-F	ATTTCTCACGCCAGGATTTG	qnrA	574	Jacoby et al. (2009)
QnrA-R	TGCCAGGCACAGATCTTGAC
QnrB-F	CGACCTKAGCGGCACTGAAT	qnrB	513	Jacoby et al. (2009)
QnrB-R	GAGCAACGAYGCCTGGTAGYTG
QnrC-F	GGGTTGTACATTTATTGAATCG	qnrC	307	Kim et al. (2009)
QnrC-R	CACCTACCCATTTATTTTCA
QnrD-F	TGTGATTTTTCAGGGGTTGA	qnrD	520	This study
QnrD-R	CCTGCTCTCCATCCAACTTC
QnrS-F	ACTGCAAGTTCATTGAACAG	qnrS	431	Jacoby et al. (2009)
QnrS-R	GATCTAAACCGTCGAGTTCG
AAC(6′)-Ib-F	TTGCGATGCTCTATGAGTGGCTA	aac(6′)-Ib	482	Park et al. (2006)
AAC(6′)-Ib-R	CTCGAATGCCTGGCGTGTTT
QepA-F	AACTGCTTGAGCCCGTAGAT	qepA	596	Kim et al. (2009)
QepA-R	GTCTACGCCATGGACCTCAC
GyrA-1	TGTCCGAGATGGCCTGAAGC	gyrA	470	Giraud et al. (1999)
GyrA-2	CGTTGATGACTTCCGTCAG
ParC-1	ATGAGCGATATGGCAGAGCG	parC	413	Giraud et al. (1999)
ParC-2	TGACCGAGTTCGCTTAACAG

PCR amplification and sequencing of gyrA and parC

PCR amplifications of the QRDR of gyrA and parC genes in selected isolates were carried out using previously described primers and protocols (Giraud et al., 1999). The isolates were selected representing all serotype and on the basis of year of isolation, livestock farm, antimicrobial resistance profile, MIC for quinolones and fluoroquinolones, and isolation frequency of serotype. Altogether, 197 Nal^r NTS strains isolated from food animals (n=114) and humans (n=83) were investigated for QRDR mutations. Purified PCR products were sequenced with primers GyrA-1 and ParC-1 (Table 1) for gyrA and parC fragments, respectively, using an automated ABI Prism 3100 Analyzer (Applied Biosystems, Foster City, CA). The QRDR DNA sequences of gyrA and parC for each of the isolates tested were compared with the QRDR of gyrA and parC DNA sequences of Salmonella enterica serotype Typhimurium LT2 strain (GenBank accession number: AE006468). Analysis and comparison were performed with BLAST program at the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov/BLAST) and ExPASY proteomics tools (www.expasy.ch/tools/#similarity).

Results

Three hundred thirty (47.7%) of 692 animal NTS strains and 177 (30.2%) of 587 human NTS strains isolated were resistant to nalidixic acid. Altogether, 22 different Salmonella serotypes were identified among the 330 animal isolates and 177 human isolates that were resistant to nalidixic acid. The various Nal^r NTS serotypes identified in this study are listed in Table 2. Overall, the most frequent serotype was Salmonella Typhimurium (45.2%, 229 of 507) followed by Salmonella Enteritidis (30.9%, 157 of 507).

Table 2.

Serotype Distribution of Nalidixic Acid-Resistant Nontyphoid Salmonella Isolated from Food Animals (n=330) and Humans (n=177) in This Study

	No. of NTS isolated from
Salmonella serotype	Animals (%)	Humans (%)	Total (%)
S. Typhimurium	201 (60.9)	28 (15.8)	229 (45.2)
S. Enteritidis	49 (14.8)	108 (61.0)	157 (30.9)
S. Gallinarium	8 (2.4)		8 (1.5)
S. Schwarzengrund	3 (0.9)		3 (0.6)
S. Afula	1 (0.3)		1 (0.2)
S. Blockley	1 (0.3)	3 (1.7)	4 (0.8)
S .Derby	1 (0.3)		1 (0.2)
S. Essen	2 (0.6)		2 (0.4)
S. Newport	2 (0.6)	3 (1.7)	5 (1.0)
S. Pullorum	1 (0.3)		1 (0.2)
S. Rissen	2 (0.6)		2 (0.4)
S. Tennessee	1 (0.3)		1 (0.2)
S. Bardo		9 (5.1)	9 (1.8)
S. Champaign		1 (0.6)	1 (0.2)
S. Haardt		1 (0.6)	1 (0.2)
S. Hadar		3 (1.7)	3 (0.6)
S. Heidelberg		1 (0.6)	1 (0.2)
S. Mbandaka		1 (0.6)	1 (0.2)
S. Montevideo		1 (0.6)	1 (0.2)
S. Panama		1 (0.6)	1 (0.2)
S. Stanley		3 (1.7)	3 (0.6)
S. Virchow		2 (1.1)	2 (0.4)
Not identified	58 (17.6)	12 (6.8)	70 (13.8)
Total	330	177	507

NTS, nontyphoid Salmonella.

The MICs of nalidixic acid and selected fluoroquinolones were determined for 507 Nal^r NTS isolates derived from food animals (n=330) and humans (n=177). Three hundred eleven (94.2%) of the total 330 animal isolates and 175 (98.9%) of the 177 human isolates exhibited high-level nalidixic acid resistance (MIC≥256 mg/L). The MIC₅₀, MIC₉₀, and MIC range for nalidixic acid, ciprofloxacin, and enrofloxacin for Nal^r NTS isolated from food animals and humans were compared and are shown in Table 3. According to the current CLSI criteria, none of the isolates of either animal or human origin was resistant to ciprofloxacin at breakpoint of ≥4 mg/L. However, three S. enterica serotype Gallinarum strains isolated from livestock showed intermediate ciprofloxacin resistance (MIC 2 mg/L). Similarly, 12.4% (41/330) of the animal isolates and none but two human isolates was resistant to enrofloxacin at the breakpoint MIC of ≥2 mg/L (CLSI, 2008).

Table 3.

Minimum Inhibitory Concentrations of Nalidixic Acid, Ciprofloxacin, and Enrofloxacin for Nalidixic Acid–Resistant Nontyphoid Salmonella of Animal and Human origins

	MIC (mg/L)
	Animal isolates (n = 330)			Human isolates (n = 177)
Salmonella serotype and antimicrobial agent	Range	MIC₅₀	MIC₉₀	Range	MIC₅₀	MIC₉₀
S. Enteritidis (n=157)
Nalidixic acid	256–1024	512	1024	128–1024	256	512
Ciprofloxacin	0.06–1	0.125	0.25	0.125–0.25	0.125	0.25
Enrofloxacin	0.25–2	0.5	0.5	0.25–1	0.5	0.5
S. Typhimurium (n=229)
Nalidixic acid	32–1024	1024	>1024	256–1024	512	1024
Ciprofloxacin	0.03–1	0.25	0.5	0.06–0.5	0.5	0.5
Enrofloxacin	0.06–4	1	2	0.25–2	1	1
Other serotypes (n=121)^a
Nalidixic acid	32–1024	512	>1024	256–1024	512	1024
Ciprofloxacin	0.03–2	0.25	1	0.125–0.5	0.125	0.25
Enrofloxacin	0.125–2	0.5	1	0.5–1	0.5	0.5

Other serotypes included nontypoid Salmonella other than Typhimurium and Enteritidis as well as unidentified serotypes mentioned in Table 2.

MIC, minimum inhibitory concentration; MIC₅₀, MIC at which 50% of the isolates were inhibited; MIC₉₀, MIC at which 90% of the isolates were inhibited.

Multiplex PCR screening using specific primers failed to detect qnrA, qnrB, qnrC, qnrD, and qnrS as well as qepA genes in any of the Nal^r NTS isolates of either animal or human origin. Nevertheless, aac(6′)-Ib determinant was identified in six animal isolates, of which four were aac(6′)-Ib-cr. Of the four aac(6′)-Ib-cr–positive isolates, two were Salmonella Typhimurium (one each isolated from diseased pig and cattle) and one each Derby (isolated from pork) and Essen (isolated from healthy cattle) serotypes. Further, all the four aac(6′)-Ib-cr–positive isolates exhibited high-level nalidixic acid resistance (MIC 512 mg/L) and decreased susceptibility to ciprofloxacin (MIC 1 mg/L) or enrofloxacin (MIC 1 mg/L).

All the 197 Nal^r NTS isolates sequenced contained a mutation that encoded single amino acid substitution within the QRDR of gyrA at either codon 87 (161 strains) or codon 83 (36 strains). Of the 103 isolates for which parC sequence analysis was successful, a single mutation was detected in parC of 41 isolates, in addition to a mutation in gyrA at Asp87 (20 strains) or Ser83 (21 strains). Point mutations within parC in these isolates were observed outside the QRDR, which included 40 isolates with Thr57 to serine substitution and 1 Salmonella Typhimurium with a novel Glu51 to lysine substitution. Further, all the four aac(6′)-Ib-cr–positive isolates had single mutation in the QRDR of gyrA at codon 87 (Asp87-Gly substitution).

The comparisons of point mutation patterns and MICs for nalidixic acid, ciprofloxacin, or enrofloxacin between the Nal^r NTS isolates of animal and human origins tested in this study are separately shown for Typhimurium and Enteritidis (Table 4) and for serovars other than Typhimurium and Enteritidis (Table 5). Overall, substitution within the gyrA at codon 87 or 83 conferred similar level of nalidixic acid resistance (MIC 128–1024 mg/L vs. 256–1024 mg/L) or ciprofloxacin (MIC 0.06–0.5 mg/L vs. 0.125–2 mg/L) irrespective of isolate origin. Further, the number of isolates with amino acid substitution at codon Asp87 was higher among the human (71/83, 85.5%) isolates compared with animal (90/114, 78.9%) isolates.

Table 4.

Correlation Between Nalidixic Acid, Ciprofloxacin, or Enrofloxacin Minimum Inhibitory Concentrations and gyrA or parC Mutations Among Representative Nalidixic Acid–Resistant Salmonella spp.

			Animal isolates				Human isolates
Point mutations within the			MIC range (MIC₅₀)				MIC range (MIC₅₀)
gyrA	parC	No.	NAL	CIP	ENR	No.	NAL	CIP	ENR
Salmonella Enteritidis (n=52)
Ser83→Tyr		1	1024	0.25	0.5
Ser83→Phe						3	1024	0.25	0.5–1
Asp87→Asn		8	256–512 (512)	0.12–0.25 (0.12)	0.25–0.5 (0.5)	9	256–1024 (512)	0.12–0.25 (0.12)	0.5
Asp87→Gly		6	256–512 (256)	0.12	0.25–0.5 (0.25)	8	128–512 (256)	0.12–0.25 (0.12)	0.25–0.5 (0.5)
Asp87→Tyr						5	512–1024 (512)	0.12–0.25 (0.12)	0.5
Ser83→Phe	Thr57→Ser	1	512	0.5	1
Ser83→Tyr	Thr57→Ser	10	512->1024 (1024)	0.25–0.5 (0.25)	0.5–1 (0.5)	1	1024	0.25	0.5
Salmonella Typhimurium (n=97)
Ser83→Phe		3	>1024	0.5–1	2
Ser83→Tyr		3	512–1024	0.25	0.5
Asp87→Tyr		55	256–1024 (1024)	0.12–1 (0.5)	0.25–2 (1)	21	256–1024 (512)	0.12–0.5 (0.5)	0.5–2 (1)
Asp87→Gly		8	256–1024 (256)	0.12–1 (0.5)	0.25–4 (0.5)	1	256	0.6	0.25
Asp87→Asn		4	512–1024	0.12–1	0.5–1	1	512	0.12	0.5
Asp87→Tyr	Glu51→Lys	1	512	0.5	1

NAL, nalidixic acid; CIP, ciprofloxacin; ENR, enrofloxacin; No., number of isolates.

Table 5.

Distribution of gyrA and parC Mutations Among the Nontyphoid Salmonella Other Than Typhimurium and Enteritidis Serotypes

		Point mutation within the		MIC range in mg/L (MIC₅₀)
Origin and Salmonella serotype	No. of isolates	gyrA	parC	NAL	CIP	ENR
Animal Salmonella isolates
S. Afula	1	Asp87→Tyr	wild type	>1024	0.5	1
S. Blockley	1	Ser83→Tyr	Thr57→Ser	1024	0.25	0.5
S. Derby	1	Asp87→Gly	wild type	512	1	1
S. Essen	1	Asp87→Gly	wild type	512	1	1
S. Essen	1	Asp87→Tyr	ND	512	0.125	0.5
S. Gallinarium	2	Ser83→Phe	ND	1024, >1024	1, 2	2
S. Gallinarium	1	Ser83→Tyr	ND	>1024	2	2
S. Newport	2	Asp87→Tyr	Thr57→Ser	256	0.125	0.5
S. Rissen	1	Ser83→Tyr	wild type	512	0.25	0.5
S. Schwarzengrund	2	Asp87→Tyr	wild type	>1024	0.5	1
S. Tennessee	1	Ser83→Phe	Thr57→Ser	512	0.125	0.5
Human Salmonella isolates
S. Bardo	9	Asp87→Tyr	Thr57→Ser	256	0.125	0.5
S. Blockley	3	Ser83→Tyr	Thr57→Ser	1024	0.25	0.5
S. Champaign	1	Ser83→Phe	Thr57→Ser	512	0.25	0.5
S. Haardt	1	Ser83→Tyr	Thr57→Ser	1024	0.25	1
S. Hadar	3	Asp87→Tyr	Thr57→Ser	512	0.125	0.5
S. Heidelberg	1	Asp87→Asn	Thr57→Ser	256	0.125	0.5
S. Mbandaka	1	Asp87→Gly	wild type	256	0.125	0.5
S. Montevideo	1	Ser83→Phe	Thr57→Ser	1024	0.25	0.5
S. Newport	3	Asp87→Tyr	Thr57→Ser	256	0.125	0.5
S. Panama	1	Asp87→Gly	Thr57→Ser	512	0.25	1
S. Stanley	2	Asp87→Tyr	wild type	512	0.25, 0.5	1
S. Virchow	1	Asp87→Tyr	wild type	256	0.125	0.5
S. Virchow	1	Ser83→Phe	wild type	512	0.5	0.5
S. spp.	1	Asp87→Tyr	wild type	512	0.125	0.5
S. spp.	3	Asp87→Asn	wild type	512	0.125	0.5
S. spp.	1	Asp87→Gly	wild type	256	0.125	0.5
S. spp.	1	Ser83→Phe	Thr57→Ser	512	0.25	0.5

ND, not determined because of repeated sequencing failure.

Discussion

In the present study, the prevalence and molecular basis of quinolone resistance among the NTS strains isolated from food animals (n=692) and humans (n=587) between 1995 and 2009 were investigated. During the study period, 330 (47.7%) of 692 animal NTS isolates and 177 (30.2%) of 587 human NTS isolates examined were resistant to nalidixic acid. In contrast, Hwang et al. (2010) found 13.9% of the 36 human isolates examined and 68.7% of the 151 livestock isolates resistant to nalidixic acid. Similarly, Choi et al. (2005) reported that 1 (1.8%) of the 55 human NTS strains collected during 1995–1996 was resistant to nalidixic acid compared with 21.8% (45 of 206) of the strains collected during 2000–2002, indicating the increasing trend of nalidixic acid resistance among the NTS isolates in Korea. Also, Lee et al. (2009) recently reported similar incidence of nalidixic acid (36.5%) resistance among the human NTS isolates from Korea. However, they reported higher (13.5%) prevalence of ciprofloxacin resistance among them, in contrast to our results in which none of the Nal^r NTS isolates was resistant to ciprofloxacin.

In this study, most of the animal (94.8%, 313 of 330) and human (99.4%, 176 of 177) NTS isolates resistant to nalidixic acid showed decreased ciprofloxacin susceptibility (MIC 0.125–2 mg/L). Recently, a multinational study revealed different rates of reduced ciprofloxacin susceptibility among the human NTS isolates from Taiwan (48.1%), Thailand (46.2%), Korea (36.5%), Singapore (24.5%), Philippines (14.9%), Sri Lanka (8.0%), and Hong Kong (7.1%) (Lee et al., 2009). In addition, we recently found that 20 (1.6%) of 1279 NTS isolates examined were resistant to extended-spectrum cephalosporins because of production of CTX-M type ESBL among the food animals and humans in Korea (unpublished data). Fluoroquinolones are important alternative antimicrobials for treatment of invasive salmonellosis in adults, especially for NTS producing ESBL, but there are several reports of treatment failures for Salmonella infections caused by strains with decreased susceptibility to fluoroquinolones (Aarestrup et al., 2003). Within this context, it is of great concern to detect the decreased susceptibility to fluoroquinolones among the NTS from both animal and human origins, which would further exacerbate the complexity of the problem. Thus, more prudent use of antimicrobial agents is recommended in both human and veterinary medicine.

The aac(6′)-Ib-cr genes were the only PMQR determinant found among the Nal^r NTS isolates in this study. In contrast, Kim et al. (2009) reported increasing prevalence and diversity of PMQR determinants among human clinical Enterobacteriaceae isolates in Korea. The absence of qnr or qepA and low prevalence of aac(6′)-Ib-cr genes may be related to the study design of this work, as nalidixic acid–susceptible NTS isolates were excluded from screening (Gunell et al., 2009). Since the aac(6′)-Ib-cr determinant was originally reported in 2003 in a clinical isolate of E. coli collected in Shanghai, China, it has appeared in several countries of Asia, North America, and Europe among various enterobacteria (Strahilevitz et al., 2009). In Korea, the gene has been previously detected in human Enterobacteriaceae isolates (Kang et al., 2009; Kim et al., 2009), but to our knowledge it has not been reported from zoonotic bacteria. In this study, the aac(6′)-Ib-cr gene was detected among four Nal^r NTS isolates from livestock for the first time in Korea. The low prevalence (0.7%) of aac(6′)-Ib-cr observed in this study contrasts with a previous Chinese report in which 35% (18/35) of S. enterica isolates with reduced susceptibility to ciprofloxacin-harbored aac(6′)-Ib-cr gene (Cui et al., 2009). Further, in China, the aac(6′)-Ib-cr gene has been detected in both human and veterinary Enterobacteriaceae isolates, with high frequency among the clinical E. coli isolates (Strahilevitz et al., 2009). On the other hand, our findings are consistent with previous data obtained in the United States in which 0.4% (1/283) of human NTS isolates exhibiting reduced susceptibility to ciprofloxacin (≥0.25 mg/L) harbored aac(6′)-Ib-cr gene (Sjolund-Karlsson et al., 2009). Nevertheless, emergence of aac(6′)-Ib-cr gene among NTS is of serious concern, because the decreased susceptibility to fluoroquinolones owing to aac(6′)-Ib-cr genes being plasmid mediated is mobilizable and may spread by horizontal transmission to other susceptible isolates in the community.

For QRDR mutation analysis, the isolates were selected based on history of isolates and the experimental data as described earlier to exclude same or similar clones as much as possible. Overall, the most prevalent mutation in the QRDR of gyrA among the isolates tested was Asp87-Tyr (n=107), followed by Asp87-Gly (n=28), Asp87-Asn (n=26), Ser83-Tyr (n=22), and Ser83-Phe (n=14). These results contrast with those reported by Liebana et al. (2002), in which the most prevalent mutation among the 100 veterinary isolates of S. enterica tested from farm animals in England and Wales was Asp87-Asn (n=42), followed by Ser83-Phe (n=38), Ser83-Tyr (n=12), Asp87-Tyr (n=4), and Asp87-Gly (n=3). This discrepancy could be due to geographical variation in the origin of the isolates, variation in the management practices, for instance, variation in the use of a particular fluoroquinolone for selection in United Kingdom and Korea (KFDA, 2009), or adaption of isolates with a particular mutation to local environment. Our results also differ from those of Hwang et al. (2010), in which a Ser83-Phe mutation was detected in 64 (76.2%) of 84 NTS isolates tested from humans and livestock in Korea. In addition, they found nine double mutations within the QRDR of gyrA, that is, Ser83-Phe and Asp87-Glu (n=6) or Tyr (n=2) or Arg (n=6), but did not detect any mutation in parC, in contrast to our findings. This discrepancy may be due to differences in selection criteria, that is, inclusion of isolates resistant to both nalidixic acid and ciprofloxacin for mutation analysis in their study, in contrast to ours.

It is interesting to note that the Thr57 to serine substitution in this study was observed in various serotypes but was never identified among the Salmonella Typhimurium strains. Our findings are in agreement with previous studies that suggest that mutations in parC of salmonellae are not as frequent as in E. coli and they do not play an important role in quinolone resistance or they may only be required to achieve high-level resistance, which occurs infrequently among Salmonella species (Hopkins et al., 2005). Similarly, Gunell et al. (2009) detected a Thr57-Ser substitution in parC among the NTS strains showing nonclassical quinolone resistance, that is, showing susceptibility or low-level resistance to nalidixic acid but decreased susceptibility to ciprofloxacin. However, they also detected the same Thr57-Ser substitution in all the quinolone-susceptible control strains except Salmonella Typhimurium strains and suggested that this substitution is likely to be a polymorphism common in serotypes other than Typhimurium (Gunell et al., 2009). Moreover, Thr57-Ser substitution has also been reported in E. coli, but its role in quinolone resistance is unknown (Hopkins et al., 2005). In addition, one Salmonella Typhimurium in this study contained a novel Glu51-Lys substitution outside the QRDR of parC. Thus, to our knowledge, this study also reports Glu51-Lys substitution in parC for the first time, although its role in quinolone resistance has to be yet determined. Further, there was no NTS strain with a parC mutation alone, which is in agreement with a previous study done in Korea (Kim et al., 2009).

In conclusion, a point mutation within the QRDR of gyrA was primarily responsible for resistance to quinolones and reduced susceptibility to fluoroquinolones among the Nal^r NTS strains isolated from food animals and humans in Korea. To the best of our knowledge, this study is the first report of occurrence of aac(6′)-Ib-cr among NTS isolates in Korea. This is also the first time aac(6′)-Ib-cr gene was identified among serotypes Derby and Essen. Isolation of aac(6′)-Ib-cr from food animals is of serious concern as it could be transmitted to humans via the food chain. As the impact of PMQR is immense, surveillance and careful monitoring of PMQR using a monitoring system as sensitive as possible to detect PMQR determinants among the relevant bacterial strains from food animals and humans should be continuously performed.

Footnotes

Acknowledgments

This work was supported by a grant from the National Veterinary Research and Quarantine Service, Ministry of Food, Agriculture, Forestry, and Fisheries, Republic of Korea. The authors are grateful to Prof. Jungmin Kim of the Department of Microbiology, Kyungpook National University School of Medicine, for kindly providing positive control strains for various PMQR determinants.

Disclosure Statement

No competing financial interests exist.

References

Aarestrup

, Wiuff

, Mølbak

, Threlfall

. Is it time to change fluoroquinolone breakpoints for Salmonella spp.? Antimicrob Agents Chemother, 2003; 47:827–829.

Angulo

, Johnson

, Tauxe

, Cohen

. Origins and consequences of antimicrobial-resistant nontyphoid Salmonella: implications for the use of fluoroquinolones in food animals. Microb Drug Resist, 2000; 6:77–83.

Bertrand

, Weill

, Cloeckaert

, Vrints

, Mairiaux

, Praud

, Dierick

, Wildemauve

, Godard

, Butaye

, Imberechts

, Grimont

PAD

, Collard

. Clonal emergence of extended-spectrum β-lactamase (CTX-M-2)-producing Salmonella enterica serovar Virchow isolates with reduced susceptibilities to ciprofloxacin among poultry and humans in Belgium and France (2000 to 2003) J Clin Microbiol, 2006; 44:2897–2903.

Cheong

, Lee

, Hwang

, Kee

, Cheong

, Song

, Kim

, Park

, Jung

, Kim

. Characteristics of non-typhoidal Salmonella isolates from human and broiler-chickens in southwestern Seoul, Korea. J Korean Med Sci, 2007; 22:773–778.

Choi

, Woo

, Lee

, Park

, Choo

, Kwak

, Kim

, Choi

, Lee

, Kim

, Jeong

, Ryu

, Kim

. Increasing incidence of quinolone resistance in human non-typhoid Salmonella enterica isolates in Korea and mechanisms involved in quinolone resistance. J Antimicrob Chemother, 2005; 56:1111–1114.

[CLSI] Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; 20^th informational supplement. M100-S20-U. Wayne, PA: CLSI, 2010.

[CLSI] Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Disc and Dilution Susceptibility Tests for Bacteria Isolated from Animals; Approved Standard, 3^rd edition. M31-A3. Wayne, PA: CLSI, 2008.

Cui

, Li

, Sun

, Hu

, Jin

, Li

, Guo

, Ran

, Ma

. Characterization of Salmonella enterica isolates from infants and toddlers in Wuhan, China. J Antimicrob Chemother, 2009; 63:87–94.

Giraud

, Baucheron

, Cloeckaert

. Resistance to fluoroquinolones in Salmonella: emerging mechanisms and resistance prevention strategies. Microbes Infect, 2006; 8:1937–1944.

10.

Giraud

, Brisabois

, Martel

, Chaslus-Dancla

. Comparative studies of mutations in animal isolates and experimental in vitro- and in vivo-selected mutants of Salmonella spp. suggest a counter selection of highly fluoroquinolone-resistant strains in the field. Antimicrob Agents Chemother, 1999; 43:2131–2137.

11.

Gunell

, Webber

, Kotilainen

, Lilly

, Caddick

, Jalava

, Huovinen

, Siitonen

, Hakanen

, Piddock

. Mechanisms of resistance in nontyphoidal Salmonella enterica strains exhibiting a nonclassical quinolone resistance phenotype. Antimicrob Agents Chemother, 2009; 53:3832–3836.

12.

Hopkins

, Davies

, Threlfall

. Mechanisms of quinolone resistance in Escherichia coli and Salmonella: recent developments. Int J Antimicrob Agents, 2005; 25:358–373.

13.

Hwang

, Song

, Kim

, Jeong

, Kim

, Cheong

. Prevalence and mechanisms of low level quinolone resistance among non-typhoidal Salmonella isolates from human and poultry/livestock in Korea: usefulness of nalidixic acid resistance test. Infect Chemother, 2010; 42:230–236.

14.

Jacoby

, Gacharna

, Black

, Miller

, Hooper

. Temporal appearance of plasmid-mediated quinolone resistance genes. Antimicrob Agents Chemother, 2009; 53:1665–1616.

15.

Kang

, Tamang

, Seol

, Kim

. Dissemination of plasmid-mediated qnr, aac(6′)-Ib-cr, and qepA genes among 16S rRNA methylase producing Enterobacteriaceae in Korea. J Bacteriol Virol, 2009; 39:173–182.

16.

[KFDA] Korea Food and Drug Administration. Establishment of Control System of Antibiotics for Livestock. Seoul, South Korea: KFDA, 2009.

17.

Kim

, Park

, Kim

E-C

, Jacoby

, Hooper

. Prevalence of plasmid-mediated quinolone resistance determinants over a nine-year period. Antimicrob Agents Chemother, 2009; 53:639–645.

18.

Lee

, Su

, Tsai

, Kim

, Chang

, Jung

, Park

, Perera

, Carlos

, Tan

, Kumarasinghe

, So

, Chongthaleong

, Hsueh

, Liu

, Song

, Chiu

. High rate of reduced susceptibility to ciprofloxacin and ceftriaxone among nontyphoid Salmonella clinical isolates in Asia. Antimicrob Agents Chemother, 2009; 53:2696–2699.

19.

Lee

, Lee

, Kim

, Park

. Foodborne illness outbreaks in Korea and Japan studied retrospectively. J Food Prot, 2001; 64:899–902.

20.

Liebana

, Clouting

, Cassar

, Walker

, Threlfall

, Clifton-Hadley

, Davies

. Comparison of gyrA mutations, cyclohexane resistance, and the presence of class I integrons in Salmonella enterica from farm animals in England and Wales. J Clin Microbiol, 2002; 40:1481–1486.

21.

Lim

, Lee

, Nam

, Jung

, Koh

, Roh

. Antimicrobial resistance and phage types of Salmonella isolates from healthy and diarrheic pigs in Korea. Foodborne Pathog Dis, 2009; 6:981–987.

22.

Martínez-Martínez

, Pascual

, Jacoby

. Quinolone resistance from a transferable plasmid. Lancet, 1998; 351:797–799.

23.

Molbak

, Baggesen

, Aarestrup

, Ebbesen

, Engberg

, Frydendahl

, Gernersmidt

, Petersen

, Wegener

. An outbreak of multidrug-resistant, quinolone-resistant, Salmonella enterica serotype typhimurium DT104. N Engl J Med, 1999; 341:1420–1425.

24.

Park

, Robicsek

, Jacoby

, Sahm

, Hooper

. Prevalence in the United States of aac(6′)Ib-cr encoding a ciprofloxacin-modifying enzyme. Antimicrob Agents Chemother, 2006; 50:3953–3955.

25.

Robicsek

, Strahilevitz

, Jacoby

, Macielag

, Abbanat

, Park

, Bush

, Hooper

. Fluoroquinolone-modifying enzyme: a new adaptation of a common aminoglycoside acetyltransferase. Nat Med, 2006; 12:83–88.

26.

Scallan

, Hoekstra

, Angulo

, Tauxe

, Widdowson

M-A

, Roy

, Jones

, Griffin

. Foodborne illness acquired in the United States: major pathogens. Emerg Infect Dis, 2011; 17:7–15.

27.

Sjolund-Karlsson

, Folster

, Pecic

, Joyce

, Medalla

, Rickert

, Whichard

J M

. Emergence of plasmid-mediated quinolone resistance among non-Typhi Salmonella enterica isolates from humans in the United States. Antimicrob Agents Chemother, 2009; 53:2142–2144.

28.

Strahilevitz

, Jacoby

, Hooper

, Robicsek

. Plasmid-mediated quinolone resistance: a multifaceted threat. Clin Microbiol Rev, 2009; 22:664–689.

29.

Tamang

, Seol

, Oh

, Kang

, Lee

, Cho

, Kim

. Plasmid-mediated quinolone resistance determinants qnrA, qnrB, and qnrS among clinical isolates of Enterobacteriaceae in a Korean hospital. Antimicrob Agents Chemother, 2008; 52:4159–4162.

30.

Weinberger

, Keller

. Recent trends in the epidemiology of non-typhoid Salmonella and antimicrobial resistance: the Israeli experience and worldwide review. Curr Opin Infect Dis, 2005; 18:513–521.

31.

Yamane

, Wachino

J-I

, Suzuki

, Kimura

, Shibata

, Kato

, Shibayama

, Konda

, Arakawa

. New plasmid-mediated fluoroquinolone efflux pump, QepA, found in an Escherichia coli clinical isolate. Antimicrob Agents Chemother, 2007; 51:3354–3360.