Phenotypic and Molecular Antibiotic Resistance Profile of Enterococcus faecalis and Enterococcus faecium Isolated from Different Traditional Fermented Foods

Abstract

A collection of 55 enterococci (41 Enterococcus faecium and 14 E. faecalis strains) isolated from various traditional fermented foodstuffs of both animal and vegetable origins, and water was evaluated for resistance against 15 antibiotics. Lower incidence of resistance was observed with gentamicin, ampicillin, penicillin and teicoplanin. However, a high incidence of antibiotic resistance was detected for rifampicin (12 out of 14 of isolates), ciprofloxacin (9/14), and quinupristin/dalfopristin (8/14) in E. faecalis strains. Enterococcus faecium isolates were resistant to rifampicin (25/41), ciprofloxacin (23/41), erythromycin (18/41), levofloxacin (16/41), and nitrofurantoin (15/41). One Enterococcus faecalis and two E. faecium strains were resistant to vancomycin (MIC>16 μg/mL). Among 55 isolates, 27 (19 E. faecium and eight E. faecalis) were resistant to at least three antibiotics. High level of multidrug resistance to clinically important antibiotics was detected in E. faecalis strains (57% of E. faecalis versus 46% of E. faecium), which showed resistance to six to seven antibiotics, especially those isolated from foods of animal origin. So, it is necessary to re-evaluate the use of therapeutic antibiotics in stock farms at both regional and international levels due to the high number of multiple resistant (MR) bacteria. Fifty-six MR E. faecalis and E. faecium strains selected from this and previous studies (Valenzuela et al., 2008, 2010) were screened by polymerase chain reaction for antibiotic resistance genes, revealing the presence of tet(L), tet(M), ermB, cat, efrA, efrB, mphA, or msrA/B genes. The ABC Multidrug Efflux Pump EfrAB was detected in 96% of E. faecalis strains and also in 13% of E. faecium strains; this is the first report describing EfrAB in this enterococcal species. The efflux pump–associated msrA/B gene was detected in 66.66% of E. faecium strains, but not in E. faecalis strains.

Introduction

E nterococci have emerged as important nosocomial pathogens over the past decade (Dupre et al., 2003; Vankerckhoven et al., 2004). Their ubiquitous nature determines their frequent finding in food as contaminants (Giraffa, 2002); they are implicated in food spoilage (Franz et al., 1999), intoxication (Giraffa et al., 1997), and the spreading of antibiotic resistance through the food chain (Leavis et al., 2006). At the same time, enterococci possess many technological applications in the food industry as starter cultures (Foulquie-Moreno et al., 2006), as potential biopreservatives (enterocin producers), and as probiotics (Stiles and Holzapfel, 1997); they are also responsible for the sensory characteristics of some fermented foods. The dualistic aspects of enterococci pose a great challenge concerning their presence in food products.

Enterococci have both an intrinsic and acquired resistance to antibiotics, making them important nosocomial pathogens (Murray et al., 1990; Klare et al., 2002, 2003; Hummel et al., 2007). Vancomycin-resistant enterococci (VRE) are of major concern (Hershberger et al., 2005; de Jong et al., 2009). Enterococci readily acquire resistance genes (Dever, 2000) and are also capable of transferring resistance genes to other bacteria (Shepard and Gilmore, 2002; Lester et al., 2006). Clinical practices and animal husbandry are important foci of selective antibiotic pressure, and the food chain has been shown to act as a reservoir of antibiotic resistance determinants to be spread to humans via various routes (Witte, 2000; Kojima et al., 2010).

The present work aimed to study the antimicrobial resistance profiles and the incidence of genetic determinants of antimicrobial resistance in enterococci isolated from different traditional fermented foods including fermented milk (Morocco and Spain), meat (Morocco), and vegetable products (Morocco, Spain, and Republic of Congo).

Materials and Methods

Bacterial strains and media

A total of 55 enterococci strains—26 strains isolated in the present study and 29 strains isolated by Valenzuela et al. (2008, 2010) from traditional foods and water used for traditional food preparation—belonging to the species of Enterococcus faecium and E. faecalis were used in this study (Table 1). The fermented milk products from Morocco that served as sources of enterococci were commercial butter, traditional cheese (Jben), commercial goat cheese (Valenzuela et al., 2008), and fermented milk. Enterococci from goat milk cheeses of Southern Spain (qE isolates in Table 1) were also included. All fermented food products were traditional foods without starter cultures added. All strains were maintained and stored in brain-heart infusion (BHI) broth (Scharlab, Barcelona, Spain) containing 20% glycerol at −80°C. For routine use, enterococcal isolates were cultivated on BHI broth at 37°C.

Table 1.

Enterococci Isolated from Different Traditional Food Products

Enterococci species	Cheese and butter	Fermented meat	Vegetable foods and water
E. faecalis	n=9	n=1	n=4
E. faecium	n=18	n=6	n=17

Identification of E. faecium and E. faecalis strains

Presumptive identification of isolates was carried out with the following tests: observation of colony characteristics and cell morphology, Gram staining, catalase, growth at 10°C and 45°C, growth in the presence of 6.5% NaCl, at pH 9.6, as well as growth and esculin hydrolysis on bile–esculin agar (Scharlab). The isolates identified as presumptive Enterococcus sp. were further identified at species level by species-specific polymerase chain reaction (PCR) to detect the ddlE.faecalis and ddlE.faecium genes. The primers used were 5’CAAACTGTTGGCATTCCACAA3’ and 5’TGGATTTCCTTTCCAGTCACTTC3’ (E. faecalis forward and reverse primers respectively); and 5’GAAGAGCTGCTGCAAAATGCTTTAGC3’ and 5’GCGCGCTTCAATTCCTTGT3’ (E. faecium forward and reverse primers respectively), as described elsewhere (Abriouel et al., 2005).

Antibiotic resistance

The antibiotic susceptibility of isolates was determined by using ATB ENTEROC 5 strips (BioMérieux, Marcy-l'Etoile, France). The tests were performed by using the antibiotics described in Table 2 and following the manufacturer's instructions. Results were recorded after 24 h of incubation at 37°C and were evaluated according to the manufacturer's instructions (Table 2).

Table 2.

Antibiotic Resistance of Enterococci Isolated from Different Foods

		Incidence of antibiotic resistance
Antibiotic	Antibiotic MIC breaking points^a (mg/L)	E. faecalis	E. faecium
Ampicillin	8	0/14	1/41
Penicillin	8	0/14	1/41
Erythromycin	4	6/14	18/41
Tetracycline	8	5/14	6/41
Chloramphenicol	16	2/14	0/41
Rifampicin	2	12/14	25/41
Ciprofloxacin	2	9/14	23/41
Levofloxacin	4	1/14	16/41
Vancomycin	16	1/14	2/41
Teicoplanin	16	1/14	2/41
Nitrofurantoin	64	1/14	15/41
Gentamycin	500	0/14	0/41
Streptomycin	1000	2/14	3/41
Quinupristin/dalfopristin	2	8/14	5/41

Values determined according to ATB ENTEROC 5 strips used in this study.

PCR amplification for the detection of antibiotic resistance genes

PCR amplification of well-known structural genes of antibiotic resistance—erythromycin (ermA,B,C; mefA,E; msrA,B; and ereA,B), tetracycline (tet[M], tet[O], tet[S], tet[K], and tet[L]), and chloramphenicol (cat)—was performed as reported by Hummel et al. (2007). PCR of efrA and efrB genes was done according to Lee et al. (2003).

Results and Discussion

Enterococci strains isolated from different traditional fermented foods (of both animal and vegetable origins) and water were used in this study. Food samples were obtained from various regions: Spain, Morocco, and Republic of Congo. All isolates showed phenotypic properties typical of E. faecium and E. faecalis strains, i.e., they were Gram-positive cocci, catalase-negative, and hydrolized esculin in the presence of 40% bile salt. They grew at 10°C and 45°C, in the presence of 6.5% NaCl, at pH 9.6, and survived at 70°C for 30 min. According to PCR amplification with E. faecium and E. faecalis species-specific primers, 14 isolates were identified as E. faecalis and 41 were identified as E. faecium. Previous studies also showed a higher incidence of E. faecium in fermented capers (nine E. faecium versus four E. faecalis strains) (Pérez-Pulido et al., 2006) and Slovak Bryndza Cheese (178 E. faecium versus 49 E. faecalis strains) (Jurkovic et al., 2006). E. faecium is also one of the lactic acid bacteria (LAB) species that can be found in relatively high numbers during meat fermentation (Hugas et al., 2003). In Argentinean artisanal dry fermented sausages, 56% of enterococcal isolates were identified as E. faecium, followed by E. faecalis (17%) and other species (Enterococcus durans, Enterococcus casseliflavus, and Enterococcus mundtii) (Fontana et al., 2009). However, Trivedi et al. (2011) showed a high predominance of E. faecalis (127 strains) followed by E. faecium (77 strains) in foodstuffs of all origins (raw and pasteurized milk samples, cheeses of different varieties, ready-to-eat meat products, and various fruits and vegetables).

Antibiotic sensitivity

The antibiotic susceptibility profile of isolates is summarized in Table 2. According to ATB ENTEROC 5 test, a lower incidence of resistance was seen with clinically relevant antibiotics such as gentamicin, ampicillin, and penicillin (Table 2) in both Enterococcus species. However, a high incidence of antibiotic resistance was detected among E. faecalis isolates to rifampicin (12 out of 14 of isolates), ciprofloxacin (9/14), and quinupristin/dalfopristin (8/14). Furthermore, E. faecalis isolates showed an intermediate resistance to erythromycin (6/14) and tetracycline (5/14), and to a lesser extent to streptomycin (2/14), chloramphenicol (2/14), nitrofurantoin (1/14), levofloxacin (1/14), teicoplanin (1/14), and vancomycin (1/14). All E. faecalis isolates were susceptible to three antibiotics (ampicillin, penicillin, and gentamicin). On the other hand, E. faecium isolates were resistant to rifampicin (25/41), ciprofloxacin (23/41), erythromycin (18/41), levofloxacin (16/41), and nitrofurantoin (15/41). In addition, two isolates were resistant to vancomycin and teicoplanin, and one isolate was resistant to ampicillin and penicillin. All E. faecium isolates were susceptible to gentamycin and chloramphenicol. The results obtained in the current study were in accordance with those obtained in food isolates reported by Ben Omar et al. (2004), Pérez-Pulido et al. (2006), and Valenzuela et al. (2008) regarding resistance to rifampicin, ciprofloxacin, and erythromycin. Only E. faecium H2OP3 (a strain isolated from water used for preparation of food at Republic of Congo) was resistant to penicillin and ampicillin, and also to vancomycin and teicoplanin. Resistance of enterococci to glycopeptide antibiotics such as vancomycin and teicoplanin and to aminoglycosides (Kacmaz and Aksoy, 2005) is well documented. In this study, few Enterococcus strains were resistant to teicoplanin and simultaneously to vancomycin (Table 3), which could pose a great concern in clinical treatment, by increasing treatment failure by 20% and mortality from 27% to 52%, as reported by Brown et al. (2006). However, our results indicated an almost complete (97.6–100%) susceptibility of enterococcal isolates to ampicillin or penicillin as cell wall active agents and gentamycin (aminoglycoside). Thus, strains with resistance to vancomycin and/or teicoplanin are completely susceptible to ampicillin and penicillin, which is of great importance in health care because of their synergistic bactericidal effects against enterococci (Filipová et al., 2006).

Table 3.

Incidence of Antibiotic Resistance in Enterococcal Isolates from Different Foods

Isolate	Food source	Antibiotic resistance (identified resistance determinants)
E. faecalis Ac 8-2	Olives	RFA, CIP, QDA (efrA, efrB)
E. faecalis Oli1	Olives	ERY, TET, CMP, RFA, QDA^a (ermB, cat, efrA) efrB, tetM)
E. faecalis Oli2	Olives	TET, RFA, QDA^a (efrA, efrB)
E. faecalis Oli3	Olives	TET, RFA, QDA^a (efrA, efrB, tetM)
E. faecalis Oli4	Olives	ERY, TET, RFA^a (ermB, efrA, efrB, tetM)
E. faecalis Mz2	Cow meat salami	ERY, TET, RFA, CIP, LVX, VAN, FUR, QDA^a (ermB, mphA,efrB, tetM)
E. faecalis Mz4	Cow meat salami	RFA, CIP, QDA (efrA, efrB)
E. faecalis GM2	Goat milk	TET, RFA, CIP, LVX, FUR^a (efrA, efrB) tetM)
E. faecalis GM43	Goat milk	TET, RFA, CIP, FUR, STH^a (efrA, efrB) tetM)
E. faecalis CM5	Cow milk	TET, RFA, CIP, LVX, FUR, QDA^a (efrA, efrB) tetM)
E. faecalis CM11	Cow milk	CIP, LVX, FUR^a
E. faecalis Mq7.1	Butter	TET, RFA, CIP, QDA^a (efrA, efrB, tetM)
E. faecalis Mq7.2	Butter	TET, RFA, CIP, QDA^a (ermB, efrA, efrB)
E. faecalis Mq7.4	Butter	TET, RFA, CIP, LVX^a (efrA, efrB, tetM)
E. faecalis qE-12	Cheese	ERY, TET, CMP, RFA, STH, QDA (ermB, cat) efrA, efrB, tetM)
E. faecalis qE-14	Cheese	ERY, TET, CMP, RFA, STH, QDA (ermB, cat) efrA, efrB, tetM)
E. faecalis qE-20	Cheese	RFA, CIP, QDA (ermB, efrB)
E. faecalis qE-21	Cheese	RFA, CIP, QDA (efrA, efrB)
E. faecalis qE-27	Cheese	TET, RFA, CIP (ermB, efrA, efrB, tetL)
E. faecalis qE-29	Cheese	ERY, RFA, CIP, LVX, VAN, TEC, QDA (efrA, efrB)
E. faecalis FB1	Cheese	ERY, TET, CMP, RFA, CIP^a (cat, efrA, efrB)
E. faecalis FB2	Cheese	ERY, TET, RFA^a (efrA, efrB)
E. faecalis FB3	Cheese	TET, RFA, CIP, FUR, QDA^a (efrA, efrB) tetM)
E. faecalis J3	Cheese	TET, RFA, CIP, LVX, FUR, STH, QDA^a (efrA) efrB, tetM, tetL)
E. faecalis J39	Cheese	TET, RFA, CIP, LVX, FUR, STH, QDA^a (efrA) efrB, tetM)
E. faecalis J41	Cheese	TET, RFA, CIP, LVX, FUR, STH, QDA^a (efrA) efrB, tetM)
E. faecium H2OP3	Water	ERY, RFA, VAN, TEC, QDA (msrA/B, efrA) efrB)
E. faecium Tg6	Ginger beer	ERY, RFA, CIP, QDA (msrA/B, efrA, efrB)
E. faecium VP3 01	Palm wine	ERY, RFA, CIP, LVX (msrA/B)
E. faecium VP3 02	Palm wine	RFA, CIP, LVX
E. faecium H1	Ground pepper	ERY, CIP, LVX, FUR^a (msrA/B, ermB)
E. faecium H2	Ground pepper	ERY, RFA, CIP, LVX, FUR^a (msrA/B, ermB) efrB)
E. faecium H3	Ground pepper	ERY, CIP, LVX, FUR^a (msrA/B)
E. faecium H4	Ground pepper	ERY, CIP, LVX, FUR^a (msrA/B, ermB)
E. faecium PE 2-2	Fish	RFA, CIP, LVX, FUR^b
E. faecium Sln 1	Blood sausage	TET, RFA, CIP, LVX (tetM, tetL)
E. faecium Sln2	Blood sausage	TET, CIP, LVX, FUR (tetL)
E. faecium KAA 1	Blood sausage	ERY, TET, CIP, FUR, STH (msrA/B, ermB) tetM, tetL)
E. faecium KAA 3	Blood sausage	TET, RFA, CIP, LVX, FUR, STH (tetM, tetL)
E. faecium KAA 4	Blood sausage	ERY, TET, RFA, CIP, LVX (msrA/B, ermB)
E. faecium Mz1B	Cow meat salami	ERY, RFA, CIP, LVX, VAN, TEC^a (msrA/B) ermB)
E. faecium Mz3B	Cow meat salami	CIP, VAN, TEC^a
E. faecium S1	Turkey salami	ERY, TET, RFA, CIP, LVX, FUR^a (msrA/B) ermB, tetM, tetL)
E. faecium YA 2	Fermented milk	ERY, RFA, CIP, LVX, QDA (msrA/B, ermB)
E. faecium YA 6	Fermented milk	ERY, CIP, LVX (msrA/B, ermB)
E. faecium YA 9-A	Fermented milk	ERY, CIP, LVX (msrA/B, ermB)
E. faecium YA 9-B	Fermented milk	ERY, CIP, LVX (msrA/B, ermB)
E. faecium Mq1	Butter	ERY, CIP, LVX, FUR^a (msrA/B,)
E. faecium Mq2	Butter	ERY, CIP, LVX, FUR^a (msrA/B, ermB)
E. faecium Mq3	Butter	ERY, CIP, LVX, FUR^a (msrA/B, ermB)
E. faecium qE-11	Cheese	ERY, RFA, CIP, LVX, FUR, QDA
E. faecium qE-17	Cheese	RFA, CIP, FUR
E. faecium qE-18	Cheese	ERY, RFA, CIP, LVX, FUR (msrA/B)
E. faecium qE-23	Cheese	ERY, RFA, CIP, LVX, FUR (msrA/B, ermB)
E. faecium qE-24	Cheese	VAN, TEC, FUR (efrA, efrB)
E. faecium qE-26	Cheese	RFA, CIP, FUR

a,b

Antibiotic resistance phenotypes were determined previously by Valenzuela et al. (2008, 2010), respectively.

Multiple resistant (MR) enterococci

Analysis of antibiotic resistance pattern of enterococci isolates revealed multiple antibiotic resistant strains in food isolates in the same way as reported by Peters et al. (2003). Among the total of 55 strains analyzed, 27 strains (19 E. faecium and eight E. faecalis) were resistant to at least three antibiotics (Table 3). Furthermore, 29 MR enterococci of food origin previously evaluated by Valenzuela et al. (2008, 2010) were included in the present study for molecular screening of resistance genes.

In this study, MR E. faecalis strains showed various levels of antibiotic resistance: resistant to seven antibiotics (strain qE-29) and six antibiotics (strains qE-12 and qE-14). Similarly, some E. faecalis strains analyzed by Valenzuela et al. (2008, 2010) and included here for molecular studies showed resistance to eight antibiotics (strain Mz2), seven antibiotics (strains J3, J39 and J41), or six antibiotics (strain CM5). It is noteworthy that E. faecalis strains with resistance to six to eight antibiotics were isolated from foods of animal origin (Table 3). As shown in Table 3, VR E. faecalis qE-29 and Mz2 isolates were also resistant to erythromycin, tetracycline, rifampicin, ciprofloxacin, levofloxacin, nitrofurantoin, and quinupristin/dalfopristin. Tetracycline and erythromycin resistance in foods of animal origin is likely related to the wide use of these classes of antibiotics in husbandry activities (Šustačkova et al., 2004; Kročko et al., 2011). The vancomycin-resistant E. faecalis qE-29 was also resistant to teicoplanin (Table 3). Regarding antibiotic resistance in E. faecium, we detected resistance to five to six antibiotics in eight strains analyzed in this study (E. faecium H2OP3, KAA1, KAA3, KAA4, YA 2, qE-11, qE-18, and qE-23), all of them of animal origin except for H2OP3 (water) and only in three strains (E. faecium H2, Mz1B, and S1) reported previously by Valenzuela et al. (2008) and included in the current study. The presence of MR bacteria in foods may have a negative impact on treatment outcomes as well as increased treatment costs (Roberts et al., 2009; Wassenberg et al., 2010) due to their transmission to human via the food chain, especially foods of animal origin such as cheese and meat. The frequent occurrence of MR enterococci in farm animals and food products was reported by several authors (Peters et al., 2003; Leclercq, 2009; Vignaroli et al., 2011), highlighting the role of nonhuman reservoirs as sources of resistance genes. In this study, the percentage of MR E. faecalis (57% of E. faecalis) was higher than E. faecium (46% of E. faecium); this may be due to the presence of resistance genes in mobile genetic elements associated with E. faecalis.

Antibiotic resistance determinants

Detection of antibiotic resistance determinants was carried out by PCR amplification of known genes in 56 MR E. faecalis and E. faecium strains. The genetic basis of the observed tetracycline resistance (TetR) was investigated by PCR amplification of tet genes: tet(L), tet(K), tet(M), tet(S), and tet(O). All of the TetR strains carried either tet(L) or tet(M), or a combination of both determinants (Table 3). The gene tet(M) was the most common among the enterococci strains studied in a similar way as reported previously in food isolates (Aarestrup et al., 2000; Huys et al., 2004; Wilcks et al., 2005), whereas tet(L) was the second-most common (Table 3); the combination of both determinants was mostly present among E. faecium isolates (13.33% in E. faecium versus 3.8% in E. faecalis strains). However, we could not detect by PCR the presence of tet(O), tet(S), and tet(K) genes in a manner similar to that reported by Wilcks et al. (2005) and Huys et al. (2004). In those cases, the incidence of tet(O) and tet(S) was very low (<10%); therefore, such low incidences may suggest that the chance of isolating enterococci bearing these resistances would be higher when the sample size is larger. Both tet(M) and tet(S) were found in raw products, whereas only tet(M) was found after fermentation, as reported by Teuber et al. (1999) and Gevers et al. (2003) in meat products.

All chloramphenicol resistant (CmR) isolates carried the cat gene, as reported in other studies (Werner et al., 2000; Teuber et al., 2003; Huys et al., 2004). We determined that four CmR E. faecalis strains were also resistant to tetracycline. The occurrence of CmR among food enterococci has been frequently reported at various incidences (Teuber et al., 1999; Franz et al., 2001). Cat genes are located usually on plasmids such as the conjugative and mobilizing, multi-resistance plasmid pRE25 from E. faecalis (Schwarz et al., 2001; Teuber et al., 2003), the conjugative plasmid pUW1965 (Werner et al., 2000), and pRUM, a non-conjugative, multidrug-resistance plasmid from E. faecium (Grady and Hayes, 2003). The sequences of the enterococcal cat genes found on plasmids usually contain genetic segments of small staphylococcal or streptococcal (i.e., pIP501) plasmids, indicating that these genes were originally obtained from Streptococcus or Staphylococcus spp. (Pepper et al., 1986; Grady and Hayes, 2003; Klare et al., 2003).

Twenty-nine (52%) of the MR enterococci strains were resistant to erythromycin (EmR). These strains were tested for the presence of erm(A), erm(B), erm(C), msrA/B, ereA/B, mefA/E, and mphA genes. 66.66% of E. faecium strains (which includes 20 of the 21 EmR MR E. faecium) yielded positive results for the PCR with primers for the efflux pump–associated msrA/B gene. This gene has also been detected previously in EmR E. faecium from foods but not in E. faecalis (Portillo et al., 2000; Hummel et al., 2007; Toomey et al., 2010), which is in accordance with the results obtained in the present study. In fact, none of the EmR E. faecalis strains harbored msrA/B genes. However, clinical E. faecalis isolates showed the presence of msrA/B genes, as reported by Chouchani et al. (2012). None of the EmR strains tested positive for erm(C), ereA/B, mefA/E, and mphA genes. The gene erm(B) was detected in eight EmR E. faecium and five E. faecalis strains. These data are in accordance with the studies of Jensen et al. (1999) and Khan et al. (2002), who found that erm(B) was the dominating EmR gene among enterococci. Jensen et al. (1999) observed that only 88% of EmR isolates contained erm(B), while erm(A) and erm(C) genes were not detected, indicating that other resistance mechanisms must also occur in enterococci. This was confirmed by Portillo et al. (2000) and Hummel et al. (2007). Furthermore, erm(B) was also detected in three additional E. faecalis strains for which erythromycin resistance was not detected by phenotype; those results were also obtained by McBride et al. (2007) in E. faecalis. This data could be explained by the fact that the erm(B) gene could be a silent gene or may lack functionality. The erm(B) genes are well known to occur on either conjugative plasmids such as pAMb1 (Martin et al., 1987), pRE25 (Teuber et al., 2003), and pUW1965 (Werner et al., 2000), or on transposons such as Tn917 (Shaw and Clewell, 1985), Tn1545 (Courvalin and Carlier, 1987), Tn5384, and Tn5385 (Bonafede et al., 1997), often linked with other antibiotic resistance determinants. Some EmR strains did not show amplification of ermA,B,C, ereA/B, mphA, mefA/E, and msrA/B genes, and thus, the mechanism and associated genes for this observed EmR are still unclear.

Regarding the multidrug efflux pump EfrAB, the results obtained in this study indicated that 96% of E. faecalis strains possess efrA and/or efrB genes, whereas only 13% of E. faecium strains carried efrA and efrB genes. This is the first work describing the presence of the ABC Multidrug Efflux Pump in E. faecium previously reported in E. faecalis (Lee et al., 2003), which suggests the possibility of co-transfer of resistance genes between both species in foods.

Conclusion

Our results suggest that fermented foods of both animal and vegetable origins are possible reservoirs of multi-drug-resistant enterococci. The isolates were resistant to three or more antibiotics simultaneously, so enterococci strains should come under tighter control. Due to the high number of MR E. faecium and E. faecalis strains with resistance to common antibiotics, it is necessary to re-evaluate the use of therapeutic antibiotics in stock farms at both regional and international levels.

Footnotes

Acknowledgments

This work was supported by grants AGL2009-08921, P08-AGR-4295, Plan propio de la Universidad de Jaén, and Campus de Excelencia Internacional Agroalimentario CeiA3.

Disclosure Statement

No competing financial interests exist.

References

Aarestrup

, Agerso

, Gerner-Smidt

, Madsen

, Jensen

. Comparison of antimicrobial resistance phenotypes and resistance genes in Enterococcus faecalis and Enterococcus faecium from humans in the community, broilers, and pigs in Denmark. Diag Microbiol Infect Dis, 2000; 37:127–137.

Abriouel

, Lucas

, Ben Omar

, Valdivia

, Maqueda

, Martínez-Cañamero

, Gálvez

. Enterocin AS-48RJ: A variant of enterocin AS-48 chromosomally encoded by Enterococcus faecium RJ16 isolated from food. Syst Appl Microbiol, 2005; 28:383–397.

Ben Omar

, Castro

, Lucas

, Abriouel

, Yousif

, Franz

, Holzapfel

, Pérez-Pulido

, Martínez-Cañamero

, Gálvez

. Functional and safety aspects of enterococci isolated from different Spanish foods. Syst Appl Microbiol, 2004; 27:118–130.

Bonafede

, Carias

, Rice

. Enterococcal transposon Tn5384: Evolution of a composite transposon through cointegration of enterococcal and staphylococcal plasmids. Antimicrob Agents Chemother, 1997; 41:1854–1858.

Brown

, Brown

, Cookson

, Duckworth

, Farrington

, French

, King

, Lewis

, Livermore

, Macrae

, Scott

, Williams

, Woodford

. National glycopeptide-resistant enterococcal bacteraemia surveillance Working Group report to the Department of Health–August 2004. J Hosp Infect, 2006; 62:1–27.

Chouchani

, El Salabi

, Marrakchi

, Ferchichi

, Walsh

. First report of mefA and msrA/msrB multidrug efflux pumps associated with bla_TEM-1 β-lactamase in Enterococcus faecalis. Int J Infect Dis, 2012; 16:e104–e109.

Courvalin

, Carlier

. Tn1545: A conjugative shuttle transposon. Mol Gen Genet, 1987; 206:259–264.

de Jong

, Bywater

, Butty

, Deroover

, Godinho

, Klein

, Marion

, Simjee

, Smets

, Thomas

, Vallé

, Wheadon

. A pan-European survey of antimicrobial susceptibility towards human-use antimicrobial drugs among zoonotic and commensal enteric bacteria isolated from healthy food-producing animals. J Antmicrob Chemother, 2009; 63:733–744.

Dever

. Emerging antibiotic resistance in nosocomial pathogens. RT: For Decision Makers in Respiratory Care, 2000 Aug/Sept.

10.

Duprè

, Zanetti

, Schito

, Fadda

, Sechi

. Incidence of virulence determinants in clinical Enterococcus faecium and Enterococcus faecalis isolates collected in Sardinia (Italy) J Med Microbiol, 2003; 52:491–498.

11.

Filipová

, Bujdákova

, Drahovská

, Lisková

, Hanzen

. Occurrence of aminoglycoside-modifying-enzyme genes aac(6′)–aph(2″), aph(3′), ant(4′) and ant(6) in clinical isolates of Enterococcus faecalis resistant to high-level of gentamicin and amikacin. Folia Microbiol (Praha), 2006; 51:57–61.

12.

Foulquié Moreno

, Sarantinopoulos

, Tsakalidou

, De Vuyst

. The role and application of enterococci in food and health. Int J Food Microbiol, 2006; 106:1–24.

13.

Fontana

, Gazzola

, Cocconcelli

, Vignolo

. Population structure and safety aspects of Enterococcus strains isolated from artisanal dry fermented sausages produced in Argentina. Lett Appl Microbiol, 2009; 49:411–414.

14.

Franz

, Holzapfel

, Stiles

. Enterococci at the crossroads of food safety? Int J Food Microbiol, 1999; 47:1–24.

15.

Franz

, Muscholl-Silberhorn

, Yousif

, Vancanneyt

, Swings

, Holzapfel

. Incidence of virulence factors and antibiotic resistance among enterococci isolated from food. Appl Environ Microbiol, 2001; 67:4385–4389.

16.

Gevers

, Danielsen

, Huys

, Swings

. Molecular characterization of tet(M) genes in Lactobacillus isolates from different types of fermented sausage. Appl Environ Microbiol, 2003; 69:1270–1275.

17.

Giraffa

. Enterococci from foods. FEMS Microbiol Rev, 2002; 26:163–171.

18.

Giraffa

, Carminati

, Neviani

. Enterococci isolated from dairy products: A review of risks and potential technological use. J Food Prot, 1997; 60:732–738.

19.

Grady

, Hayes

. Axe–Txe, a broad-spectrum proteictoxin–antitoxin system specified by a multidrug-resistant, clinical isolate of Enterococcus faecium. Mol Microbiol, 2003; 47:1419–1432.

20.

Hershberger

, Oprea

, Donabedian

, Perri

, Bozigar

, Bartlett

, Zervos

. Epidemiology of antimicrobial resistance in enterococci of animal origin. J Antmicrob Chemother, 2005; 55:127–130.

21.

Hugas

, Garriga

, Aymerich

. Functionality of enterococci in meat products. Int J Food Microbiol, 2003; 88:223–233.

22.

Hummel

, Holzapfel

, Franz

. Characterisation and transfer of antibiotic resistance genes from enterococci isolated from food. Syst Appl Microbiol, 2007; 30:1–7.

23.

Huys

, D'Haene

, Collard

, Swings

. Prevalence and molecular characterization of tetracycline resistance in Enterococcus isolates from food. Appl Environ Microbiol, 2004; 70:1555–1562.

24.

Jensen

, Frimodt-Moller

, Aarestrup

. Presence of erm gene classes in Gram-positive bacteria of animal and human origin in Denmark. FEMS Microbiol Lett, 1999; 170:151–158.

25.

Jurkovic

, Krizková

, Sojka

, Belicová

, Dusinský

, Krajcovic

, Snauwaert

, Naser

, Vandamme

, Vancanneyt

. Molecular identification and diversity of enterococci isolated from Slovak Bryndza cheese. J Gen Appl Microbiol, 2006; 52:329–337.

26.

Kacmaz

, Aksoy

. Antimicrobial resistance of enterococci in Turkey. Int J Antimicrob Agents, 2005; 25:535–538.

27.

Kročko

, Čanigová

, Ducková

, Artimová

, Bezeková

, Poston

. Antibiotic resistance of Enterococcus species isolated from raw foods of animal origin in south west part of Slovakia. Czech J Food Sci, 2011; 29:654–659.

28.

Khan

, Nawaz

, Khan

, Steele

. Detection and characterization of erythromycin-resistant methylase genes in Gram-positive bacteria isolated from poultry litter. Appl Microbiol Biotechnol, 2002; 59:377–381.

29.

Klare

, Werner

, Witte

. Enterococci. Habitats, infections, virulence factors, resistances to antibiotics. Emerging Bacterial Pathogens, Contributions to Microbiology. Mühldorfer

, Schäfer

. Basel: Karger, 2002; 108–122.

30.

Klare

, Konstabel

, Badstübner

, Werner

, Witte

. Occurrence and spread of antibiotic resistances in Enterococcus faecium. Int J Food Microbiol, 2003; 88:269–290.

31.

Kojima

, Morioka

, Kijima

, Ishihara

, Asai

, Fujisawa

, Tamura

, Takahashi

. Classification and antimicrobial susceptibilities of Enterococcus species isolated from apparently healthy food-producing animals in Japan. Zoonoses Public Health, 2010; 57:137–141.

32.

Leavis

, Bonten

MJM

, Willems

RJL

. Identification of high-risk enterococcal clonal complexes: Global dispersion and antibiotic resistance. Curr Opin Microbiol, 2006; 9:454–460.

33.

Leclercq

. Epidemiological and resistance issues in multidrug-resistant staphylococci and enterococci. Clin Microbiol Infect, 2009; 15:224–231.

34.

Lee

, Huda

, Kuroda

, Mizushima

, Tsuchiya

. EfrAB, an ABC multidrug efflux pump in Enterococcus faecalis. Antimicrob Agents Chemother, 2003; 47:3733–3738.

35.

Lester

, Frimodt-Møller

, Sørensen

, Monnet

, Hammerum

. In vivo transfer of the vanA resistance gene from an Enterococcus faecium isolate of animal origin to an E. faecium isolate of human origin in the intestines of human volunteers. Antimicrob Agents Chemother, 2006; 50:596–599.

36.

Martin

, Alloing

, Méjean

, Claverys

. Constitutive expression of erythromycin resistance mediated by the ermAM determinant of plasmid pAM beta 1 results from deletion of 50 leader peptide sequences. Plasmid, 1987; 18:250–253.

37.

McBride

, Fischetti

, Leblanc

, Moellering

Jr , Gilmore

. Genetic diversity among Enterococcus faecalis. PLoS One, 2007; 7:e582.

38.

Murray

. The life and times of the Enterococcus. Clin Microbiol Rev, 1990; 3:46–65.

39.

Pepper

, Le Bouguénec

, de Cespédès

, Horaud

. Dispersal of a plasmid-borne chloramphenicol-resistance gene in streptococcal and enterococcal plasmids. Plasmid, 1986; 16:195–203.

40.

Pérez-Pulido

, Abriouel

, Ben Omar

, Lucas

, Martínez-Cañamero

, Gálvez

. Safety and potential risks of enterococci isolated from traditional fermented capers. Food Chem Toxicol, 2006; 44:2070–2077.

41.

Peters

, Mac

, Wichmann-Schauer

, Klein

, Ellerbroek

. Species distribution and antibiotic resistance patterns of enterococci isolated from food of animal origin in Germany. Int J Food Microbiol, 2003; 88:311–314.

42.

Portillo

, Ruiz-Larrea

, Zarazaga

, Alonso

, Martinez

, Torres

. Macrolide resistance genes in Enterococcus spp. Antimicrob Agents Chemother, 2000; 44:967–971.

43.

Roberts

, Hota

, Ahmad

, Scott

2nd , Foster

, Abbasi

, Schabowski

, Kampe

, Ciavarella

, Supino

, Naples

, Cordell

, Levy

, Weinstein

. Hospital and societal costs of antimicrobial-resistant infections in a Chicago teaching hospital: Implications for antibiotic stewardship. Clin Infect Dis, 2009; 49:1175–1184.

44.

Schwarz

, Perreten

, Teuber

. Sequence of the 50-kb conjugative multiresistance plasmid pRE25 from Enterococcus faecalis RE25. Plasmid, 2001; 46:170–187.

45.

Shaw

, Clewell

. Complete nucleotide sequence of macrolide-lincosamide-streptogramin B-resistance transposon Tn917 in Streptococcus faecalis. J Bacteriol, 1985; 164:782–796.

46.

Shepard

, Gilmore

. Antibiotic-resistant enterococci: The mechanisms and dynamics of drug introduction and resistance. Microb Infect, 2002; 4:215–224.

47.

Stiles

, Holzapfel

. Lactic acid bacteria of foods and their current taxonomy. Int J Food Microbiol, 1997; 36:1–29.

48.

Šustačkova

, Napravnikova

, Schlegelova

. Antimicrobial resistance of Enterococcus spp. isolates from raw beef and meat products. Folia Microbiol, 2004; 49:411–417.

49.

Teuber

, Meile

, Schwarz

. Acquired antibiotic resistance in lactic acid bacteria from food. Anton van Leeuwenhoek, 1999; 76:115–137.

50.

Teuber

, Schwarz

, Perreten

. Molecular structure and evolution of the conjugative multiresistance plasmid pRE25 of Enterococcus faecalis isolated from a raw fermented sausage. Int J Food Microbiol, 2003; 88:325–329.

51.

Toomey

, Bolton

, Fanning

. Characterisation and transferability of antibiotic resistance genes from lactic acid bacteria isolated from Irish pork and beef abattoirs. Res Microbiol, 2010; 161:127–135.

52.

Trivedi

, Cupakova

, Karpiskova

. Virulence factors and antibiotic resistance in enterococci isolated from food-stuffs. Vet Med, 2011; 56:352–357.

53.

Valenzuela

, Omar

, Abriouel

, López

, Ortega

, Cañamero

, Gálvez

. Risk factors in enterococci isolated from foods in Morocco: Determination of antimicrobial resistance and incidence of virulence traits. Food Chem Toxicol, 2008; 46:2648–2652.

54.

Valenzuela

, Benomar

, Abriouel

, Cañamero

, Gálvez

. Isolation and identification of Enterococcus faecium from seafoods: Antimicrobial resistance and production of bacteriocin-like substances. Food Microbiol, 2010; 27:955–961.

55.

Vankerckhoven

, Van Autgaerden

, Vael

, Lammens

, Chapelle

, Rossi

, Jabes

, Goossens

. Development of a multiplex PCR for the detection of asa1, gelE, cylA, esp, and hyl genes in enterococci and survey for virulence determinants among European hospital isolates of Enterococcus faecium. J Clin Microbiol, 2004; 42:4473–4479.

56.

Vignaroli

, Zandri

, Aquilanti

, Pasquaroli

, Biavasco

. Multidrug-resistant enterococci in animal meat and faeces and co-transfer of resistance from an Enterococcus durans to a human Enterococcus faecium. Curr Microbiol, 2011; 62:1438–1447.

57.

Wassenberg

, de Wit

, van Hout

, Bonten

. Quantifying cost-effectiveness of controlling nosocomial spread of antibiotic-resistant bacteria: The case of MRSA. PLoS One, 2010; 5:e11562.

58.

Werner

, Hildebrandt

, Klare

, Witte

. Linkage of determinants for streptogramin A, macrolide-lincosamide-streptogramin B, and chloramphenicol resistance on a conjugative plasmid in Enterococcus faecium and dissemination of this cluster among streptogramin-resistant enterococci. Int J Med Microbiol, 2000; 290:543–548.

59.

Wilcks

, Andersen

, Licht

. Characterization of transferable tetracycline resistance genes in Enterococcus faecalis isolated from food. FEMS Microbiol Lett, 2005; 243:15–19.

60.

Witte

. Ecological impact of antibiotic use in animals on different complex microflora: Environment. Int J Antimicrob Agents, 2000; 14:321–325.