Characterization of Salmonella Food Isolates with Concurrent Resistance to Ceftriaxone and Ciprofloxacin

Abstract

Foodborne salmonellosis is an important public health problem worldwide. Most human Salmonella infections occur through the consumption of contaminated food of animal origin. The study reported the first isolation of two Salmonella enterica serovar Oranienburg strains from pork in China with concurrent resistance to ciprofloxacin and ceftriaxone. Both isolates also showed resistance to norfloxacin, trimethoprim-sulfamethoxazole, and chloramphenicol, and an elevated minimal inhibitory concentraton of azithromycin; one strain was also resistant to amikacin, gentamicin, tetracycline, and amoxicillin-clavulanic acid. Salmonella ceftriaxone resistance was due to the production of IncN plasmidborne CTX-M-14 ESBL, and their ciprofloxacin resistance was mediated by target mutations and efflux pump activity. This is the first time that ceftriaxone- and ciprofloxacin-resistant Salmonella was reported in meat products, which may be due to the uses of antibiotics in animal production. The study warrants the continuous surveillance of multidrug-resistant Salmonella in meat products and cautious use of antibiotics in food animals.

Introduction

F oodborne salmonellosis is an important public health problem worldwide and the leading cause of foodborne illnesses in many countries such as the United States and China (Gomez et al., 1997). Most human Salmonella infections occur through the consumption of contaminated food of animal origin, such as poultry, beef, pork, eggs, and milk (Gomez et al., 1997). Although antibiotics are not essential for the treatment of most cases of salmonellosis, they can be lifesaving in invasive infections, which normally occur in children and elderly people. Ceftriaxone and ciprofloxacin are the choices of treatment for invasive Salmonella infections in humans (Glynn et al., 1998; Hohmann, 2001). Resistance of quinolone and fluoroquinolone are often associated with point mutations at the Quinolone Resistance Determining Region (QRDR) of gyrA and parC (Hooper, 2001). In Salmonella, it is demonstrated that quinolone resistance often results from single mutation in gyrA, whereas fluoroquinolone resistance is always due to double mutation in gyrA and single mutation in parC (Chen et al., 2007). In addition to chromosomal mutation, plasmid-mediated quinolone resistance (PMQR), including derivatives of quinolone resistance proteins (Qnr), aminoglycoside acetyltransferase aac(6′)-Ib-cr, and quinolone efflux pump QepA, have also been described in quinolone- and fluoroquinolone-resistant Salmonella isolates (Nordmann and Poirel, 2005; Robicsek et al., 2006). Resistance to extended-spectrum β-lactams are mainly due to intracellular production extended-spectrum β-lactamases (ESBLs). CTX-M- and OXA-type β-lactamases are commonly reported in Enterobacteriaceae, in which CTX-M-14 and OXA-30 are discovered frequently in Salmonella (Antunes et al., 2004; Lewis et al., 2007). The increasing trend of ceftriaxone- or ciprofloxacin-resistant Salmonella infections, in particular in Asia, poses a huge threat to human health due to the limited choices of treatment. In this study, we report the first isolation of multidrug-resistant Salmonella enteric serovar Oranienburg with concurrent resistance to both ceftriaxone and ciprofloxacin from meat products in China.

Methods

Salmonella isolation

Meat products, including pork and chicken, were purchased from Guangdong Province, China and Hong Kong SAR. These samples were subjected to Salmonella isolation using selective XLT4 agar plates containing 16 μg/mL of ceftriaxone and 2 μg/mL of ciprofloxacin as previously described (Andrews et al., 2011). Salmonella isolates were confirmed by API20E (BioMerieux, Mercy, France) and polymerase chain reaction (PCR) assay targeting invA gene (Rahn et al., 1992). Serotyping of Salmonella was done by multiplex PCR approach as previously described (Kim et al., 2006).

Antimicrobial susceptibility testing

Antimicrobial susceptibility testing was performed on Salmonella isolates by agar dilution method and interpreted following Clinical and Laboratory Standards Institute (CLSI) instructions (CLSI, 2010). Fourteen antimicrobials were tested: nalidixic acid, ciprofloxacin, norfloxacin, ampicillin, amikacin, gentamicin, tetracycline, cefotaxime, ceftriaxone, ceftiofur, amoxicillin-clavulanic acid, trimethoprim-sulfamethoxazole, chloramphenicol, and meropenem. Azithromycin susceptibility was tested by broth microdilution method as previously described (Sjolund-Karlsson et al., 2011). Escherichia coli American Type Culture Collection (ATCC) 25922 and 35218, Enterococcus faecalis ATCC 29212, and Staphylococcus aureus ATCC 29213 were used as quality controls. Effect of efflux pumps on fluoroquinolone and cephalosporin susceptibility was assessed by determining minimal inhibitory concentration (MIC) on ciprofloxacin, norfloxacin, and ceftriaxone by broth microdilution method following CLSI instructions with the presence of an efflux pump inhibitor, phenylalanine arginine β-naphthylamide (PAβN) of a final concentration of 30 μg/mL (CLSI, 2010).

β-Lactamases, PMQRs, and QRDR mutation determination

The presence of ESBLs was determined using PCR assay targeting most of the β-lactamases as previously described (Dallenne et al., 2010). Full-length β-lactamase genes were amplified and sequenced by specific primers (Table 1). The QRDR of gyrA, gyrB, parC, and parE were amplified by PCR as previously described (Chen et al., 2007), sequenced, and then compared to the genes from wild-type Salmonella enterica serovar Typhimurium LT2 to determine the target gene mutations. The presence of PMQR genes, qnrA, qnrB, qnrC, qnrD, qnrS, qepA, oqxAB, and aac(6′)Ib-cr was determined by PCR using primers described previously (Chen et al., 2007; Deng et al., 2011b). Insertion sequences (ISs) were frequently detected upstream of ESBLs and responsible for the capture and mobilization of the antibiotic resistance genes. Forward primers targeting insertion sequences ISCR1, ISEcp1, and IS903, and reverse primer bla _CTX-M-14-R (Table 1) were used to determine the linkage of insertion sequence with bla _CTX-M-14. All PCR products were sequenced to confirm the correct sequence of the products.

Table 1.

Primers and Polymerase Chain Reaction (PCR) Procedures Used in This Study

Primer	Sequence (5′to 3′)	Expected size	PCR conditions
bla_CTX-M-14-F bla_CTX-M-14-R bla_OXA-1-F bla_OXA-1-R armA-F armA-R	TCGAATGGTGACAAAGAGAGTGCA TACTTTACAGCCCTTCGGCGATGAT GACTTTATAAATTTAGTGTGTTTA ACGTTATGAAAAACACAATACAT CAATCAGGGGCAGTTATCA CCCTATAACCTTCGAATC	875 829 529	95°C for 3min, (95°C 30s, 55°C 30s, 72°C 1min)× 30, 72°C for 10min
ISEcp1-F IS903-F ISCR1-F	CTGCAAACGGTGCTGCGGAA CGCAGCGTCAGTGAACCCCC AGACGCCGTGGAAGCGTGTG		95°C for 3min, (95°C 30s, 60°C 30s, 68°C 2.5min)× 30, 68°C for 10min

Plasmid replicon typing and conjugation experiment

Plasmids were isolated using Plasmid miniprep kit (Qiagen). Replicon typing of plasmids was performed by PCR-based method as previously described (Carattoli et al., 2005). Conjugation experiment was performed in Salmonella isolates using a sodium azide-resistant E. coli J53 as recipient strain as previously described (Jacoby et al., 2003). Transconjugants were selected on LB agar plates containing ceftriaxone (16 μg/mL) and sodium azide (100 μg/mL).

Pulsed-field gel electrophoresis (PFGE)

PFGE was performed following the PulseNet PFGE protocol for Salmonella using a Chef Mapper electrophoresis system (Bio-Rad, Hercules, CA) with pulse times of 2.16–63.8 s as previously described (Ribot et al., 2006). Clonal relatedness were analyzed by Bionumerics with the use of Dice coefficient and a parameter of 0.5% for optimization and band matching tolerance.

Results and Discussion

From April to August 2011, 330 and 150 pork and chicken samples were purchased from different supermarkets and farmer's markets in Guangzhou, China and Hong Kong, SAR, respectively. Two Salmonella isolates were obtained from two pork samples from Guangzhou, and no positive Salmonella was isolated from meat samples from Hong Kong. The two Salmonella isolates were designated as Salmonella S166 and S284, and were isolated at different times and markets in Guangzhou city. S166 was isolated from pork that originated from farm A, and S284 was from pork that originated from farm B. The serotype of these two Salmonella isolates was determined to be Salmonella enterica serovar Oranienburg. PFGE characterization of these two isolates showed 60% similarity and thus belonged to different PFGE types (Table 2).

Table 2.

Characteristics of Two Salmonella Oranienburg Isolated from Food

			QRDR mutations			Fluoroquinolones MICs (μg/mL)					Other antimicrobial MICs (μg/mL)
Strain	PFGE patterns	No. of plasmid	GyrA	ParC	β-lactamases	NAL	CIP	CIP+PAβN	NOR	NOR+PAβN	AMP	AMK	GEN	TEL	CTO	CTX	CRO	CRO+PAβN	AMC	SXT	CHL	AZR
S166	A	6	S83F, D87N	S80R	CTX-M-14, OXA-1	>64	>16	2	>64	8	>64	>128	>64	>32	>64	>64	>64	>64	16/8	>8/156	>64	≥64
S284	B	1	S83F, D87N	S80R	CTX-M-14, OXA-1	>64	>16	2	>64	16	>64	<8	<4	<4	>64	>64	>64	>64	8/4	>8/156	>64	≥64

PFGE, pulsed-field gel electrophoresis; NAL, nalidixic acid; CIP, ciprofloxacin; NOR, norfloxacin; AMK, amikacin; AMP, ampicillin; GEN, gentamicin; TEL, tetracycline; CTO, ceftiofur; CTX, cefotaxime; CRO, ceftriaxone; AMC, amoxicillin-clavulanic acid; SXT, trimethoprim-sulfamethoxazole; CHL, chloramphenicol; AZR, azithromycin; PAβN, phenylalanine arginine β-naphthylamide.

Both strains exhibited resistance to nine antimicrobials tested: ampicillin, cefotaxime, ceftriaxone, ceftiofur, nalidixic acid, ciprofloxacin, norfloxacin, trimethoprim-sulfamethoxazole, and chloramphenicol. Salmonella S166 also showed resistance to amikacin, gentamicin, amoxicillin-clavulanic acid, and tetracycline (Table 2).

Both Salmonella isolates were multidrug-resistant, and S166 showed only susceptibility to meropenem, a reserved antibiotic for severe clinical Gram-negative pathogen infections. Most significantly, both isolates showed concurrent resistance to both ceftriaxone and ciprofloxacin, which are current choices for treatment of human Salmonella clinical infections. Salmonella Choleraesuis that showed concurrent resistance to both ceftriaxone and ciprofloxacin has only been reported in a children's hospital in Taiwan, which was suggested to be due to the nosocomial uses of antibiotics (Chiu et al., 2004; Su et al., 2005). In this study, the isolation of multidrug-resistant Salmonella Oranienburg that showed concurrent resistance to both ceftriaxone and ciprofloxacin from meat products in China suggests a potential threat to human health. In addition, these two isolates showed a MIC of ≥64 μg/mL for azithromycin, which is increasingly being adopted for treating multidrug-resistant salmonellae infection. Currently, there is no established breakpoint of azithromycin for Enterobacteriaceae. A study investigating azithromycin susceptibility of clinical and environmental Salmonella isolates revealed that majority of Salmonella would have a MIC of 16 μg/mL (Sjolund-Karlsson et al., 2011). The relatively high azithromycin MIC showed by two isolates in this study warrants further researches on Salmonella azithromycin susceptibility. Furthermore, most of Salmonella can cause clinical infections and Salmonella Oranienburg identified in this study has been reported to cause foodborne illness outbreaks in the United States, Europe, and Asia (CDC, 2007; Kumao et al., 2002). Salmonella Oranienburg can cause invasive human infections and antibiotic treatment is necessary (Kumao et al., 2002). Therefore, the selection of Salmonella Oranienburg and maybe other more common serotype such as Salmonella enterica serovar Typhimurium and Salmonella enterica serovar Enteritidis in the future with concurrent resistance to both ciprofloxacin and ceftriaxone, which may result from the uses of antibiotics in food animals, can cause human health consequence in the future.

The antibiotic usage was investigated in the two farms where isolates was obtained in this study. Fluoroquinolones, such as ciprofloxacin, norfloxacin, and levofloxain have been used in these farms since 1980s for treatment and growth promotion purposes. Ceftiofur, one of the veterinary use β-lactam, has been used as disease treatment purpose since 2002 due to its high costs. However, due to the increasing trend of multidrug resistant animal pathogens, the uses of these two drugs are becoming more frequent and with higher doses in recent years, which may trigger the emergence of Salmonella with concurrent resistance to both ciprofloxacin and ceftriaxone. The antibiotic uses in animal production in China will keep increasing and the development of these double drug-resistant Salmonella will be speeding up. The consequence may be seen in near future.

Conjugation experiments were conducted for these two isolates using E. coli J53 as recipient strain. However, no successful transconjugants could be obtained. Plasmids were isolated from these two Salmonella isolates and showed different profiles. S166 contained several plasmids with different sizes, whereas S284 contained only one plasmid of ∼24kb that was also found in S166. This plasmid was purified from both strains through gel extraction and was determined to belong to IncN group. An ESBL gene, bla _CTX-M-14, and a non-ESBL gene, bla _OXA-1, were identified on this plasmid, whereas no β-lactamase gene has been detected from the chromosomal DNA. CTX-M-14 and OXA-1 are commonly found β-lactamases in Enterobacteriaceae. Although less frequent than CMY-2 β-lactamase in Salmonella, CTX-M-14 has been reported in ceftriaxone-resistant Salmonella in different parts of the world (Chiu et al., 2004; Fey et al., 2000; Jin and Ling, 2006; Li et al., 2005; Romero et al., 2004; Tamang et al., 2011). bla _CTX-M-14 carried on IncN plasmid was first reported in Salmonella, and bla _CTX-M-14 has never been reported in Salmonella isolates in China. In addition, an insertion sequence IS903 was detected upstream of the bla _CTX-M-14 from both isolates. A recent study has shown the presence of bla _CTX-M-14 linking to IS903 on a 95-kb IncI1 conjugative plasmid in a clinical isolate of Salmonella Enteritidis (Bado et al., 2012). The first identification of bla _CTX-M-14 on a IncN plasmid in this study suggesting the possible transmission of bla _CTX-M-14 within plasmids through insertion sequence such as IS903. Interestingly, the IncN plasmid from S166 also carried armA gene, a 16S rRNA methylase gene, which is responsible for its resistance to aminoglycosides. This is also the first report of armA found on IncN plasmid in Salmonella. Further studies will be needed to determine the genetic structures of bla _CTX-M-14 and armA on IncN type of plasmid.

Double mutations on GyrA (S83F, D87N) and single mutation on ParC (S80R) were found on both strains. No GyrB mutation was found. The result is consistent with a previous study that showed only mutations on GyrA and ParC mediate quinolone and fluoroquinolone resistance (Chen et al., 2007). Both isolates were negative to all PMQR genes. The contribution of Salmonella efflux pump to their multidrug-resistances was determined using efflux pump inhibitor, PAβN. The presence of PAβN significantly reduced the MIC of ciprofloxacin, while not norfloxacin or ceftriaxone suggesting the contribution of efflux pump to ciprofloxacin resistance in these two Salmonella. Further study is needed to understand the different mechanisms of norfloxacin and ciprofloxacin resistances in these Salmonella isolates.

Conclusion

The study reported the first isolation of ceftriaxone and ciprofloxacin-resistant Salmonella from meat product. Salmonella ceftriaxone resistance was due to the production of IncN plasmidborne CTX-M-14 ESBL and their ciprofloxacin resistance was mediated by target mutations and efflux pump activity. The emergence of ceftriaxone and ciprofloxacin-resistant Salmonella may be due to the uses of antibiotics in animal production. The study warrants the continuous surveillance of multidrug-resistant Salmonella in meat products and cautious use of antibiotics in food animals.

Footnotes

Acknowledgments

We acknowledged the critical reading of the manuscript by Josephine Leung. The research was supported by the Hong Kong Polytechnic University (internal grant G-U662 to S.C.) and the National Natural Science Foundation of China (grant 30972218 to J.H.L.).

Disclosure Statement

No competing financial interests exist.

References

Andrews

, Jacobson

, Hammack

. Chapter 5: Salmonella. Bacteriological Analytical Manual (BAM) U.S. Food and Drug Administration, 2011. http://www.fda.gov/Food/ScienceResearch/LaboratoryMethods/BacteriologicalAnalyticalManualBAM/ucm070149.htm. 2011 March 1.

Antunes

, Machado

, Sousa

, Peixe

. Dissemination amongst humans and food products of animal origin of a Salmonella Typhimurium clone expressing an integron-borne OXA-30 beta-lactamase. J Antimicrob Chemother, 2004; 54:429–434.

Bado

, García-Fulgueiras

, Cordeiro

, Betancor

, Caiata

, Seija

, Robino

, Algorta

, Chabalgoity

, Ayala

, Gutkind

, Vignoli

. First human isolate of Salmonella enterica serotype Enteritidis harboring blaCTX-M-14 in South America. Antimicrob Agents Chemother, 2012; 56:2132–2134.

Carattoli

, Bertini

, Villa

, Falbo

, Hopkins

, Threlfall

. Identification of plasmids by PCR-based replicon typing. J Microbiol Methods, 2005; 63:219–228.

[CDC] Centers for Disease Control and Prevention. Salmonella Oranienburg infections associated with fruit salad served in health-care facilities–northeastern United States and Canada, 2006. MMWR Morb Mortal Wkly Rep, 2007; 56:1025–1028.

Chen

, Cui

, McDermott

, Zhao

, White

, Paulsen

, Meng

. Contribution of target gene mutations and efflux to decreased susceptibility of Salmonella enterica serovar Typhimurium to fluoroquinolones and other antimicrobials. Antimicrob Agents Chemother, 2007; 51:535–542.

Chiu

, Su

, Chu

, Chia

, Wu

, Lin

, Lee

, Ou

. Isolation of Salmonella enterica serotype Choleraesuis resistant to ceftriaxone and ciprofloxacin. Lancet, 2004; 363:1285–1286.

[CLSI] Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; Twentieth Informational Supplement. CLSI Document M100-S20. Wayne, PA: CLSI, 2010.

Dallenne

, Da Costa

, Decre

, Favier

, Arlet

. Development of a set of multiplex PCR assays for the detection of genes encoding important β-lactamases in Enterobacteriaceae. J Antimicrob Chemother, 2010; 65:490–495.

10.

Deng

, He

, Chen

, Zheng

, Zeng

, Liu

, Sun

, Ma

, Chen

, Liu

. F33:A-:B- and F2:A-:B- plasmids mediate dissemination of rmtB-blaCTX-M-9 group genes and rmtB-qepA in Enterobacteriaceae isolates from pets in China. Antimicrob Agents Chemother, 2011a. 55:4926–4929.

11.

Deng

, Zeng

, Chen

, He

, Liu

, Wu

, Chen

, Yao

, Hou

, Yang

, Liu

. Dissemination of IncFII plasmids carrying rmtB and qepA in Escherichia coli from pigs, farm workers and the environment. Clin Microbiol Infect, 2011b. 17:1740–1745.

12.

Fey

, Safranek

, Rupp

, Dunne

, Ribot

, Iwen

, Bradford

, Angulo

, Hinrichs

. Ceftriaxone-resistant Salmonella infection acquired by a child from cattle. N Engl J Med, 2000; 342:1242–1249.

13.

Glynn

, Bopp

, Dewitt

, Dabney

, Mokhtar

, Angulo

F.J.

Emergence of multidrug-resistant Salmonella enterica serotype Typhimurium DT104 infections in the United States. N Engl J Med, 1998; 338:1333–1338.

14.

Gomez

, Motarjemi

, Miyagawa

, Kaferstein

, Stohr

. Foodborne salmonellosis. World Health Stat Q, 1997; 50:81–89.

15.

Hohmann

. Nontyphoidal salmonellosis. Clin Infect Dis, 2001; 32:263–269.

16.

Hooper

. Emerging mechanisms of fluoroquinolone resistance. Emerg Infect Dis, 2001; 7:337–341.

17.

Jacoby

, Chow

, Waites

. Prevalence of plasmid-mediated quinolone resistance. Antimicrob Agents Chemother, 2003; 47:559–562.

18.

Jin

, Ling

. CTX-M-producing Salmonella spp. in Hong Kong: An emerging problem. J Med Microbiol, 2006; 55:1245–1250.

19.

Kim

, Frye

, Hu

, Fedorka-Cray

, Gautom

, Boyle

. Multiplex PCR-based method for identification of common clinical serotypes of Salmonella enterica subsp. enterica. J Clin Microbiol, 2006; 44:3608–3615.

20.

Kumao

, Ba-Thein

, Hayashi

. Molecular subtyping methods for detection of Salmonella enterica serovar Oranienburg outbreaks. J Clin Microbiol, 2002; 40:2057–2061.

21.

Lewis

2nd , Herrera

, Wickes

, Patterson

, Jorgensen

. First report of the emergence of CTX-M-type extended-spectrum beta-lactamases (ESBLs) as the predominant ESBL isolated in a U.S. health care system. Antimicrob Agents Chemother, 2007; 51:4015–4021.

22.

, Huang

, Liu

, Weng

, Wang

, Chiu

, Chiang

. Ceftriaxone resistance of nontyphoidal Salmonella enterica isolates in Northern Taiwan attributable to production of CTX-M-14 and CMY-2 beta-lactamases. J Clin Microbiol, 2005; 43:3237–3243.

23.

Nordmann

, Poirel

. Emergence of plasmid-mediated resistance to quinolones in Enterobacteriaceae. J Antimicrob Chemother, 2005; 56:463–469.

24.

Rahn

, De Grandis

, Clarke

, McEwen

, Galán

, Ginocchio

, Curtiss

3rd , Gyles

. Amplification of an invA gene sequence of Salmonella Typhimurium by polymerase chain reaction as a specific method of detection of Salmonella. Mol Cell Probes, 1992; 6:271–279.

25.

Ribot

, Fair

, Gautom

, Cameron

, Hunter

, Swaminathan

, Barrett

. Standardization of pulsed-field gel electrophoresis protocols for the subtyping of Escherichia coli O157:H7, Salmonella, and Shigella for PulseNet. Foodborne Pathog Dis, 2006; 3:59–67.

26.

Robicsek

, Jacoby

, Hooper

. The worldwide emergence of plasmid-mediated quinolone resistance. Lancet Infect Dis, 2006; 6:629–640.

27.

Romero

, Lopez

, Martinez-Martinez

, Guerra

, Hernandez

, Pascual

. Characterization of the first CTX-M-14-producing Salmonella enterica serotype Enteritidis isolate. J Antimicrob Chemother, 2004; 53:1113–1114.

28.

Sjölund-Karlsson

, Joyce

, Blickenstaff

, Ball

, Haro

, Medalla

, Fedorka-Cray

, Zhao

, Crump

, Whichard

. Antimicrobial susceptibility to azithromycin among Salmonella enterica isolates from the United States. Antimicrob Agents Chemother, 2011; 55:3985–3989.

29.

, Wu

, Chia

, Chu

, Kuo

, Chiu

. Increasing ceftriaxone resistance in Salmonella isolates from a university hospital in Taiwan. J Antimicrob Chemother, 2005; 55:846–852.

30.

Tamang

, Nam

, Kim

, Jang

, Jung

, Lim

. Emergence of extended-spectrum beta-lactamase (CTX-M-15 and CTX-M-14)–producing nontyphoid Salmonella with reduced susceptibility to ciprofloxacin among food animals and humans in Korea. J Clin Microbiol, 2011; 49:2671–2675.