Characterization of Multidrug-Resistant Proteus mirabilis Isolated from Chicken Carcasses

Abstract

This study investigated genotypic and phenotypic features of antimicrobial resistance of Proteus mirabilis isolated from chicken products. Resistance to a broad spectrum of antimicrobial agents was commonly observed in the test isolates: tetracycline (100%), sulfamethoxazole (80%), chloramphenicol (66%), nalidixic acid (66%), ampicillin (60%), streptomycin (56%), ciprofloxacin (52%), kanamycin (46%), gentamicin (38%), ceftriaxone (36%), cefotaxime (34%), ceftiofur (22%), and amoxicillin-clavulanic acid (16%). The β-lactamases TEM-1 and OXA-1, and extended-spectrum β-lactamases CTX-M-9 and CMY-2 were detected in β-lactam–resistant isolates. Single mutations in gyrA and parC were found to be contributing factors for fluoroquinolone resistance. Plasmid-mediated quinolone resistance (PMQR) genes qnrA and qnrD were detected in six fluoroquinolone-resistant isolates and a superintegron element, SXT, was detected in 14 out of 50 isolates. The high-level of antimicrobial resistance of P. mirabilis isolated from food products may pose a potential threat to public health.

Introduction

P roteus mirabilis and other members of Enterobacteriaceae are the leading cause of community-associated and nosocomial infections (Jacobsen et al., 2008). P. mirabilis is an opportunistic pathogen that can cause wound and respiratory tract infections in immunocompromised individuals and is the third most common cause of complicated urinary tract infection (UTI) and the second most common cause of catheter-associated bacteriuria in long-term catheterized patients (Jacobsen et al., 2008; Rozalski et al., 1997; Watanakunakorn and Perni, 1994). The emergence of multidrug-resistant (MDR) P. mirabilis has been increasingly reported in the last few years (Aragon et al., 2008; Kim et al., 2005; Park et al., 2006; Tonkic et al., 2010). The most significant concern is their increasing resistance to β-lactams and fluoroquinolones, since these antimicrobials are typical treatment options against clinical infections caused by Proteus. Different from other Gram-negative clinical pathogens, the development of antimicrobial resistance in P. mirabilis was thought to be due to the clinical use of antimicrobials in humans, while not the use of antimicrobials in animals (Tumbarello et al., 2012).

P. mirabilis are known to exist in different kinds of food products; in particular, meat products such as pork and chicken are implicated as vehicles (Kim et al., 2005). P. mirabilis can cause food poisoning (Wang et al., 2010); therefore, its prevalence in food and the environment may contribute to clinical infections in humans. However, little is known about the contamination rate of P. mirabilis in meat products and their susceptibilities to antimicrobials, in particular the agents commonly used for treatment of clinical P. mirabilis infections. The objective of this study was therefore to understand the prevalence of P. mirabilis in chicken carcass, their susceptibilities to major antimicrobials, and the genetic basis of the prevalent resistance phenotypes among the isolates.

Materials and Methods

P. mirabilis isolation and confirmation

Fresh chicken carcass samples were purchased from supermarkets at different locations in Hong Kong from May 1, 2010 to October 31, 2010. Since there is no standard method for Proteus isolation from food, we developed a simple method for Proteus isolation in this study. We modified the Salmonella isolation protocol from the U.S. Food and Drug Administration Bacteriological Analytical Manual (FDA/BAM) to isolate Proteus. Briefly, 25 g of chicken carcass was placed in a stomacher bag with 100 mL of buffered peptone water (BPW) (Difco, Detroit, MI) and homogenized for 5 min in the stomacher. The homogenate was incubated at 35°C for 24 h. A 1-mL aliquot of pre-enriched homogenate was transferred to 10 mL of tetrathionate broth (Difco) and incubated at 42°C for 24 h. One loopful of broth was streaked onto xylose lysine deoxycholate agar plates (XLD; Difco). The plates were incubated at 35°C for 24 h, and three to four Salmonella typical colonies were picked and re-streaked on Mueller Hinton Agar (MHA) to check for the motility of the isolates. The colonies with swarming phenotype were streaked on xylose lysine tergitol 4 agars (XLT4; Difco). Isolates that showed no growth on XLT4 were further confirmed to be P. mirabilis by API20E (bioMérieux, Hazelwood, MO). Only one isolate from each sample was selected for further characterization.

Antimicrobial susceptibility testing

Antimicrobial susceptibility testing was performed on P. mirabilis isolates by the agar dilution method and interpreted according to instructions from the Clinical and Laboratory Standards Institute (CLSI, 2010). Fourteen antimicrobials were tested: nalidixic acid, ciprofloxacin, norfloxacin, ampicillin, amikacin, gentamicin, tetracycline, cefotaxime, ceftriaxone, ceftiofur, amoxicillin-clavulanic acid, trimethoprim-sulfamethoxazole, chloramphenicol, and meropenem. Escherichia coli strains American Type Culture Collection (ATCC) 25922 and 35218, Enterococcus faecalis strain ATCC 29212, and Staphylococcus aureus strain ATCC 29213 were used as quality control.

β-Lactamase and quinolone resistance determining region (QRDR) mutation determination

The presence of extended-spectrum β-lactamases (ESBLs) was determined using polymerase chain reaction (PCR) assay targeting most of the reported β-lactamases genes as previously described (Dallenne et al., 2010). Full length β-lactamase genes were amplified and sequenced by specific primers (Table 1) at Beijing Genomic Institute (Shenzhen, China). The full length of the gene was sequenced using primers targeting different regions of the gene. The QRDR of gyrA, gyrB, parC, and parE were amplified by PCR as previously described (Weigel et al., 2002). The deductive amino acid sequence was obtained and compared to the wild-type gyrA, gyrB, parC, and parE of P. mirabilis to identify the mutations. Plasmid-mediated quinolone resistance (PMQR) genes, including qnrA, qnrB, qnrC, qnrD, qnrS, qepA, aac(6’)Ib-cr, and oqxAB, were screened by PCR as described previously (Chen et al., 2007; Deng et al., 2011). Insertion sequences (ISs) were frequently detected upstream of ESBLs and found to be responsible for the capture and mobilization of the antibiotic resistance genes. Forward primers targeting insertion sequences ISCR1, ISEcp1, and IS903 and reverse primer bla _CTX-M-9-R and bla _CMY-2-R (Table 1) were used to determine the linkage between insertion sequence and CTX-M-9 or CMY-2.

Table 1.

Polymerase Chain Reaction Primers Used in This Study

Primer	Sequence (5’to 3’)
bla _CTX-M-14-F	TCGAATGGTGACAAAGAGAGTGCA
bla _CTX-M-14-R	TACTTTACAGCCCTTCGGCGATGAT
bla _CMY-2-F	ATGATGAAAAAATCGTTATGCT
bla _CMY-2-R	ATTGCAGCTTTTCAAGAAT
bla _TEM-1-F	ATGAGTATTCAACATTTTCGT
bla _TEM-1-R	ACCAATGCTTAATCAGTGA
bla _OXA-1-F	GACTTTATAAATTTAGTGTGTTTA
bla _OXA-1-R	ACGTTATGAAAAACACAATACAT
ISEcp1-F	CTGCAAACGGTGCTGCGGAA
IS903-F	CGCAGCGTCAGTGAACCCCC
ISCR1-F	AGACGCCGTGGAAGCGTGTG

Conjugation

A conjugation experiment was carried out as previously described using sodium azide–resistant E. coli J53 strain as recipient (Wong et al., 2012). Briefly, overnight cultures of ceftriaxone-resistant P. mirabilis and recipient strains were mixed and collected on a 0.45-μM membrane filter (Pall Life Sciences, Port Washington, NY), which was subjected to overnight incubation on a blood agar plate. The mixture was washed out and spread on double selective blood agar plates containing ceftriaxone (4 μg/mL) and sodium azide (100 μg/mL). The transconjugants were confirmed to be E. coli J53 by API20E.

Molecular typing

Clonal relationships between representative P. mirabilis isolates were examined by pulsed-field gel electrophoresis (PFGE) following the PulseNet PFGE protocol for E. coli (Ribot et al., 2006). Briefly, agarose-embedded DNA was digested with 50U of XbaI (Bio-Labs) for least 4 h in a water bath at 37°C. The restriction fragments were separated by electrophoresis in 0.5 Tris-borate-EDTA buffer at 14°C for 18 h using a Chef Mapper electrophoresis system (Bio-Rad, Hercules, CA) with pulse times of 2.16–63.8 s. Phage Lambda PFG ladder (New England Biolabs, Ipswich, MA) was used as DNA size marker. The gels were stained with GelRed, and DNA bands were visualized with UV transillumination (Bio-Rad). Clonal relatedness was analyzed by Bionumerics (version 6.6; Applied Maths, Sint-Martens-Latem, Belgium) with the use of Dice coefficient and a parameter of 0.5% for optimization and band matching tolerance.

Results

Antimicrobial resistance of P. mirabilis food isolates

A total of 50 positive samples were obtained from 58 (85%) fresh raw chicken carcass samples in Hong Kong during the isolation period. All Proteus isolates were intrinsically resistant to tetracycline (Maraki et al., 2012), and 80% of them were resistant to sulfamethoxazole. The resistance percentage to other agents was as follows: chloramphenicol (66%), nalidixic acid (66%), ampicillin (60%), streptomycin (56%), ciprofloxacin (52%), kanamycin (46%), gentamicin (38%), ceftriaxone (36%), cefotaxime (34%), ceftiofur (22%), and amoxicillin-clavulanic acid (16%). All isolates were susceptible to amikacin (Table 2).

Table 2.

Resistance Profiles of Proteus mirabilis Isolated from Chicken Products

Antimicrobials	Minimum inhibitory concentration, range (mg/L)	Percentage resistant (n=50)
Ampicillin	<4 to ≥64	60
Amoxicillin-clavulanic acid	<4 to ≥64	14
Cefotaxime	<0.5 to 32	34
Ceftiofur	<4 to ≥64	22
Ceftriaxone	<0.5 to ≥8	36
Sulfamethoxazole	<128 to ≥512	80
Kanamycin	<4 to ≥64	46
Streptomycin	<4 to ≥64	56
Amikacin	<8	0
Gentamicin	<2 to ≥32	38
Tetracycline	16 to ≥64	100
Chloramphenicol	8 to ≥64	66
Ciprofloxacin	<0.5 to >64	52
Nalidixic acid	<4 to ≥64	66

Mechanisms of β-lactams resistance in P. mirabilis

Four different β-lactamase genes were detected in different isolates of P. mirabilis, including bla _TEM-1, bla _OXA-1, bla _CMY-2, and bla _CTX-M-9. Full-length β-lactamase sequencing showed that these β-lactamase genes were identical to the sequence reported in the GenBank. As seen from Table 3, genes encoding β-lactamases were detected only in the β-lactam–resistant isolates, with penicillinase TEM-1 and oxacillinase OXA-1 being the most prevalent, recoverable in 21 and 18 out of 50 isolates, respectively (Table 3). Twelve isolates possessed both TEM-1 and OXA-1. Another four isolates were found to possess both CMY-2 and TEM-1 β-lactamase, and two isolates possessed TEM-1, OXA-1, and CMY-2. CTX-M-9 β-lactamase was also found in six isolates together with TEM-1 and OXA-1. Two isolates that were resistant to all extended-spectrum cephalosporins, and the other two that were resistant to cefotaxime contained only TEM-1 and OXA-1, suggesting that some novel β-lactamases, which were not detectable by the current assays, might be present in these isolates (Table 3). In addition, an insertion sequence IS903 was detected upstream of the bla _CTX-M-9 from all six bla _CTX-M-9 positive isolates. Insertion sequence, ISEcp1, was detected upstream of CMY-2 in all four CMY-2 positive isolates. The superintegron element SXT was detected in all P. mirabilis isolates that carried CMY-2 and CTX-M-9. Repeated attempts to transfer the ceftriaxone resistance phenotype from P. mirabilis to E. coli J53 were not successful.

Table 3.

Detection of β-Lactamases and QRDR Mutations in Proteus mirabilis Isolates

	MIC (mg/L)							QRDR mutation
No. of isolates	AMC	CTX	FUR	CRO	CIP	NAL	β lactamases	GyrA	GyrB	ParC	PMQR genes	SXT	PFGE patterns (no. of isolates)
8	<4	<0.5	<4	<0.5	<0.5	<4	—	—	—	—	—		A(3), B(3), C1(1), C2(1)
8	<4	<0.5	<4	<0.5	<0.5	8	—	—	—	—	—		D1(3), D2(1), E(3), F(1)
2	≥64	32	≥64	≥8	<0.5	8	TEM-1, CMY-2	—	—	—	—	SXT (n=2)	G(2)
2	<4	<0.5	<4	<0.5	1	≥64	—	S83I	—	S80I	—		H(2)
2	8	<0.5	<4	<0.5	1	≥64	—	S83I	—	S80I	—		I1(1), I2(1)
1	<4	<0.5	<4	<0.5	2	≥64	—	S83I	—	S80I	—		R(1)
2	<4	<0.5	<4	<0.5	4	≥64	—	S83I	—	S80R	—		J1(1), J2(1)
1	≥64	2	<4	2	4	≥64	TEM-1	S83I	—	S80I	—		S(1)
1	32	<0.5	<4	<0.5	4	32	OXA-1	S83I	—	S80I	—		T(1)
1	16	<0.5	<4	<0.5	4	≥64	OXA-1	S83I	—	S80I	—		U(1)
4	≥64	32	16	≥8	4	≥64	TEM-1, CMY-2	S83I	E466D	S80I	—	SXT (n=4)	K(3), L(1)
1	≥64	<0.5	<4	<0.5	8	≥64	TEM-1	S83I	—	S80I	—		M(1)
4	≥64	<0.5	<4	<0.5	16	≥64	OXA-1	S83I	—	S80I	—		N1(2), N2(2)
2	≥64	<0.5	<4	<0.5	32	≥64	TEM-1, OXA-1	S83I	—	S80I	—		O(2)
1	≥64	<0.5	<4	≥8	32	≥64	TEM-1	S83I	S464Y	S80I	qnrA (n=1)		V(1)
2	≥64	32	8	≥8	32	≥64	TEM-1, OXA-1	S83I	—	S80I	—		P(2)
1	≥64	32	≥64	≥8	32	≥64	TEM-1, OXA-1, CMY-2	S83I	—	E84K	qnrD (n=1)	SXT (n=1)	W(1)
1	≥64	32	≥64	≥8	64	≥64	TEM-1, OXA-1, CMY-2	S83I	—	S80I	qnrD (n=1)	SXT (n=1)	X(1)
6	≥64	16	≥64	≥8	64	≥64	TEM-1, OXA-1, CTX-M-9	S83I	—	S80I	qnrD (n=4)	SXT (n=6)	Q1(4), Q2(2)

QRDR, quinolone resistance determining region; MIC, minimum inhibitory concentration; PMQR, plasmid-mediated quinolone resistance; SXT, superintegron element; PFGE, pulsed-field gel electrophoresis; AMC, amoxicillin/clavulanic acid; CTX, cefotaxime; FUR, ceftiofur; CRO, ceftriaxone; CIP, ciprofloxacin; NAL, nalidixic acid.

Mechanisms of fluoroquinolone resistance in P. mirabilis

In this study, mutations in QRDRs of gyrA, gyrB, and parC genes were determined. Isolates with minimum inhibitory concentrations (MICs) of ciprofloxacin of <1 mg/L showed no mutations in any of the three target genes tested. Isolates with MICs of ciprofloxacin of 1–64 mg/L had a single mutation in both gyrA (S83I) and parC (S80I, S80R, or E84K). A single gyrB mutation at S464Y was detectable in one isolate, and a mutation at site 466 (E466D) was detected in four isolates; yet these mutations showed no correlation with the MIC of fluoroquinolone (Table 3). Taken together, double mutations in gyrA and gyrB were not common in P. mirabilis, and the single mutation in gyrA and gyrB seems to be sufficient to mediate high-level fluoroquinolone resistance. However, a single mutation in these genes sometimes only mediated intermediate resistance to fluoroquinolone in some P. mirabilis isolates, suggesting other mechanisms of fluoroquinolone resistance such as plasmid-mediated fluoroquinolone resistance, and efflux pumps may also contribute to the high-level fluoroquinolone resistance in P. mirabilis. The presence of plasmid-mediated quinolone resistance genes was also investigated in these isolates (Table 3). QnrD was detected in six isolates with MIC of CIP greater than 32 and qnrA was detected in one isolate with MIC of CIP greater than 32 (Table 3).

Molecular subtyping was performed on MDR P. mirabilis isolates, and 30 different PFGE patterns were identified in 50 P. mirabilis isolates, suggesting the spread of resistance determinants instead of clonal distribution. There is no direct correlation between specific PFGE patterns and antimicrobial resistance profiles, and genes of P. mirabilis (Table 3).

Discussion

MDR P. mirabilis is commonly isolated from patients suffering from UTIs and catheter-associated bacteriuria; such organisms are also known to spread easily within nosocomial settings (Endimiani et al., 2005; Jacobsen et al., 2008). In this study, isolates from chicken products showed unexpectedly high ciprofloxacin and cephalosporins resistance compared with recent published reports studying E. coli and Salmonella foodborne isolates (Aslam et al., 2012; Sheikh et al., 2012). In addition, isolates in the current study showed strikingly different resistant profiles from clinical isolates (Maraki et al., 2012). This suggests that the acquisition of antimicrobial resistance may be linked to the selective pressure due to the use of antimicrobials on animals to achieve the purposes of disease prevention and treatment, as well as enhancing growth rate. The high prevalence of resistance in chicken isolates may be due to the use of penicillin, fluoroquinolones, and aminoglycosides in poultry farms (McEwen and Fedorka-Cray, 2002).

Among the most striking findings is the emergence of fluoroquinolone- and extended-spectrum β-lactam–resistant P. mirabilis in foodborne isolates since resistance to these antimicrobials in clinical P. mirabilis has been extremely low (Maraki et al., 2012). These food isolates also showed differential carriage features of β-lactamases and ESBLs when compared to clinical isolates reported in the literature. β-lactamases such as TEM-1, TEM-52, TEM-110, CTX-group, SHV-type, and KPC have been reported in P. mirabilis clinical isolates (Aragon et al., 2008; Kim et al., 2005; Park et al., 2006; Tonkic et al., 2010). A recent study also reported the emergence of AmpC β-lactamases, the CMY-2 gene carried by SXT/R391-like superintegron, and other conjugative elements (Mata et al., 2011). However, this is the first report of identification of OXA-1 β-lactamase in P. mirabilis. The presence of SXT elements in P. mirabilis was also examined by screening for the SXT-specific integrase gene. ESBLs such as CMY-2 and CTX-M-9 were shown to coexist with the SXT element in this study. The co-existence of CTX-M-9 with SXT was a novel finding. In addition, the presence of different insertion sequences upstream of CTX-M-9 and CMY-2 was reported for the first time, although this phenomenon is common in other bacteria (suggesting the possible transfer of these ESBLs from other bacteria).

The mechanisms of fluoroquinolone resistance in P. mirabilis are primarily mediated by the mutations in the gyrase and topoisomerase genes (Weigel et al., 2002). In other Gram-negative bacteria such as E. coli and Salmonella, double mutations in gyrA and mutations in parC are known to contribute to the high level resistance to fluoroquinolone. However, the contribution of target mutations to P. mirabilis fluoroquinolone resistance is less understood, despite the fact that only single mutations in gyrase and topoisomerase genes have been reported. Consistently, in our work single mutations in gryA and parC were detected in high and intermediate fluoroquinolone resistance in P. mirabilis, suggesting that multiple mechanisms are needed to mediate the high-level fluoroquinolone resistance in P. mirabilis. In addition, qnrA and qnrD can only be detected in P. mirabilis isolates with high ciprofloxacin-resistant isolates (MIC 32), suggesting that these PMQR genes might be associated with the development of high fluoroquinolone resistance in P. mirabilis. qnrA and qnrD have also been reported in clinical isolates of P. mirabilis (Cambau et al., 2006). The detection of similar resistance mechanisms in food and clinical isolates suggests that environmental dissemination of MDR P. mirabilis strains might eventually cause clinical infections.

The emergence of highly resistant P. mirabilis in foods may threaten human health. First, since P. mirabilis was reported to cause food poisoning, the MDR P. mirabilis may cause more concern for treatment. Second, even most of the MDR P. mirabilis from food may not directly cause food poisoning; it may spread around and cause fecal contamination of community and hospital environment, which will subsequently result in UTIs in hospital patients and outpatients. Last, the widespread MDR P. mirabilis may favor the transfer of their antimicrobial resistance traits among P. mirabilis and from P. mirabilis to other Gram-negative pathogens, in particular Salmonella and other commensal flora. Taken together, the direct consequence of MDR P. mirabilis in food may not be clear so far, but it may cause potential problems to human health in the long run. Therefore, more studies and surveillance will be needed to monitor the antimicrobial resistance of P. mirabilis in human food, and new strategies should be devised to stop or arrest the progress of antimicrobial resistance in foodborne P. mirabilis.

Footnotes

Acknowledgments

We acknowledge Chun Yip Cheung, Ming Lai Chow, Susanna Pui Yan Law, and Hoi Ting Wong for help with bacterial isolation and critical reading of the manuscript by Edward Chan. This study was supported by Hong Kong Polytechnic University (internal grant G-U662 to S.C.).

Disclosure Statement

No competing financial interests exist.

References

Aragón

, Mirelis

, Miró

, Mata

, Gómez

, Rivera

, Coll

, Navarro

. Increase in beta-lactam–resistant Proteus mirabilis strains due to CTX-M- and CMY-type as well as new VEB- and inhibitor-resistant TEM-type beta-lactamases. J Antimicrob Chemother, 2008; 61:1029–1032.

Aslam

, Checkley

, Avery

, Chalmers

, Bohaychuk

, Gensler

, Reid-Smith

, Boerlin

. Phenotypic and genetic characterization of antimicrobial resistance in Salmonella serovars isolated from retail meats in Alberta, Canada. Food Microbiol, 2012; 32:110–117.

Cambau

, Lascols

, Sougakoff

, Bébéar

, Bonnet

, Cavallo

, Gutmann

, Ploy

, Jarlier

, Soussy

, Robert

. Occurrence of qnrA-positive clinical isolates in French teaching hospitals during 2002–2005. Clin Microbiol Infect, 2006; 12:1013–1020.

Cernohorská

, Chvilova

. [Proteus mirabilis isolated from urine, resistance to antibiotics and biofilm formation] Klin Mikrobiol Infekc Lek, 2011; 17:81–85(In Czech.)

Chen

, Cui

, McDermott

, Zhao

, White

, Paulsen

, Meng

. Contribution of target gene mutations and efflux to decreased susceptibility of Salmonella enterica serovar Typhimurium to fluoroquinolones and other antimicrobials. Antimicrob Agents Chemother, 2007; 51:535–542.

[CLSI] Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; Twentieth Informational Supplement. CLSI Document M100-S20. Wayne, PA: CLSI, 2010.

Dallenne

, Da Costa

, Decre

, Favier

, Arlet

. Development of a set of multiplex PCR assays for the detection of genes encoding important B-lactamases in Enterobacteriaceae. J Antimicrob Chemother, 2010; 65:490–495.

Deng

, Zeng

, Chen

, He

, Liu

, Wu

, Chen

, Yao

, Hou

, Yang

, Liu

. Dissemination of IncFII plasmids carrying rmtB and qepA in Escherichia coli from pigs, farm workers and the environment. Clin Microbiol Infect, 2011; 17:1740–1745.

Endimiani

, Luzzaro

, Brigante

, Perilli

, Lombardi

, Amicosante

, Rossolini

, Toniolo

. Proteus mirabilis bloodstream infections: Risk factors and treatment outcome related to the expression of extended-spectrum beta-lactamases. Antimicrob Agents Chemother, 2005; 49:2598–2605.

10.

Jacobsen

, Stickler

, Mobley

, Shirtliff

. Complicated catheter-associated urinary tract infections due to Escherichia coli and Proteus mirabilis. Clin Microbiol Rev, 2008; 21:26–59.

11.

Kim

, Wei

, An

. Molecular characterization of multidrug-resistant Proteus mirabilis isolates from retail meat products. J Food Prot, 2005; 68:1408–1413.

12.

Maraki

, Samonis

, Karageorgopoulos

, Mavros

, Kofteridis

, Falagas

. In vitro antimicrobial susceptibility to isepamicin of 6,296 Enterobacteriaceae clinical isolates collected at a tertiary care university hospital in Greece. Antimicrob Agents Chemother, 2012; 56:3067–3073.

13.

Mata

, Navarro

, Miro

, Walsh

, Mirelis

, Toleman

. Prevalence of SXT/R391-like integrative and conjugative elements carrying blaCMY-2 in Proteus mirabilis. J Antimicrob Chemother, 2011; 66:2266–2270.

14.

McEwen

, Fedorka-Cray

. Antimicrobial use and resistance in animals. Clin Infect Dis, 2002; 34,Suppl 3:S93–S106.

15.

Park

, Uh

, Lee

, Lim

, Kim

, Jeong

. Prevalence and resistance patterns of extended-spectrum and AmpC beta-lactamase in Escherichia coli, Klebsiella pneumoniae, Proteus mirabilis, and Salmonella serovar Stanley in a Korean tertiary hospital. APMIS, 2010; 118:801–808.

16.

Park

, Lee

, Kim

, Oh

, Woo

, Lee

. Occurrence of extended-spectrum (beta)–lactamases and plasmid-mediated AmpC (beta)–lactamases among Korean isolates of Proteus mirabilis. J Antimicrob Chemother, 2006; 57:156–158.

17.

Ribot

, Fair

, Gautom

, Cameron

, Hunter

, Swaminathan

, Barrett

. Standardization of pulsed-field gel electrophoresis protocols for the subtyping of Escherichia coli O157:H7, Salmonella, and Shigella for PulseNet. Foodborne Pathog Dis, 2006; 3:59–67.

18.

Rozalski

, Sidorczyk

, Kotelko

. Potential virulence factors of Proteus bacilli. Microbiol Mol Biol Rev, 1997; 61:65–89.

19.

Sekowska

, Janicka

, Wroblewska

, Kruszynska

. [Prevalence of Proteus mirabilis strains in clinical specimens and evaluation of their resistance to selected antibiotics] Pol Merkur Lekarski, 2004; 17:538–540(In Polish.)

20.

Sheikh

, Checkley

, Avery

, Chalmers

, Bohaychuk

, Boerlin

, Reid-Smith

, Aslam

. Antimicrobial resistance and resistance genes in Escherichia coli isolated from retail meat purchased in Alberta, Canada. Foodborne Pathog Dis, 2012; 9:625–631.

21.

Tonkic

, Mohar

, Sisko-Kraljević

, Mesko-Meglic

, Goić-Barisić

, Novak

, Kovacić

, Punda-Polić

. High prevalence and molecular characterization of extended-spectrum beta-lactamase-producing Proteus mirabilis strains in southern Croatia. J Med Microbiol, 2010; 59:1185–1190.

22.

Tumbarello

, Trecarichi

, Fiori

, Losito

, D'Inzeo

, Campana

, Ruggeri

, Di Meco

, Liberto

, Fadda

, Cauda

, Spanu

. Multidrug-resistant Proteus mirabilis bloodstream infections: Risk factors and outcomes. Antimicrob Agents Chemother, 2012; 56:3224–3231.

23.

Wang

, Guo

, Xu

, Wang

, Ye

, Wu

, Hooper

, Wang

. New plasmid-mediated quinolone resistance gene, qnrC, found in a clinical isolate of Proteus mirabilis. Antimicrob Agents Chemother, 2009; 53:1892–1897.

24.

Wang

, Zhang

, Yu

, Zhang

, Yuan

, Sun

, Zhang

, Zhu

, Song

. An outbreak of Proteus mirabilis food poisoning associated with eating stewed pork balls in brown sauce, Beijing. Food Control, 2010; 21:302–305.

25.

Watanakunakorn

, Perni

. Proteus mirabilis bacteremia: A review of 176 cases during 1980–1992. Scand J Infect Dis, 1994; 26:361–367.

26.

Weigel

, Anderson

, Tenover

. DNA gyrase and topoisomerase IV mutations associated with fluoroquinolone resistance in Proteus mirabilis. Antimicrob Agents Chemother, 2002; 46:2582–2587.

27.

Wong

, Liu

, Wan

, Chen

. Characterization of extended-spectrum-beta-lactamase-producing Vibrio parahaemolyticus. Antimicrob Agents Chemother, 2012; 56:4026–4028.