Differences in Virulence Genes and Genome Patterns of Mastitis-Associated Staphylococcus aureus Among Goat,Cow,and Human Isolates in Taiwan

Abstract

A total of 117 mastitis-associated Staphylococcus aureus isolates from cow, goat, and human patients were analyzed for differences in antibiotic susceptibility, virulence genes, and genotypes using accessory gene regulator (agr) typing, pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). Multidrug-resistant (MDR) S. aureus were commonly found in all sources, though they were predominantly found in human and goat isolates. Almost 70% of the isolates were resistant to ampicillin and penicillin. Host-associated virulence genes were identified as follows: tst, a gene encoding toxic shock syndrome toxin, was found in goat isolates; lukED and lukM, genes encoding leukocidin, found in cow isolates; lukPV, a gene encoding leukocidin, found in human isolates; and eta, a gene encoding for exfoliative toxin, found in both human and cow isolates. All four types of hemolysin, α, β, γ, and δ, were identified in human isolates, three types (α, γ, and δ), were identified in cow isolates, and two types (α and δ) were identified in goat isolates. Agr-typing determined agr1 to be the main subtype in human and cow isolates. PFGE and MLST analysis revealed the presence of diverse genotypes among the three sources. In conclusion, mastitis-associated, genetically diverse strains of MDR S. aureus differed in virulence genes among human, cow, and goat isolates.

Introduction

S taphylococcus aureus is an opportunistic zoonotic pathogen that causes mastitis in cattle and dermatitis, pneumonia, septicemia, osteomyelitis, and meningitis in humans and swine (Quinn et al., 2000). S. aureus tends to infect humans through contaminated foods (Phillips et al., 2004). Antibiotics are routinely administered to food-producing animals for disease prevention and growth enhancement, which has led to the development of antimicrobial-resistant bacteria (Barber et al., 2003). Recently, the increase in prevalence of multidrug resistant (MDR) S. aureus has affected our ability to control S. aureus infections in humans and animals (Enright, 2003; Spohr et al., 2011; Kreausukon et al., 2012).

Since the discovery of methicillin-resistant bacteria in 1941 (Barrett et al., 1968), it has been shown that methicillin-resistant S. aureus (MRSA) isolates emerge from methicillin-susceptible S. aureus isolates via introduction of SCCmec elements, including the mecA gene (Jarraud et al., 2002). Methicillin-resistant S. aureus ST398/CC398, which originates from livestock, has recently increased in prevalence in many countries (Lewis et al., 2008). As a zoonotic pathogen, MRSA can cause mastitis in cows (Devriese et al., 1972) and accounts for 53–83% of S. aureus isolated from hospitals in Taiwan (Hsueh et al., 2001). Priority by prime characterized MDR S. aureus and MRSA isolates from dairy goats in 2006–2008 (Chu et al., 2010; Chu et al., 2012). The emergence of MDR MRSA has becomes a public health problem of prime concern.

Though it is normally a species of commensal bacteria found in nasopharyngeal mucosa and on the skin of humans and animals, S. aureus can become pathogenic through acquisition of virulence factors (e.g., toxins) that damage the host cell (Shopsin et al., 1999). S. aureus can cause a variety of symptoms in the host through various virulence factors, including toxic shock syndrome toxin (TSST), which stimulates the massive release of multiple cytokines resulting in toxic shock syndrome; exfoliative toxin, which causes skin abnormalities; and leukocidin and hemolysins, which destroy both leukocytes and erythrocytes. As a regulatory protein, accessory gene regulator (agr) can regulate the expression of cell surface proteins and extracellular virulence factors (Moodley et al., 2006). Previous studies that analyzed agr types found that agr1 was associated with mastitis in cows (Buzzola et al., 2007) and agr type IV was associated with skin infection in humans (Garbacz et al., 2009).

S. aureus belongs to a genetically diverse group of bacteria. The genomic variations of S. aureus and the traceability of outbreak isolates from humans and several animal species have been investigated using various methods, such as multilocus sequence typing (MLST), ribotyping, pulsed-field gel electrophoresis (PFGE), and staphylococcal protein A typing (Melles et al., 2007; Moneke et al., 2007; Milheirico et al., 2011). Of these methods, PFGE and MLST generally provide the most reliable information for phylogenetic analysis of S. aureus isolates (Feil et al., 2003; Turner and Feil, 2007). In this study, we investigated the differences in genomic patterns, virulence genes, and antimicrobial resistance of 117 mastitis-associated S. aureus isolates from humans, cows, and goats.

Methods

Samples and isolates

Twenty herds of dairy cows and 20 dairy goat farms were randomly selected from Taichung, Chunghua, Yunlin, Chiayi, and Tainan counties from January 2006 to December 2007. Milk sample collection was performed using the method of the National Mastitis Council, with some modifications, under aseptic conditions (Hogan et al., 1999). A total of 1372 cows and 3427 goats milk samples were randomly collected. For each sample, 1 mL out of a 10-mL milk sample was mixed with 9 mL of tryptic soy broth and then incubated for 8 to 12 h at 37°C. Staphylococcus aureus isolates were initially identified by colony shape, colony hemolytic type, Gram stain, and coagulase test and further confirmed by the Analytical Profile Index method (Bio-Merieux, France). A total of 101 S. aureus isolates were identified from the milk of cows and goats with mastitis. Additionally, 16 isolates were kindly provided to us from female patients with mastitis by Chiayi Christian Hospital, Taiwan.

Antibiotic susceptibility testing

An overnight-grown bacterial culture was adjusted to 0.5 McFarland (approximately 10⁸ CFU/mL) and then plated on Mueller-Hinton agar. The disc diffusion method and the guidelines of the Clinical and Laboratory Standards Institute standards (CLSI, 2006) and of the manufacturer were used to determine the susceptibility of each isolate to ampicillin (10 μg), bacitracin (10 units), oxacillin (1 μg), cefuroxime (30 μg), cephalothin (30 μg), cloxacillin (5 μg), enrofloxacin (5 μg), gentamicin (10 μg), neomycin (30 μg), oxytetracycline (30 μg), penicillin G (10 units), streptomycin (10 μg), sulfamethoxazole/trimethoprim (Sxt; 23.75 μg for S and 1.25 μg for t), tetracycline (30 μg), and vancomycin (30 μg). The results of the antibiotic susceptibility test were also validated using Escherichia coli (ATCC No. 25922). Discs were purchased from BD (Bacto^™, Becton, Dickinson and Company, Sparks, MD). Finally, the minimum inhibitory concentration to oxacillin of each oxacillin-resistant S. aureus isolate was determined by Etest^® (AB^® Biodisk, Solna, Sweden) using 5% sheep blood Mueller-Hinton agar (Bacto^™, Becton, Dickinson and Company).

PCR detection of toxin genes and agr typing

Chromosomal DNA templates were purified using the QIAamp^® DNA Mini Kit (Qiagen GmbH, Hilden, Germany). Table 1 lists the primers used to detect the toxin genes tst, eta, etb, lukE-lukD, lukM, lukS-PV–lukF-PV, hla, hlb, hld, hlg, and hlg-2 (Jarraud et al., 2002) and for agr typing (Gilot et al., 2002). PCR was performed in a 50-μL reaction volume containing 5 μL of the DNA template, 0.2 μmol/L of each primer, 200 μmol/L of dNTPs, 1x polymerase chain reaction (PCR) buffer, and 1.4 units of Taq DNA polymerase. The PCR procedure was as follows: 5 min of pre-denaturation at 94°C, followed by 30 cycles of 30 s of denaturation at 94°C, 30 s of annealing at 53–55°C, and 40–60 s of extension at 72°C. All PCR products were separated on 2% agarose with 0.5×Tris-acetate (TAE) buffer at 100 V.

Table 1.

Primers and Their Sequences Used for Detecting Virulence Genes

Gene	Primer	Sequence (5′– 3′)	Size (bp)	Accession no.	Reference
tst	TST-1	TTCACTATTTGTAAAAGTGTCAGACCCACT	180	J02615	Jarraud et al., 2002
	TST-2	TACTAATGAATTTTTTTATCGTAAGCCCTT
eta	mpETA-1	ACTGTAGGAGCTAGTGCATTTGT	190	M17347
	mpETA-3	TGGATACTTTTGTCTATCTTTTTCATCAAC
etb	mpETB-1	CAGATAAAGAGCTTTATACACACATTAC	612	M17348
	mpETB-2	AGTGAACTTATCTTTCTATTGAAAAACACTC
lukS-lukF	PVL-1	ATCATTAGGTAAAATGTCTGGACATGATCCA	433	AB006796
	NPVL-2	GCATCAASTGTATTGGATAGCAAAAGC
lukE-lukD	LUKDE-1	TGAAAAAGGTTCAAAGTTGATACGAG	269	Y13225
	LUKDE-2	TGTATTCGATAGCAAAAGCAGTGCA
lukM	LUKM-1	TGGATGTTACCTATGCAACCTAC	780	D42144
	LUKM-2	GTTCGTTTCCATATAATGAATCACTAC
hla	HLA-1	CTGATTACTATCCAAGAAATTCGATTG	209	M90536
	HLA-2	CTTTCCAGCCTACTTTTTTATCAGT
hlb	HLB-1	GTGCACTTACTGACAATAGTGC	309	S72497
	HLB-2-2	GTTGATGAGTAGCTACCTTCAGT
hld	HLD-1	AAGAATTTTTATCTTAATTAAGGAAGGAGTG	111	AF288215
	HLD-2	TTAGTGAATTTGTTCACTGTGTCGA
hlg	mpHLG-1	GTCAYAGAGTCCATAATGCATTTAA	535	L01055
	mpHLG-2	CACCAAATGTATAGCCTAAAGTG
hlg-2	mpHLG2-1	GACATAGAGTCCATAATGCATTYGT	390	D42143
	mpHLG2-2	ATAGTCATTAGGATTAGGTTTCACAAAG
agr 1	AGR1-F	ATGCACATGGTGCACATG C	441	M21854	Gilot et al., 2002
	AGR1-R	GTCACAAGTACTATAAGCTGCGAT
agr 2	AGR2-F	ATGCACATGGTGCACATGC	575	AF001782
	AGR2-R	TATTACTAATTGAAAAGTGGCCATAGC
agr 3	AGR3-F	ATGCACATGGTGCACATGC	323	AF001783
	AGR3-R	GTAATGTAATAGCTTGTATAATAATACCCAG
agr 4	AGR4-F	ATG CAC ATG GTG CAC ATG C	659	AF288215
	AGR4-R	CGATAATGCCGTAATACCCG

PFGE and MLST analysis

PFGE analysis of SmaI-digested genomic DNA was performed to determine the genotype of each isolate according to the method of Bannerman et al. (1995). Briefly, restriction endonuclease SmaI was used to digest genomic DNA in whole-cell embedding agarose plugs, and DNA fragments were separated using a CHEF DR-III apparatus (Bio-Rad). After staining with ethidium bromide and under ultraviolet illumination, DNA banding patterns were recorded and analyzed using an IS-100 Digital System running Gelcompare Version l.3.1b (Applied Math, Kortrijk, Belgium). The MLST types of the isolates were determined according to the method of Enright et al. (2000) using MLST databases (http://saureus.mlst.net/-SA).

Results

S. aureus was isolated from milk with a prevalence of 2% (2.0%, 28/1372) and 2.1% (2.1%, 73/3427) in cows and goats, respectively.

Antibiotic susceptibility

All strains were sensitive to bacitracin, cephalothin, enrofloxacin, oxacillin, and vancomycin. Of the remaining 11 antimicrobials tested, susceptible strains (14.5%) were only identified in the cow and goat isolates; 79.5% of the strains were resistant to at least two of the antimicrobials tested (Table 2). The prevalence of antimicrobial resistance was approximately 70% for ampicillin and penicillin, 48.7% for oxytetracycline and tetracycline, and lower than 25% for streptomycin (22.2%), neomycin (13.7%), gentamicin (9.4%), cloxacillin (6.8%), sulfamethoxazole/trimethoprim (6.8%), and cefuroxime (3.4%). The human and goat isolates were more resistant to the tested antimicrobials than cow isolates. Furthermore, 31.2% (5/16) of the human and 39.7% (29/73) of the goat isolates were resistant to four antimicrobials, and 64.3% (18/28) of the cow isolates were resistant to two antimicrobials.

Table 2.

Antimicrobial Resistance of 117 Staphylococcus aureus Isolates from Different Sources

	Resistance to:
Resistance number	AMP	CLO	CXM	GEN	NEO	OXY	PEN	STR	SxT	TET	Number of isolates	Human	Cow	Goat
0											17		4	13
1				R							1			1
							R				1			1
								R			5	1		4
2	R						R				24	2	18	4
						R				R	8			8
3	R					R				R	1			1
	R						R			R	1			1
						R	R			R	1			1
				R	R			R			1			1
4	R						R		R		6	1	5
	R	R		R			R				1	1
	R				R		R	R			2	2
	R					R	R			R	28	1	1	26
						R	R	R		R	2			2
				R	R	R		R			1			1
5	R			R		R		R		R	1			1
	R	R			R		R	R			1	1
	R	R				R	R			R	1			1
	R				R	R	R			R	1			1
	R					R	R	R		R	1			1
6	R			R	R	R		R		R	1			1
	R			R		R	R	R		R	1			1
	R				R	R	R	R		R	2	2
7	R	R	R			R	R	R		R	1	1
	R	R			R	R	R	R		R	1	1
	R			R	R	R	R	R		R	1			1
8	R	R	R		R	R	R	R		R	2	2
9	R			R	R	R	R	R	R	R	2			2
	R	R	R	R	R	R	R	R		R	1	1
Total	80	8	4	11	16	57	81	26	8	57	117	16	28	73
	68.4	6.8	3.4	9.4	13.7	48.7	69.2	22.2	6.8	48.7

Ampicillin (AMP), cloxacillin (CLO), cefuroxime (CXM), gentamicin (GEN), neomycin (NEO), oxytetracycline (OXY), penicillin G (PEN), streptomycin (STR), sulfamethoxazole/ trimethoprim (SxT), tetracycline (TET).

Variations in toxin genes

Analysis of 10 virulence genes revealed absence of the etb gene and varying of the other genes in isolates (Table 3). Four hemolysin genes (hla, hlb, hld, and hlg-2) differed in prevalence among sources from 83.6% in the goat isolates to 100% in the human isolates for α-hemolysin (hla); from 38.4% in the goat isolates to 75% in the human isolates for β-hemolysin (hlb); from 95.9% in the goat isolates to 100% in the human and cow isolates for δ-hemolysin (hld); and from 50.7% in the goat isolates to 96.4% in the cow isolates for γ-hemolysin (hlg-2) (Table 3). Additionally, we assessed host-associated virulence genes and found lukPV (13.8%), lukM (25%) and eta (25%) for human isolates; lukM (3.6%), eta (21.4 %), and lukED (100%) for cow isolates, and tst (28.8%) and lukED (27.4%) for goat isolates.

Table 3.

Prevalence of Virulence Genes in Staphylococcus aureus Isolates from Different Sources

Genes ^a	Human (%)	Cow (%)	Goat (%)
Tsst	0 (0/16)	0 (0/28)	28.8 (21/73)
Eta	25.0 (4/16)	21.4 (6/28)	0 (0/73)
Etb	0 (0/16)	0 (0/28)	0 (0/73)
lukED	0 (0/16)	100 (28/28)	27.4 (20/73)
lukPV	13.8 (7/16)	0 (0/28)	0 (0/73)
lukM	0 (0/16)	3.6 (1/28)	0 (0/73)
α-hemolysin	100 (16/16)	96.4 (27/28)	83.6 (61/73)
β-hemolysin	75.0 (12/16)	46.4 (13/28)	38.4 (28/73)
δ-hemolysin	100 (16/16)	100 (28/28)	95.9 (70/73)
γ-hemolysin	87.5 (14/16)	96.4 (27/28)	50.7 (37/73)

Tsst stands for toxic shock syndrome toxin, eta and etb stand for exofoliative toxin, and lukED, lukPV, and lukM stand for leukocidin.

Genomic and genetic variations

Using agr typing, the isolates were separated into four types: agr1, agr2, agr3, and nontypeable, the last of which was only found in the human (25%) and goat (52.1%) isolates (Table 4). As the most prevalent type, agr1 isolates were identified in almost all of the cow strains (96.4%) and most of the human strains (62.5%), but was less prevalent in the goat strains (30.1%). PFGE analysis separated all of the isolates into two clusters, with each cluster containing three subclusters (Fig. 1). The pulsotype number was three for the cow isolates (pulsotypes C1-C3), six for the human isolates (pulsotypes H1-H6), and eight for the goat isolates (pulsotypes G1-G8) (Fig. 1). The human isolates were found to be predominantly in cluster I, and the goat isolates were predominantly found in cluster II. Additionally, cow pulsotype C1 and goat pulsotype G6 were found to be identical.

FIG. 1.

Phylogenetic distance tree of pulsed-field gel electrophoresis typing. C1–C3, cow isolates; H1–H6, human isolates; F1, food isolate; G1–G8, goat isolates. Most human pulsotypes belonged to cluster I, whereas most goat pulsotypes were grouped into cluster II. Additionally, cow pulsotype C1 and goat pulsotype G6 were found to be identical.

Table 4.

Prevalence of agr Types of S. aureus Strains from Different Sources

Agr type	Human (%)	Cow (%)	Goat (%)
agr1	62.5 (10/16)	96.4 (27/28)	30.1 (22/73)
agr2	0 (0/16)	3.6 (1/28)	15.0 (11/73)
agr3	12.5 (2/16)	0 (0/28)	2.7 (2/73)
Nontypeable	25 (4/16)	0 (0/28)	52.1 (38/73)

The MLST analysis of 10 isolates determined that the ST types were ST59 for the human isolates; ST188 and ST 705 for the cow isolates; and ST1, ST133, and ST1027 for the goat isolates (Table 5). Although the strains shared the agr1 type, the ST type differed among sources, with, for example, ST59 found in the human strains, ST188 found in the cow strains, and 133 or 133-like found in the goat strains.

Table 5.

Multilocus Sequence Typing and agr Analysis of Representative Staphylococcus aureus Isolates from Different Sources

Isolates	Sources	Allele profile	Sequence types
O122	Human	agr1	59
1556C	Cow	agr1	188
5171		agr2	705
1C	Goat	agr1	133-like
99Q		agr1	133-like
13LV		agr1	133
1E		agr2	1027
2E		agr2	1027-like
6E		agr2	1027
9F		agr3	1

Discussion

S. aureus is generally considered to be a contagious udder pathogen, which mainly spreads within and between cows or goats at milking; the udder is the main source of infection. Therefore, control measures are primarily aimed at improving milking hygiene and milking routines such as milking order and teat dipping. Recently, MDR pathogenic S. aureus has been frequently isolated from cows and goats with mastitis (Dung, 2004). Normally, MRSA are MDR with various toxins (Tang et al., 2007; von Eiff et al., 2008), highly pathogenic and infectious in humans (Strommenger et al., 2003), canines (Rao et al., 1987), geriatric patients (Scott et al., 1988) and cattle (Rao et al., 1987; Lee, 2003). Although our previous study discovered genetically divergent MRSA isolates from goats with mastitis (Chu et al., 2012), in this study, we were only able to isolate MDR S. aureus from goats, not MRSA (Table 2). Furthermore, our S. aureus isolates were more resistant to ampicillin, penicillin, tetracycline, and oxytetracycline, which are drugs that are often used to treat bacterial infections in goats.

Pathogenic S. aureus strains have differing prevalence of various virulence genes. Our present study identified host-associated virulence genes in mastitis-related S. aureus. In goats, S. aureus toxins consist mostly of TSST (Adesiyun et al., 1992). Indeed, we confirmed the presence of TSST-1 in a few goat isolates, but found none in the cow or human isolates (Table 3). Furthermore, the virulence gene eta was only detected in the human and cow isolates and not in the goat isolates. Further investigation is needed to determine whether these two genes are related to host-associated mastitis. The virulence factor ETA differs in prevalence among geographical regions, mainly distributed in Africa, Europe, and North America (Ladhani, 2001; Rabello et al., 2007). In Taiwan, the major breed of dairy cattle is the Holstein-Friesan, imported mainly from Australia and the United States. It is possible that the S. aureus strains with eta are from imported cows.

Leukocidins are bicomponent toxins, which include Panton-Valentine leukocidin (LukS-PV + LukF-PV), LukM (LukM + LukF′-PV), and LukED (LukE + LukD) (Holmes et al., 2005; Clark, 2008). Previous reports frequently identified lukM in sheep and goat isolates and infrequently in cow isolates (Rainard et al., 2003). Leukocidin E and lukD were found to be predominant in human isolates from blood (82%) (von Eiff et al., 2008). In the present study, we observed lukPV and lukM in isolates from humans (13.8%) and cows (3.6%), and lukED in isolates from cows (100%) and goats (27.4%) (Table 3). Additionally, genes encoding hemolysins, which can destroy cell membranes (Ikawaty et al., 2009), were found to be present in our isolates: 75–100% of human isolates had α, β, δ, and γ-hemolysin genes; 96.4–100% of bovine isolates had α, δ, and γ-hemolysin genes; and 83.6–95.9% of caprine isolates had α- and δ-hemolysin genes (Table 3). These results suggest that mastitis-associated virulence genes include α-, δ-, and γ-hemolysin genes, eta, lukED, and lukM for cows; α- and δ-hemolysin genes, tst and lukED for goats; and all four hemolysin genes, eta and lukPV for humans.

The analysis of the agr types demonstrated that the major type was agr1 in the MRSA isolates. Previous studies have indicated that agr type IV is the predominant type for human dermatitis isolates (Garbacz et al., 2009; Ho et al., 2010); agr1 and agr2 for bovine mastitis-associated isolates (Buzzola et al., 2007); and agr1 for penicillin-resistant strains (Melchior et al., 2009; van den Borne et al., 2010). In this study, although agr1 was the major type in human and cow isolates, nontypeable isolates were predominant in the goat isolates and absent in the cow isolates (Table 4), demonstrating the possible diverse origins of S. aureus in human and goat isolates. Pulsotype analysis also confirmed the different origins of the human and goat isolates. However, we encountered identical pulsotypes for certain goat and human isolates, suggesting the possibility of transfer of MDR S. aureus between humans and goats. Diverse genomic variations of S. aureus generally limit the capacity to perform PFGE analysis in epidemiological studies. Instead, MLST is highly effective for epidemiological research on S. aureus (Enright et al., 2000; Denis et al., 2004). Recent MLST analysis of mastitis-associated S. aureus isolates identified 11 ST types for goats and 10 ST and nontypeable types for sheep in Spain (Concepción Porrero et al., 2012). A similar study identified four ST types in Brazil (de Almeida et al., 2011). Our ST types differed among the three sources, and identical ST types (ST133 and 1027) were found in different goat isolates (Table 5), demonstrating clonal dissemination in goats. When comparing our ST types with those reported in Spain and Brazil, we found only ST133 to be common to both Spain and Taiwan; ST types were otherwise diverse and distinct (de Almeida et al., 2011; Concepción Porrero et al., 2012), suggesting that mastitis-associated S. aureus strains are genetically diverse and that clonal dissemination may have occurred in goats.

In conclusion, MDR S. aureus was commonly isolated from humans, cows, and goats with mastitis. Ten virulence genes differed in prevalence and appeared to be host-associated. These isolates revealed the presence of diverse genetic variations among the three host species and indicated a possible clonal dissemination in goats.

Footnotes

Acknowledgments

The authors would like to thank the grant of 99-AS−9.6.1-BQ-B3 and 98-AS−9.2.4-BQ-B1(Z) from the Council of Agriculture, executive Yuan of the Republic of China, Taiwan.

Disclosure Statement

No competing financial interests exist.

References

Adesiyun

, Lenz

, Schaal

. Production of toxic shock syndrome toxin-1 (TSST-1) by Staphylococcus aureus strains isolated from humans, animals and foods in Nigeria. Microbiologica, 1992; 15:125–133.

Bannerman

, Hancock

, Tenover

, Miller

. Pulsed-field gel electrophoresis as a replacement for bacteriophage typing of Staphylococcus aureus. J Clin Microbiol, 1995; 33:551–555.

Barber

, Miller

, McNamara

. Models of antimicrobial resistance and food-borne illness: Examining assumptions and practical application. J Food Protect, 2003; 66:700–709.

Barrett

, McGehee

RFJ

, Finland

. Methicillin-resistant Staphylococcus aureus at Boston City Hospital: Bacteriologic and epidemiologic observations. N Engl J Med, 1968; 279:441–448.

Buzzola

, Alvarez

, Tuchscherr

, Barbagelata

, Lattar

, Calvinho

, Sordelli

. Differential abilities of capsulated and noncapsulated Staphylococcus aureus isolates from diverse agr groups to invade mammary epithelial cells. Infect Immun, 2007; 75:886–891.

Chu

, Lai

, Yu

, Chang

, Lin

, Su

. Rapid identification of staphylococcal infection in dairy goat raw milk by a multiplex PCR assay. Taiwan Vet J, 2010; 36:182–190.

Chu

, Yu

, Lee

, Su

. Genetically divergent methicillin-resistant Staphylococcus aureus and sec-dependent mastitis of dairy goats in Taiwan. BMC Vet Res, 2012; 8:39.

Clark

. A brief review of Panton-Valentine leukocidin producing staphylococcal infections in the intensive therapy unit. Curr Anaesth Crit Care, 2008; 19:330–332.

[CLSI] Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Disk Susceptibility Tests; Approved Standard. 9 ^th CLSI Document M2–A9. Wayne, PA: CLSI, 2006.

10.

Concepción Porrero

, Hasman

, Vela

, Fernández-Garayzábal

, Domínguez

, Aarestrup

. Clonal diversity of Staphylococcus aureus originating from the small ruminants goats and sheep. Vet Microbiol, 2012; 156:157–161.

11.

de Almeida

, de Almeida

MZPRB

, de Mendonça

, Mamizuka

. Novel sequence types (STs) of Staphylococcus aureus isolates causing clinical and subclinical mastitis in flocks of sheep in the northeast of Brazil. J Dairy Res, 2011; 78:373–378.

12.

Denis

, Deplano

, Nonhoff

, De Ryck

, de Mendonca

, Rottiers

, Vanhoof

, Struelens

. National surveillance of methicillin-resistant Staphylococcus aureus in Belgian hospitals indicates rapid diversification of epidemic clones. Antimicrob Agents Chemother, 2004; 48:3625–3629.

13.

Devriese

, Van Damme

, Fameree

. Methicillin (cloxacillin)-resistant Staphylococcus aureus strains isolated from bovine mastitis cases. Zentralbl Veterinarmed B, 1972; 19:598–605.

14.

Dung

. Study of molecular epidemiological of Staphylococcus aureus isolated by using PCR-RFLP method from dairy cattle and goat raw milk [Master Thesis] Taichung, Taiwan: Graduate Institute of Veterinary Medicine, National University, 2004.

15.

Enright

, Day

, Davies

, Peacock

, Spratt

. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J Clin Microbiol, 2000; 38:1008–1015.

16.

Enright

. The evolution of resistant pathogen: The case of MRSA. Curr Opin Pharmacol, 2003; 3:474–479.

17.

Feil

, Cooper

, Grundmann

, Robinson

, Enright

, Berendt

, Peacock

, Smith

, Murphy

, Spratt

, Moore

, Day

. How clonal is Staphylococcus aureus? J Bacteriol, 2003; 185:3307–3316.

18.

Garbacz

, Piechowicz

, Wiśniewska

, Dabrowska-Szponar

. Diversification of agr locus among Staphylococcus aureus isolated from carriers and from hospital patients with infection syndromes. Med Dosw Mikrobiol, 2009; 61:5–9.

19.

Gilot

, Lina

, Cochard

, Poutrel

. Analysis of the genetic variability of genes encoding the RNA III-activating components Agr and TRAP in a population of Staphylococcus aureus strains isolated from cows with mastitis. J Clin Microbiol, 2002; 40:4060–4067.

20.

, Hsueh

, Liu

, Lee

, Chiueh

, Shyr

, Tsao

, Chuang

, Yan

, Wang

, Ho

, Tien

, Lu

. Prevalence and accessory gene regulator (agr) analysis of vancomycin-intermediate Staphylococcus aureus among methicillin-resistant isolates in Taiwan: SMART program, 2003. Eur J Clin Microbiol Infect Dis, 2010; 29:383–389.

21.

Hogan

, Gonzalez

, Harmon

, Nickerson

, Oliver

, Pankey

, Smith

. Sample collection and handling. Laboratory Handbook on Bovine Mastitis. Madison, WI: National Mastitis Council Inc., 1999; 1–11.

22.

Holmes

, Ganner

, McGuane

, Pitt

, Cookson

, Kearns

. Staphylococcus aureus isolates carrying Panton-Valentine leucocidin genes in England and Wales: Frequency, characterization, and association with clinical disease. J Clin Microbiol, 2005; 43:2384–2390.

23.

Hsueh

, Liu

, Yang

, Yan

, Wu

, Huang

, Wu

, Ko

, Leu

, Yu

, Luh

. Multicenter surveillance of antimicrobial resistance of major bacterial pathogens in intensive care units in 2000 in Taiwan. Microb Drug Resist, 2001; 7:373–382.

24.

Ikawaty

, Brouwer

, Jansen

, van Duijkeren

, Mevius

, Verhoef

, Fluit

. Characterization of Dutch Staphylococcus aureus from bovine mastitis using a multiple locus variable number tandem repeat analysis. Vet Microbiol, 2009; 136:277–284.

25.

Jarraud

, Mougel

, Thioulouse

, Lina

, Meugnier

, Forey

, Nesme

, Etienne

, Vandenesch

. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect Immun, 2002; 70:631–641.

26.

Kreausukon

, Fetsch

, Kraushaar

, Alt

, Müller

, Krömker

, Zessin

, Käsbohrer

, Tenhagen

. Prevalence, antimicrobial resistance, and molecular characterization of methicillin-resistant Staphylococcus aureus from bulk tank milk of dairy herds. J Dairy Sci, 2012; 95:4382–4388.

27.

Ladhani

. Recent developments in staphylococcal scalded skin syndrome. Clin Microbiol Infect, 2001; 7:301–307.

28.

Lee

. Methicillin (oxacillin)-resistant Staphylococcus aureus strains isolated from major food animals and their potential transmission to humans. Appl Environ Microbiol, 2003; 69:6489–6494.

29.

Lewis

, Molbak

, Reese

, Aarestrup

, Selchau

, Sorum

, Skov

. Pig as source of methicillin-resistant Staphylococcus aureus CC398 infection in human, Denmark. Emerg Infect Dis, 2008; 14:1383–1389.

30.

Melchior

, van Osch

, Graat

, van Duijkeren

, Mevius

, Nielen

, Gaastra

, Fink-Gremmels

. Biofilm formation and genotyping of Staphylococcus aureus bovine mastitis isolates: Evidence for lack of penicillin-resistance in Agr-type II strains. Vet Microbiol, 2009; 137:83–89.

31.

Melles

, van Leeuwen

, Snijders

, Horst-Kreft

, Peeters

, Verbrugh

, van Belkum

. Comparison of multilocus sequence typing (MLST), pulsed-field gel electrophoresis (PFGE), and amplified fragment length polymorphism (AFLP) for genetic typing of Staphylococcus aureus. J Microbial Methods, 2007; 69:371–375.

32.

Milheirico

, Portelinha

, Krippahl

, de Lencastre

, Oliveira

. Evidence for a purifying selection acting on the beta-lactamase locus in epidemic clones of methicillin-resistant Staphylococcus aureus. BMC Microbiol, 2011; 11:76.

33.

Monecke

, Kuhnert

, Hotzel

, Slickers

, Ehricht

. Microarray based study on virulence-associated genes and resistance determinants of Staphylococcus aureus isolates from cattle. Vet Microbial, 2007; 125:128–140.

34.

Moodley

, Stegger

, Bagcigil

, Baptiste

, Loeffler

, Lloyd

, Williams

, Leonard

, Abbott

, Skov

, Guardabassi

. spa typing of methicillin-resistant Staphylococcus aureus isolated from domestic animals and veterinary staff in the UK and Ireland. J Antimicrob Chemother, 2006; 58:1118–1123.

35.

Phillips

, Casewell

, Cox

, Groot

, Friis

, Jones

, Nightingale

, Preston

, Waddell

. Does the use of antibiotics in food animals pose a risk to human health? A critical review of published data. J Antimicrob Chemother, 2004; 53:28–52.

36.

Quinn

, Carter

, Markey

, Cater

. Staphylococcus species. Clinical Veterinary Microbiology. Edinburgh: Mosby, 2000; 118–126.

37.

Rabello

, Moreira

, Lopes

, Teixeira

, Riley

, Castro

. Multilocus sequence typing of Staphylococcus aureus isolates recovered from cows with mastitis in Brazilian dairy herds. J Med Microbiol, 2007; 56:1505–1511.

38.

Rainard

, Corrales

, Barrio

, Cochard

, Poutrel

. Leucotoxic activities of Staphylococcus aureus strains isolated from cows, ewes, and goats with mastitis: importance of LukM/LukF'-PV leukotoxin. Clin Diagn Lab Immunol, 2003; 10:272–277.

39.

Rao

, Naidu

, Rao

, Rajyalakshmi

. Prevalence of staphylococcal zoonosis in pyogenic skin infections. Zentbl Bakteriol Mikrobiol Hyg A, 1987; 265:218–226.

40.

Scott

, Thomson

, Malone-Lee

, Ridgway

. Cross-infection between animals and man: Possible feline transmission of Staphylococcus aureus infection in humans? J Hosp Infect, 1988; 12:29–34.

41.

Shopsin

, Gomez

, Montgomery

, Smith

, Waddington

, Dodge

, Bost

, Riehman

, Naidich

, Kreiswirth

. Evaluation of protein A gene polymorphic region DNA sequencing for typing of Staphylococcus aureus strains. J Clin Microbiol, 1999; 37:3556–3563.

42.

Spohr

, Rau

, Friedrich

, Klittich

, Fetsch

, Guerra

, Hammerl

, Tenhagen

. Methicillin-resistant Staphylococcus aureus (MRSA) in three dairy herds in Southwest Germany. Zoo Pub Heal, 2011; 58:252–261.

43.

Strommenger

, Kettlitz

, Werner

, Witte

. Multiplex PCR assay for simultaneous detection of nine clinically relevant antibiotic resistance genes in Staphylococcus aureus. J Clin Microbiol, 2003; 41:4089–4094.

44.

Tang

, Kilic

, Yang

, McAllister

, Li

, Miller

, McCormac

, Tracy

, Stratton

, Han

, Limbago

. StaphPlex system for rapid and simultaneous identification of antibiotic resistance determinants and Panton-Valentine leukocidin detection of staphylococci from positive blood cultures. J Clin Microbiol, 2007; 45:1867–1873.

45.

Turner

, Feil

. The secrete life of the multilocus sequence type. Int J Antimicrob Agents, 2007; 29:129–135.

46.

van den Borne

BHP

, van Schaik

, Lam

TJGM

, Nielen

. Variation in herd level mastitis indicators between primi- and multiparae in Dutch dairy herds. Prevent Vet Med, 2010; 96:49–55.

47.

von Eiff

, Maas

, Sander

, Friedrich

, Peters

, Becker

. Microbiological evaluation of a new growth-based approach for rapid detection of methicillin- resistant Staphylococcus aureus. J Antimicrob Chemother, 2008; 61:1277–1280.