Development of PCR Primers and a DNA Macroarray for the Simultaneous Detection of Major Staphylococcus Species Using groESL Gene

Abstract

Staphylococcus spp., including S. aureus, S. intermedius, S. hyicus, S. epidermidis, S. saprophyticus, S. haemolyticus, S. xylosus, and S. carnosus, are major bacterial species associated with food poisoning, and human and veterinary clinics. Traditional methods for the identification of these staphylococci are time-consuming, laborious, or inaccurate. Therefore, rapid and accurate diagnostic methods are needed. In this study, we designed the DNA probes and polymerase chain reaction (PCR) primers for the detection of the aforementioned Staphylococcus species. These primers were proved to be specific for the detection of their corresponding target strains. Furthermore, by using a consensus primer pair, we were able to co-amplify the intergenic region of groES-groEL for these staphylococci. Followed by a chromogenic macroarray system with the specific probes on the plastic chips, these staphylococci in milk products or clinical samples could be simultaneously detected. When the system was used for the inspection of milk or urine samples containing N×10⁰ target cells per milliliter of the sample, all these staphylococcal species could be identified after an 8-h pre-enrichment step. This system also allowed the adequate diagnosis of bacteremia, since N×10⁰ target cells per milliliter of the blood samples could be detected after a 12-h pre-enrichment. Compared to the multiplex PCR method, this approach has the additional advantage that it allowed the discrimination of more bacterial strains—even some bacterial strains that may generate PCR products with the same molecular sizes.

Introduction

S taphylococcus spp., including S. aureus, S. intermedius, S. hyicus, S. epidermidis, S. saprophyticus, S. haemolyticus, S. xylosus, and S. carnosus, are important bacterial species associated with food poisoning, and human and veterinary clinics. S. aureus, a major bacterial pathogen in clinical infection, is generally coagulase-positive (Fox et al., 1996). It plays a major role in food poisoning cases due to its ability to produce staphylococcal enterotoxins (SEs) (Argudín et al., 2010). S. aureus is also a common causative agent in bovine mastitis. Other coagulase-positive staphylococci (CPS), including S. intermedius and S. hyicus, have been reported to cause mastitis in cattle (Hazarika et al., 1991). S. intermedius is also a zoonotic pathogen (Tanner et al., 2000). Coagulase-negative staphylococci (CNS), including S. epidermidis, S. saprophyticus, and S. haemolyticus, are often recognized as major nosocomial pathogens related to bacteremia and urinary tract infection (Huebner and Goldmann, 1999; Elouennass et al., 2008; Raz et al., 2005; Ben-Ami et al., 2003). In contrast, other CNS, including S. xylosus and S. carnosus, which have been used as starter culture in the fermented meat, are considered non-pathogenic (Leroy et al., 2006). However, recent study in comparative genomics has revealed that S. xylosus is potentially pathogenic (Dordet-Frisoni et al., 2007).

Diagnosis of these staphylococcal species isolated from food poisoning cases and clinical samples is important. Accurate determination of the sources and specific infection control measures often require accurate species level identification. Phenotypic identification methods have been developed for the identification of staphylococci, such as the methods using API ID 32 Staph (bioMérieux, Marcy l'Etoile, France) or the Vitek system (bioMérieux). However, Zadoks and Watts (2009) reported that these phenotypic methods have lower typeability and accuracy.

Various molecular markers, including 16S rDNA (Couzinet et al., 2005), ITS (Couto et al., 2001), hsp60 (Kwok and Chow, 2003), tuf (Martineau et al., 2001), sodA (Poyart et al., 2001; Giammarinaro et al., 2005), femA (Hamels et al., 2001), and rpoB genes (Drancourt and Raoult, 2002), have been used for the identification of staphylococci. Biochips are a powerful tool for the parallel detection of multiple targets in microbial diagnosis in a relatively short time. Couzinet et al. (2005) evaluated the ability of a Staphylococcus DNA chip (BioMérieux) based on 16S rDNA. Notably, S. saprophyticus could not be correctly identified due to the limited differences between 16S rDNA sequences. Giammarinaro et al. (2005) developed an oligonucleotide array targeting the sodA gene for the staphylococcal identification. However, in their study, other bacterial species that contain sodA gene (e.g., Enterococcus, Streptococcus, Pasteurella, and Mycobacterium spp.) were not tested. Moreover, identification of target bacteria by using specific pattern with multiple probes may be problematic if multiple bacterial strains were presented in the sample.

In our previous work, we developed a chromogenic macroarray system for the simultaneous detection of SEs A, B, C, D, E, and G (Lin et al., 2009). We also constructed a 16S rDNA-based array for the rapid diagnosis of food pathogens, mostly at the genus level (Chiang et al., 2006). Kärenlampi et al. (2004) indicated that a heat shock protein family gene, groEL, could be more suitable than 16S rDNA in species discrimination. Therefore, we focused on heat shock protein family gene, groESL, including groES, groEL, and the intergenic region of groES-groEL (IGR), to develop PCR primers and probes for the simultaneous identification of S. aureus, S. intermedius, S. hyicus, S. epidermidis, S. saprophyticus, S. haemolyticus, S. xylosus, and S. carnosus.

Methods

Bacterial strains and cell cultivation

Bacterial strains used in this study are listed in Table 1. Bacterial cells were cultivated as previously described (Chiang et al., 2006).

Table 1.

Specificity of the Target Primer Sets and the Bacterial Strains Used in This Study

	PCR result with
	S. aureus	S. intermedius	S. hyicus	S. epidermidis	S. saprophyticus	S. haemolyticus	S. xylosus	S. carnosus	Consensus primer
Strains/source	S.aur-F/R	S.int-F/R	S.hyi-F/R	S.epi-F/R	S.sap-F/R	S.hae-F/R	S.xyl-F/R	S.car-F/R	universal-F/R
S. aureus (ATCC 700699; BCRC 10782, 12652, 12654, 12656, 12657, 13824, 13825, 13826, 13827, 13828, 13829, 13830, 13831)	+	−	−	−	−	−	−	−	+
S. intermedius (BCRC 15236, 15235)	−	+	−	−	−	−	−	−	+
S. hyicus (BCRC 12925)	−	−	+	−	−	−	−	−	+
S. epidermidis (ATCC 12228; BCRC 10785, 11030, 15246, 17069)	−	−	−	+	−	−	−	−	+
S. saprophyticus (ATCC 15305; BCRC 10786, 13977)	−	−	−	−	+	−	−	−	+
S. haemolyticus (BCRC 12923, 15237, 15240)	−	−	−	−	−	+	−	−	+
S. xylosus (BCRC 15252, 15253, 15442)	−	−	−	−	−	−	+	−	+
S. carnosus (BCRC 12922, 12924)	−	−	−	−	−	−	−	+	+
S. warneri (BCRC 12929)	−	−	−	−	−	−	−	−	+
Other non-target staphylococci S. cohni (BCRC 12155) S. simulans (BCRC 10778, 12928) S. lentus (BCRC 12926) S. sciuri (BCRC 12927)	−	−	−	−	−	−	−	−	−
Non-target bacteria strains including the following:	−	−	−	−	−	−	−	−	−
Acinetobacter calcoaceticus (BCRC 11562), Acinetobacter baumannii (BCRC 15556, 15318), Alcaligenes faecalis (BCRC 10828), Bacillus cereus (BCRC 10250, 11837, 14195), Brevibacterium linens (ATCC 19391), Clostridium perfringens (BCRC 16152), Clostridium butyricum (BCRC 11665), Clostridium celatum (BCRC 14521), Clostridium nexile (BCRC 14523), Clostridium haemolyticum (BCRC 10643), Clostridium haemolyticum (BCRC 10643), Corynebacterium minutissimum (BCRC 14870), Corynebacterium cystitidis (BCRC 12320), Corynebacterium pseudotuberculosis (BCRC 14872), Corynebacterium renale (BCRC 10657), Corynebacterium matruchotii (BCRC 14869), Corynebacterium variabile (BCRC 14862), Corynebacterium flavoscens (BCRC 12131), Corynebacterium glutamicum (BCRC 10027), Citrobacter freundii (BCRC 12291), Enterobacter cloacae (BCRC 11507, 10401, 12831), Enterobacter aerogenes (BCRC 17147, 15630, 10370), Enterobacter amnigenus (BCRC 13987), Enterobacter gergoviae (BCRC 17150), Enterobacter intermedius (BCRC 14808), Escherichia coli (BCRC 14825, 14824, 13084), Hafnia alvei (BCRC 10906), Kurthia gibsonii (BCRC 17033), Kluyvera ascorbata (BCRC 11645), Klebsiella pneumonia (BCRC 10692), Kocuria rosea (BCRC 11577), Klebsiella pneunoniae (BCRC 10692), Listeria ivanovii (BCRC 15383), Listeria seeligeri (BCRC 15361), Listeria welshimeri (BCRC 15362), Lactobacillus acidophilus (BCRC 14079), Lactobacillus casei (BCRC 14084), Lactobacillus delbrueckii subsp. Lactis (BCRC 12256), Neisseria meningitides (BCRC 10714), Neisseria mucosa (BCRC 10716), Serratia entomophila (BCRC 15867), Serratia marcescens (BCRC 11576, 12832, 12833), Serratia liquefaciens (BCRC 19989), Serratia rubidaea (BCRC 13990), Shigella flexneri (BCRC 10772), Shigella sonnei (BCRC 10773, 10774), Shigella boydii (BCRC 15959), Streptococcus pneumoniae (BCRC 10794), Plesiomonas shigelloides (BCRC 14120), Proteus vulgaris(ATCC 8427), Vibrio mimicus (BCRC 14690), Vibrio vulnificus (BCRC 12905), Vibrio fluvialis (BCRC 12830), Vibrio furnisii (BCRC 15889), Yersinia enterocolitica (BCRC 10807, 12986, 13999), and Yersinia ruckeri (BCRC 14124).

ATCC, American Type Culture Collection (Manassas, VA); BCRC, Bioresource Collection and Research Center (Hsin-Chu, Taiwan).

DNA preparation

Bacterial genomic DNAs were prepared using the GeneMark Tissue & Cell Genomic DNA Purification Kit (Hopegen Biotechnology, Taichung, Taiwan). Cells collected (15,700×g for 5 min) from 1 mL of culture broth were washed twice with 1 mL of double deionized water and pelleted (15,700×g for 5 min). The pellet was suspended in 250 μL of lysostaphin buffer, followed by addition of 1 μL of lysostaphin (50 mg/mL; AMBI Products LLC, Lawrence, NY) and 10 (L of lysozyme (10 mg/mL; Sigma, St. Louis, MO). The mixture was incubated at 37°C for 120 min. After incubation, total DNA was extracted according to the manufacturer's manual.

PCR primers and probes design

PCR primers were designed from staphylococcal groESL gene sequences using the Primer Premier 5.0 software (PREMIER Biosoft, Palo Alto, CA). Sequences of groESL gene were aligned with other bacterial heat shock protein gene sequences available in GenBank using basic local alignment search tool (http://www.ncbi.nlm.nih.gov/BLAST). For those sequences not available in GenBank such as S. intermedius, S. hyicus, and S. xylosus, PCR primers (seq-F: 5’-CCRATTTCTTCATCWGCWGC-3’; seq-R: GCWAAAGAYAAYTCDAARG- AAGG) were designed from conserved region of groESL gene for sequencing purpose.

After alignment, unique sequences were selected and primers for each Staphylococcus spp. were designed. The consensus primers, universal-F/R, were degenerate primers used to co-amplify all the groESL genes for these eight Staphylococcus spp. (Table 2).

Table 2.

Polymerase Chain Reaction (PCR) Primer Sets and the Macroarray Probes Used in This Study

Target organism	Primer set	Oligonucleotide sequence (5’ to 3’)	Predicted size of PCR product	GenBank accession number
S. aureus	S.aur-F/R	F/CTTCTAATTCGATTTCTTTAG R/CTAAACAAATGGAGGTTTATC Probe/ACTAAACAAATGGAGGTTTATCTTTTTTTTTTTTTTTTTT	212 bp	BA000017.4
S. intermedius	S.int-F/R	F/TCTATTACCTCCGTTGTTGG R/CGTCTCAAACCTGAACTCAAC Probe/CCAACAACGGAGGTAATAGATTTTTTTTTTTTTTTTTTTT	179 bp	This study
S. hyicus	S.hyi-F/R	F/GCAAGTCTTATATGTACCAAGCG R/TGCGTTGACCATTATCAAGAAT Probe/TTTTTTTTTTTTTTTTTCGCTTGGTACATATAAGACTTGC	192 bp	This study
S. epidermidis	S.epi-F/R	F/GATTGTGCTAAAACTGTTGCTG R/TAATAAGTGGAGGTTGTTTAGAC Probe/TTTTTTTTTTTTTTTTAATAAGTGGAGGTTGTTTAGACTT	314 bp	AE015929.1
S. saprophyticus	S.sap-F/R	F/GTTCTCGTGTTGCTCCTG R/ACCTCCATGTTGTTTCTATG Probe/TAATTATCATAGAAACAACATGGAGGTATTTTTTTTTTTT	190 bp	AP008934.1
S. haemolyticus	S.hae-F/R	F/GACAATGGTGAAAAGGTTGC R/GATTATACCTCCATTGTTTAAAAT Probe/TTTTTTTTTTTTTTTTATTTAAACAATGGAGGTATAATCA	204 bp	AP006716.1
S. xylosus	S.xyl-F/R	F/CGCCATATTACTTATACCTCC R/AAGGCGATAATGTAGTATTTCA Probe/CAATAAAACATCATGGAGGTATAAGTAATTTTTTTTTTTTTTTTTTTTTT	180 bp	This study
S. carnosus	S.car-F/R	F/TAGCCTCCTGTATTTGTATTA R/CAGTGAAGTGCAAGTAGGAG Probe/TTTTTTTTTTTTTTTTAAAATATAGCCTCCTGTATTTGTA	108 bp	AM295250.1
Consensus primer	universal-F/R	F/Biotin-CACCACGTAACATWGMTTGWC R/Biotin-TCGTGTTCCAACAATWYGCTGG Probe for positive control/TTTTTTTTTTTTTTTTTTTTAARTTYTCTGAAGATGCRCG	225 bp	-

The selected primers were modified as oligonucleotide probes in the array. Modifications include addition of thymine bases and adjustment of antiparallel sequences. Thymine bases were added to either 5’-end or 3’-end of the probes to obtain a 40-mer probe except of the probe for S. xylosus (50 mer). As for hybridization positive control, degenerate probe was used for simultaneous detection of these eight Staphylococcus spp. based on the alignment result.

Specificity of PCR primers

Specificity of each primer set was tested with DNA isolated from baterial strains listed in Table 1. Each PCR primer set was used in a single PCR reaction containing 200 μM concentration of each deoxynucleotide triphosphate, 1×PCR buffer (PROtech Technology Enterprise Co., Ltd., Taipei, Taiwan), 0.4 μM of each primers, 0.4 U Prozyme (PROtech Technology), ∼150–200 ng of bacterial DNA and double deionized water to a final volume of 25 μL. PCR conditions in a thermal cycler (Gene Amp PCR system 2720; Applied Biosystems, Carlsbad, CA) were as follows: an initial denaturation at 94°C for 5 min followed by 35 cycles of amplification at 94°C for 30 s, annealing at 50°C for 30 s; extension at 72°C for 30 s, and a final extension at 72°C for 5 min. The amplified products were analyzed by electrophoresis.

Detection limit of specific PCR primers

Commercial whole milk samples purchased from the markets were used to determine the detectable level of target organism contaminated in milk samples. As for clinical samples, urine and blood samples obtained from our laboratory personnel were used. Blood samples were collected with BD Vacutainer K2 EDTA (Becton, Dickinson and Company, Sparks, MD). Urine samples were autoclaved prior to further tests.

Twenty-five milliliters of the abovementioned samples was well mixed with 225 mL of 0.1% peptone water. One hundred microliters of the 10-fold serial dilutions (10⁻⁴ to 10⁻⁸) of the overnight culture of one of the target strains (N×10⁹ CFU/mL) as listed in Table 1 was mixed with 1 mL of the above described mixture, followed by addition of 8.9 mL of TSB broth. Afterwards, 1 mL of the abovementioned mixture with or without an 8-h pre-enrichment at 37°C was used for DNA extraction according to the methods described above.

PCR followed by macroarray for detection of staphylococci

5’-ends of the consensus primers, universal-F/R, were labeled with biotin and then were subjected to PCR amplification. These biotin-labeled PCR products were used in macroarray tests.

For macroarray construction, 25 μL of each oligonucleotide probe (∼20–40 μM) was mixed with 25 μL of 2×probe solution (DR. Chip Biotech, Hsin-Chu, Taiwan). It was then spotted onto the plastic chip (Dr. Chip Biotech) by using the MicroArrayer Ezspot SR-A300 (Shuai Ran Precision, Taoyuan Hsien, Taiwan). Positive control using the biotin-labeled primers only and the negative controls using water only were also included. The spotted DNA was then cross linked onto the plastic chip by ultraviolet (UV) irradiation at 254 nm/0.6–1.2 joules.

For hybridization, 25 μL each of the biotin-labeled PCR products was denatured at 95°C for 10 min and immediately ice-bathed for 5 min. Afterwards, 200 μL of DR. Hyb^™ Buffer (DR. Chip Biotech) and the denatured PCR products were loaded into a chip chamber well. Hybridization was performed for 30 min at 45°C with gentle vibration in the DR. Mini Oven (DR. Chip Biotech).

Wash steps and chromogenic reaction were performed as previously described (Lin et al., 2009). Afterwards, the hybridization signals were scanned by DR. AiM^™ Reader (DR. Chip Biotech). Seeded milk or clinical samples with known levels of target bacterial strain were used for evaluation of the detection sensitivity and specificity of the macroarray. DNA was extracted from the samples followed by PCR and array hybridization.

Results

Specificity and detection limit of the PCR primers

To evaluate the specificity, the primers S.aur-F/R, S.int-F/R, S.hyi-F/R, S.epi-F/R, S.sap-F/R, S.hae-F/R, S.xyl-F/R, and S.car-F/R, respectively, were tested with bacterial strains listed in Table 1. All primers used in this study generated amplicons with expected sizes. No false positive result was observed. Thus, it was apparent that all primers provided a specific means to detect corresponding target strains of staphylococci.

The conserved region for groESL gene was used to design the consensus primers, universal-F/R. The degenerate bases were used in the consensus primers as a pool to amplify all these eight Staphylococcus spp. in any possible combination. S. aureus, S. intermedius, S. hyicus, S. epidermidis, S. saprophyticus, S. haemolyticus, S. xylosus, and S. carnosus generated positive results. The non-target strain of S. warneri also generated positive results (Fig. 1). The expected size of 225 bp with primers universal-F/R was based on the sequence from S. aureus (GenBank accession no. BA000017.4). Since the length of the intergenic regions, groESL, from different species of staphylococci varies, the molecular sizes of amplicons from these eight Staphylococcus spp. differ slightly. Other non-target bacterial strains including non-target staphylococci such as S. simulans and S. cohnii produced negative results.

FIG. 1.

Detection of the target staphylococcal strains in milk samples using consensus primers universal-F/R. Experimental conditions were as described in Methods. (Lane M) 100-bp ladder marker (PROtech Technology). (Lane 1) Negative control. (Lanes 2—9) Polymerase chain reaction (PCR) products amplified from target strains of S. aureus ATCC 700699 (225 bp), S. epidermidis BCRC 12228 (203 bp), S. saprophyticus ATCC 15305 (213 bp), S. haemolyticus BCRC 15240 (212 bp), S. carnosus BCRC 12922 (189 bp), S. hyicus BCRC 12925 (230 bp), S. intermedius BCRC 15235 (203 bp), and S. xylosus BCRC 15442 (217 bp) in milk sample, respectively. (Lanes 10–12) Results from non-target strains of S. cohnii BCRC 12155, S. warneri BCRC 12929, and S. simulans BCRC 10778 in milk sample, respectively. Non-target strain of S. warneri also generates positive results.

The detection limit of the PCR primers for milk samples was evaluated by inoculating with known levels of target bacterial strains (Table 3). The expected PCR product could be obtained from N×10³CFU/mL of the milk samples without enrichment. The detection limit of the consensus primers was also evaluated. Results showed that the expected PCR product could be obtained from N×10³CFU/mL of staphylococci in spiked milk or urine samples, or N×10⁵CFU/mL of staphylococci in blood samples.

Table 3.

Detection Limit of the Polymerase Chain Reaction (PCR) Methods Used in This Study

	Pure culture (CFU/mL)		Milk samples (CFU/mL)
Strain	Without enrichment	With enrichment	Without enrichment	With enrichment
S. aureus	N×10³	N×10⁰	N×10⁴	N×10⁰
S. intermedius	N×10³	N×10⁰	N×10⁴	N×10⁰
S. hyicus	N×10³	N×10⁰	N×10³	N×10⁰
S. epidermidis	N×10³	N×10⁰	N×10⁴	N×10⁰
S. saprophyticus	N×10³	N×10⁰	N×10³	N×10⁰
S. haemolyticus	N×10³	N×10⁰	N×10³	N×10⁰
S. xylosus	N×10³	N×10⁰	N×10³	N×10⁰
S. carnosus	N×10³	N×10⁰	N×10³	N×10⁰
Consensus primer	N×10³	N×10⁰	N×10³	N×10⁰

Specificity and detection limit for macroarray

Macroarray was constructed by spotting the oligonucleotide probes listed in Table 2 for specific detection of these eight Staphylococcal species. Allocation of the probes and interpretation of patterns of macroarray were demonstrated in Figure 2. Negative controls without PCR products or probe (buffer only) gave negative results (100%). Meanwhile, chromogenic positive controls and hybridization positive controls were included in the chips. The hybridization patterns were in compliance with designed patterns either from pure culture or artificially spiked milk sample (Figs. 2 and 3). No non-specific hybridization signal was observed. Thus, it is apparent that our macroarray provides a very specific means to detect these staphylococci.

FIG. 2.

Detection of the staphylococci using the macroarray. Conditions for the macroarray hybridization were as described in Methods. (1) Allocation for specific oligonucleotide probes on the macroarray. Probes were as listed on Table 2. Positive and negative controls were also included. (2—9) Hybridization results from different bacterial strains. Each target strain generated specific hybridization patterns, respectively.

FIG. 3.

Simultaneous detection of multiple target staphylocci in milk samples using the microarray. (1) Hybridization result from milk sample artificially spiked with S. aureus and S. intermedius. Hybridization pattern was in compliance with the target staphylococci in milk sample. (2—6) Hybridization result with multiple targets in milk samples. Allocation for specific oligonucleotide probes on the macroarray was as shown in (1).

The detection limit of the array was also evaluated using artificially contaminated samples spiked with different levels of bacterial cells (Table 4). For milk and urine samples, the detection limit was N×10² CFU/mL without the enrichment. To improve the detection limits, an 8-h enrichment step was performed prior to the PCR followed by macroarray. Under such conditions, the detection limit was N×10⁰ CFU/mL. With the use of macroarray, the detection limit could be improved by one logarithmic scale, at least, in comparison with PCR methods. As for blood samples, the detection limit of the array varied from N×10³ CFU/mL to N×10⁵ CFU/mL. Even with an 8-h enrichment, the detection limit could barely reach N×10² CFU/mL. Hence we further extended the time of enrichment to 12 h; it was found that the detection limit could reach N×10⁰ CFU/mL, which will suffice in the diagnosis of bacteremia.

Table 4.

Detection Limit of the Macroarray Method Used in This Study

	Pure culture (CFU/mL)		Milk samples (CFU/mL)		Urine samples (CFU/mL)		Blood samples (CFU/mL)
Strain	Without enrichment	With enrichment^a	Without enrichment	With enrichment^a	Without enrichment	With enrichment^a	Without enrichment	With enrichment^b
S. aureus	N×10²	N×10⁰	N×10²	N×10⁰	N×10²	N×10⁰	N×10³	N×10⁰
S. intermedius	N×10²	N×10⁰	N×10²	N×10⁰	N×10²	N×10⁰	N×10⁵	N×10⁰
S. hyicus	N×10²	N×10⁰	N×10²	N×10⁰	N×10²	N×10⁰	N×10⁴	N×10⁰
S. epidermidis	N×10²	N×10⁰	N×10²	N×10⁰	N×10²	N×10⁰	N×10³	N×10⁰
S. saprophyticus	N×10²	N×10⁰	N×10²	N×10⁰	N×10²	N×10⁰	N×10⁵	N×10⁰
S. haemolyticus	N×10²	N×10⁰	N×10²	N×10⁰	N×10²	N×10⁰	N×10⁵	N×10⁰
S. xylosus	N×10²	N×10⁰	N×10²	N×10⁰	N×10²	N×10⁰	N×10⁴	N×10⁰
S. carnosus	N×10²	N×10⁰	N×10²	N×10⁰	N×10²	N×10⁰	N×10⁵	N×10⁰

8-h enrichment.

12-h enrichment.

Discussion

In our previous work, we developed a 16S rDNA-based array for the rapid diagnosis of Staphylococcus spp. and non-staphylococcal species, including Bacillus spp., E. coli, Salmonella spp., and Vibrio spp. (Chiang et al., 2006). However, detection of the target bacteria at the species level is required to fulfill the diagnostic need. Thus, we aimed to establish an array for simultaneous detection of major staphylococcal species.

Our previous studies showed that heat shock protein gene may be used in the molecular diagnosis of microorganisms, e.g., hsp70, hsp40, and hsp10 in Streptococcus agalactiae, Strept. Uberis, and Strept. bovis (Chiang et al., 2008); htrA in S. aureus (Chiang et al., 2007); and tuf in Bifidobacterium species (Sheu et al., 2010) and in B. longum, Lactobacillus acidophilus, L. casei group, and L. delbrueckii (Sheu et al., 2009). Therefore, we focused on heat shock protein family gene, groESL. Alignment of groESL sequences from major Staphylococcus spp. showed it is possible to design specific DNA probes and primers at the species level. Unique sequences were selected as primers for each Staphylococcus spp. (Table 2). PCR was performed to confirm the specificity of these sequences for the use as probes to detect S. aureus, S. intermedius, S. hyicus, S. epidermidis, S. saprophyticus, S. haemolyticus, S. xylosus, and S. carnosus. No interference was observed; this indicates these primers could be individually used as a specific means to detect corresponding target strains of these staphylococci. However, sizes of these PCR products are close (e.g., the difference in the PCR products between S. intermedius and S. xylosus is only 1 bp). It would be difficult to integrate these primers into a single multiplex PCR system. Macroarray could be used for simultaneous detection of multiple targets; more importantly, it allowed us to discriminate the bacterial strains which may generate the PCR products with the same or close molecular sizes. Thus, a macroarray was constructed by spotting these unique sequences. The conserved region for groESL gene was used to design consensus primers to co-amplify the unique sequences. Each target strain of staphylococci generated a specific hybridization pattern. From the homogenization of milk sample, the pre-enrichment step, to the signal observation, results could be obtained within 24 h. Compared to the identification of a target bacterial strain with multiple probes, the use of single probe to each target allowed us to discriminate these eight staphylococci easily, even in the presence of multiple targets (Fig. 3).

The consensus primers were aimed to co-amplify these eight Staphylococcus spp. only. There was amplicon produced from another CNS, such as S. warneri. However, there was no interference from S. warneri in the amplification with species-specific primers designed in this study, e.g., S.aur-F/R, S.int-F/R. Furthermore, no interference was observed from S. warneri in our macroarray system. One advantage of the macroarray is the capacity of expanding targets. Thus, it is possible to detect more Staphylococcus spp., e.g., S. warneri, if suitable probe is found. Also, it is possible to combine this macroarray with our previous work (Lin et al., 2009) to develop a macroarray of detecting SEs and Staphylococcus spp. Simultaneously, since these eight Staphylococcus spp. are enterotoxin producers (Bautista et al., 1988; Becker et al., 2001; Oliveira et al., 2010; Valle et al., 1990; Zell et al., 2008).

Recently, complete genome sequence of S. pseudintermedius HKU10-03, one of the S. intermedius group (SIG), has been revealed (Tse et al., 2011). Alignment result indicates that S.int-F/R also amplifies S. pseudintermedius HKU10-03. High similarity in the groESL genes between S. pseudintermedius and S. intermedius makes it difficult to differentiate these two strains. This may require further investigation into SIG.

Brown and Anthony (2000) demonstrated that the intensity of hybridization signal could be enhanced by adding thymine bases to the 3’-end of the probes. In this study, we modified the designed probes either on the 3’-end or 5’-end to obtain the 40-mer probes except of the probe for S. xylosus (50-mer). It was found that some 5’-end labeled probes also generated a stronger hybridization signal as compared with the results obtained from the 3’-labeled probe. By comparing the hybridization signal, the modified probes with stronger signal were chosen. Thus, 5’-end labeled probes were used for hybridization positive control and the detection of S. hyicus, S. epidermidis, S. haemolyticus, and S. carnosus. As for S. aureus, S. intermedius, S. saprophyticus, and S. xylosus, 3’-end labeling was performed. The addition of thymine bases also enabled the adjustment of the probe length to 40-mer; thus, similar melting temperatures of each probe could be achieved. For S. xylosus, a 50-mer probe was used since 40-mer probe did not produce acceptable signal.

The signal detection system in our macroarray combines the use of streptavidin conjugated-alkaline phosphatase and NBT/BCIP as substrate. This simple chromogenic reaction allows the hybridization signals to be read by untrained personnel via the naked eye or to be processed by the computerized system with a compatible reader (DR. AiM^™ Reader), which uses a charge-coupled device. The signal detection system in the Staphylococcus DNA chip developed by BioMérieux uses florescent dye, requires a confocal laser scanner and corresponding analysis software, and is costly. Our system provides a more cost-effective signal detection than the florescent system.

The plastic chips used in this study provide convenience in storage compared to the nitrocellulose paper, a commonly used matrix in the macroarray system (Chiang et al., 2006). Furthermore, the signals in the plastic chips showed good roundness, superb uniformity, and lower background signals than those in the nylon membrane. In addition, the plastic chip used in this study is economically feasible compared to the nitrocellulose paper. With standardized reagents, the whole system can be easily commercialized into a diagnostic kit. The use of the reader also provides flexibility for being modularized into an automated system.

Conclusion

In conclusion, we have successfully developed a macroarray system for simultaneous detection of eight major Staphylococcal species contaminated in milk products or in the clinical samples; the results could be obtained within 24 h, including the enrichment step. In addition, the PCR primers developed in this study could be individually used for the detection of each target staphylococci. Such PCR and macroarray methods could be used for the rapid identification of these staphylococci contaminated in milk products or in the clinical samples. This system may be used for human and animal epidemic disease study, and for quality control in food and dairy industries.

Footnotes

Acknowledgments

This project was supported by the National Science Council, Taipei, Taiwan (grant 97-2313-B-241-005-MY3 1-3).

Disclosure Statement

No competing financial interests exist.

References

Argudín

MÁ

, Mendoza

, Rodicio

et al. Food poisoning and Staphylococcus aureus enterotoxins. Toxins, 2010; 2:1751–1773.

Bautista

, Gaya

, Medina

, Nuñez

et al. A quantitative study of enterotoxin production by sheep milk staphylococci. Appl Environ Microbiol, 1988; 54:566–569.

Becker

, Keller

, von Eiff

, Brück

, Lubritz

, Etienne

, Peters

et al. Enterotoxigenic potential of Staphylococcus intermedius. Appl Environ Microbiol, 2001; 67:5551–5557.

Ben-Ami

, Navon-Venezia

, Schwartz

, Carmeli

et al. Infection of a ventriculoatrial shunt with phenotypically variable Staphylococcus epidermidis masquerading as polymicrobial bacteremia due to various coagulase-negative Staphylococci and Kocuria varians. J Clin Microbiol, 2003; 41:2444–24447.

Brown

, Anthony

. The addition of low numbers of 3′ thymine bases can be used to improve the hybridization signal of oligonucleotides for use within arrays on nylon supports. J Microbiol Methods, 2000; 42:203–207.

Chiang

, Fan

, Liao

, Lin

, Tsen

et al. Real-time PCR detection of Staphylococcus aureus in milk and meat using new primers designed from the heat shock protein gene htrA sequence. J Food Prot, 2007; 70:2855–2859.

Chiang

, Pai

, Chen

, Tsen

et al. Use of primers based on the heat shock protein genes hsp70, hsp40, and hsp10, for the detection of bovine mastitis pathogens Streptococcus agalactiae, Streptococcus uberis and Streptococcus bovis. Mol Cell Probes, 2008; 22:262–266.

Chiang

, Yang

, Li

, Ho

, Lin

, Tsen

et al. Identification of Bacillus spp., Escherichia coli, Salmonella spp., Staphylococcus spp. and Vibrio spp. with 16S ribosomal DNA-based oligonucleotide array hybridization. Int J Food Microbiol, 2006; 107:131–137.

Couto

, Pereira

, Miragaia

, Sanches

, de Lencastre

et al. Identification of clinical staphylococcal isolates from humans by internal transcribed spacer PCR. J Clin Microbiol, 2001; 39:3099–3103.

10.

Couzinet

, Jay

, Barras

, Vachon

, Vernet

, Ninet

, Jan

, Minazio

, Francois

, Lew

, Troesch

, Schrenzel

et al. High-density DNA probe arrays for identification of staphylococci to the species level. J Microbiol Methods, 2005; 61:201–208.

11.

Dordet-Frisoni

, Dorchies

, De Araujo

, Talon

, Leroy

et al. Genomic diversity in Staphylococcus xylosus. Appl Environ Microbiol, 2007; 73:7199–7209.

12.

Drancourt

, Raoult

. rpoB gene sequence-based identification of Staphylococcus species. J Clin Microbiol, 2002; 40:1333–1338.

13.

Elouennass

, Sahnoun

, Zrara

, Bajjou

, Elhamzaoui

et al.

Epidemiology and susceptibility profile of blood culture isolates in an intensive care unit (2002–2005)

Med Mal Infect, 2008; 38:18–24.

14.

Fox

, Besser

, Jackson

et al. Evaluation of a coagulase-negative variant of Staphylococcus aureus as a cause of intramammary infections in a herd of dairy cattle. J Am Vet Med Assoc, 1996; 209:1143–1146.

15.

Giammarinaro

, Leroy

, Chacornac

, Delmas

, Talon

et al. Development of a new oligonucleotide array to identify staphylococcal strains at species level. J Clin Microbiol, 2005; 43:3673–3680.

16.

Hamels

, Gala

, Dufour

, Vannuffel

, Zammatteo

, Remacle

et al. Consensus PCR and microarray for diagnosis of the genus Staphylococcus, species, and methicillin resistance. Biotechniques, 2001; 31:1364–13661368,1370–1372.

17.

Hazarika

, Mahanta

, Dutta

, Devriese

et al. Cutaneous infection associated with Staphylococcus hyicus in cattle. Res Vet Sci, 1991; 50:374–375.

18.

Huebner

, Goldmann

. Coagulase-negative staphylococci: Role as pathogens. Annu Rev Med, 1999; 50:223–236.

19.

Kärenlampi

, Tolvanen

, Hänninen

et al. Phylogenetic analysis and PCR-restriction fragment length polymorphism identification of Campylobacter species based on partial groEL gene sequences. J Clin Microbiol, 2004; 42:5731–5738.

20.

Kwok

, Chow

. Phylogenetic study of Staphylococcus and Macrococcus species based on partial hsp60 gene sequences. Int J Syst Evol Microbiol, 2003; 53:87–92.

21.

Leroy

, Verluyten

, De Vuyst

et al. Functional meat starter cultures for improved sausage fermentation. Int J Food Microbiol, 2006; 106:270–285.

22.

Lin

, Chiang

, Tsen

et al. Development and use of a chromogenic macroarray system for the detection of Staphylococcus aureus with enterotoxin A, B, C, D, E, and G genes in food and milk samples. Foodborne Pathog Dis, 2009; 6:445–452.

23.

Martineau

, Picard

, Ke

, Paradis

, Roy

, Ouellette

, Bergeron

et al. Development of a PCR assay for identification of staphylococci at genus and species levels. J Clin Microbiol, 2001; 39:2541–2547.

24.

Oliveira

, Miya

, Sant'Ana

, Pereira

et al. Behavior and enterotoxin production by coagulase negative Staphylococcus in cooked ham, reconstituted skimmed milk, and confectionery cream. J Food Sci, 2010; 75:M475–M481.

25.

Poyart

, Quesne

, Boumaila

, Trieu-Cuot

et al. Rapid and accurate species-level identification of coagulase-negative staphylococci by using the sodA gene as a target. J Clin Microbiol, 2001; 39:4296–4301.

26.

Raz

, Colodner

, Kunin

et al.

Who are you–Staphylococcus saprophyticus?

Clin Infect Dis, 2005; 40:896–898.

27.

Sheu

, Hwang

, Chen

, Chiang

, Tsen

et al. Development and use of tuf gene-based primers for the multiplex PCR detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum in commercial dairy products. J Food Prot, 2009; 72:93–100.

28.

Sheu

, Hwang

, Chiang

, Lin

, Chen

, Tsen

et al. Use of tuf gene-based primers for the PCR detection of probiotic Bifidobacterium species and enumeration of bifidobacteria in fermented milk by cultural and quantitative real-time PCR methods. J Food Sci, 2010; 75:M521–M527.

29.

Tanner

, Everett

, Youvan

et al. Molecular phylogenetic evidence for noninvasive zoonotic transmission of Staphylococcus intermedius from a canine pet to a human. J Clin Microbiol, 2000; 38:1628–1631.

30.

Tse

, Tsoi

, Leung

, Urquhart

, Lau

, Woo

, Yuen

et al. Complete genome sequence of the veterinary pathogen Staphylococcus pseudintermedius strain HKU10–03, isolated in a case of canine pyoderma. J Bacteriol, 2011; 193:1783–1784.

31.

Valle

, Gomez-Lucia

, Piriz

, Goyache

, Orden

, Vadillo

et al. Enterotoxin production by staphylococci isolated from healthy goats. Appl Environ Microbiol, 1990; 56:1323–1326.

32.

Zadoks

, Watts

. Species identification of coagulase-negative staphylococci: Genotyping is superior to phenotyping. Vet Microbiol, 2009; 134:20–28.

33.

Zell

, Resch

, Rosenstein

, Albrecht

, Hertel

, Götz

et al. Characterization of toxin production of coagulase-negative staphylococci isolated from food and starter cultures. Int J Food Microbiol, 2008; 127:246–251.