Reduction of Salmonella enterica Serovar Typhimurium DT104 Infection in Experimentally Challenged Weaned Pigs Fed a Lactobacillus -Fermented Feed

Abstract

Salmonella Typhimurium is a foodborne pathogen and commonly present on pig farms. Probiotics have shown potential as a means of reducing Salmonella shedding in pigs. Three experimental challenge trials were conducted to investigate the potential application of newly isolated Lactobacillus isolates for controlling Salmonella infection in pigs. In each trial, 16 Yorkshire piglets (28-d old) were randomly allocated to 1 of 4 dietary treatments: (1) basal diet (BD), (2) naturally fermented (NF) feed, (3) Lactobacillus zeae–fermented (LZ-F) feed, and 4) Lactobacillus casei-fermented (LC-F) feed. All pigs consumed their assigned diets for 3 d prior to the challenge of Salmonella Typhimurium DT104 (approximately 6 log colony-forming units/pig) through gavage. Pediococcus pentosaceus, L. zeae, and L. casei were most abundant in NF, LZ-F, and LC-F feed, respectively. After the challenge, pigs on fermented feed had lower rectal temperature, diarrhea scores, serum haptoglobin concentrations, and intestinal Salmonella counts than the control group (BD) (p≤0.01). Salmonella spp. were detected in both ileocecal lymph nodes (ICLN) and spleens from all pigs on BD, NF, and LC-F, but only 50% of spleens from pigs on LZ-F. Pigs had a dynamic spatial and temporal immune response to Salmonella infection and dietary treatments, as indicated by up- and downregulation in gene expression of inflammatory cytokines (interleukin (IL)-1β, IL-6, IL-10, interferon-γ, and tumor necrosis factor) in the ileum, ICLN, and spleen. The alternation in cytokine expression by fermented feed, particularly LZ-F, appeared to benefit pigs in combating Salmonella infection.

Introduction

S almonella enterica serovar Typhimurium DT104 presents a major concern in public health (Threlfall et al., 1998; Boyd et al., 2006) and is the most common serovar/pathotype of Salmonella detected in Ontario pig farms (Farzan et al., 2004). Control of Salmonella infection in food animals is important but challenging. Probiotics have been suggested as a possible approach. Some probiotic bacteria (e.g., lactobacilli) have been reported to reduce Salmonella infection in animals, including pigs (Casey et al., 2007) and chickens (Pascual et al., 1999). The nematode Caenorhabditis elegans has become increasingly used for effective screening of antimicrobial agents (Moy et al., 2006). Using this system, we recently selected several Lactobacillus isolates that were able to protect C. elegans from Salmonella Typhimurium infection-caused death (Wang et al., 2011). Two of these isolates were used in the present study to determine the effect of their fermented feed on reducing Salmonella infection in pigs experimentally challenged with Salmonella Typhimurium DT104 and to evaluate the host response to Salmonella infection.

Materials and Methods

Bacteria growth and feed fermentation

Two Lactobacillus isolates belonging to L. zeae and L. casei, respectively, were used for the present study because of their difference in protecting C. elegans from Salmonella Typhimurium DT104 infection-caused death (Wang et al., 2011). Lactobacillus isolates were grown in DeMan, Rogosa, and Sharpe (MRS) broth (Fisher Scientific, Ottawa, Canada) at 37°C for 18 h without agitation under an atmosphere (85% N₂, 10% CO₂, and 5% H₂). Salmonella Typhimurium DT104 strain SA970934, a porcine multiantibiotic-resistant isolate (Poppe et al., 2002), was cultured in tryptic soy broth at 37°C for 16 h.

Three fermented feeds were prepared (i.e., naturally fermented [fermented by indigenous microbes in feed, NF], L. zeae-fermented [LZ-F], and L. casei-fermented [LC-F]) feed. To prepare the feed, 2 kg commercial corn and soybean meal–based particle feed (antibiotics free) were mixed with 4.4 kg tap water in a 10-L plastic bucket. The mixtures were inoculated with a Lactobacillus culture to reach a final concentration of 1×10⁷ colony-forming units (CFU)/g, or without any inoculant for the NF feed, incubated (30±0.5°C with 75±2% relative humidity) without air agitation for 24 h for Trial 1 and 48 h for Trials 2 and 3, and mixed every 6 h manually. Before and after the fermentation, fermented feed were measured for pH values and sampled for analyses of short-chain organic acid (SCOA) and the population of lactic acid–producing bacteria (LAB).

Animals and management

Three challenge trials were conducted. A procedure for Salmonella challenge and dietary treatments that had been established previously (Gong and Friendship, unpublished data) was applied in the present study. The protocol for the animal trials was approved by the Animal Care and Use Committee of University of Guelph. Sixteen Yorkshire weaned pigs at an age of 28 d and average body weight of 6.55 (SE=0.20) kg were divided into 4 groups (2 males and 2 females per group) in a randomized complete block design and were maintained in 4 environmentally controlled rooms (temperature: 28±2°C, relative humidity: 65%–75%). The dietary treatments were basal diet (BD), BD fermented naturally (NF), fermented with isolate L. zeae (LZ-F), or isolate L. casei (LC-F). All pigs were fed 4 times daily (9:00 a.m., 1:00 p.m., 5:00 p.m., and 9:00 p.m.). Water was freely available. The pigs consumed the experimental diets for 3 d (d 1–d 3) followed by challenge with Salmonella Typhimurium DT104 through gavage, twice (d4 and d5) in Trials 1 and 3 and once (d4) in Trial 2. The challenge dosage per pig was 1 mL (1×10⁶ CFU/mL) in Trials 1 and 2, and 2 mL (6×10⁶ CFU/mL) in Trial 3. Pigs were continued on the experimental diets, after Salmonella challenge, for 6 d in Trial 1, and 3 d in Trials 2 and 3 until they were euthanized for sample collection.

Rectal temperature, diarrhea incidence, and diarrhea scores

Pig rectal temperature and incidence of diarrhea were recorded twice a day (9:00 a.m. and 3:00 p.m.) from d0 to d4 postinfection (PI) in Trial 1, and d 0 to 2 PI in Trials 2 and 3. The severity of diarrhea was scored as follows: 0, normal, firm feces; 1, possibly slight diarrhea; 2, loose and unformed fluid feces; and 3, very watery diarrhea (Liu et al., 2008).

Sample collection

For Salmonella counting, approximate 2-g fecal samples were collected on d 0–d 3 PI in Trials 2 and 3 in the morning before pigs consumed the experimental diets. Blood samples (approximately 5 mL per piglet) were collected by venipuncture of the jugular vein into heparin-free Vacutainer^® tubes (BD, Franklin Lakes, NJ) 1 h prior to feeding in the morning on d 0, 2, 3, and 7 PI in Trial 1, and d 0–d 3 PI in Trial 3. The blood samples were kept at 4°C overnight before centrifugation (750×g, 10 min at 4°C) to prepare serum. All pigs were euthanized on d 7 PI in Trial 1, and d 3 PI in Trials 2 and 3. Ileal and cecal digesta were collected in Trials 2 and 3, and approximate 2 g each of ileocecal lymph nodes (ICLN) and spleen tissues were collected in Trial 3. These samples were kept on ice for later Salmonella counting. In Trials 1 and 3, approximate 2 cm of posterior ileum (1 cm above the ileocecal junction) and 2 g each of ICLN and spleen tissues were collected for RNA extraction according to the procedure described previously (Sarson et al., 2009).

Analysis of SCOA

The concentration of SCOAs, including lactate, acetate, propionate, isobutyrate, and butyrate, in fermented feed was measured using a Thermo Finnigan high-performance liquid chromatography instrument (Thermo Finnigan, San Jose, CA) as described previously (Ying et al., 2013).

Bacterial quantitation

The total and predominant populations of LAB in the fermented feed were determined by plating on MRS agar, microscopic examination, and sequence analysis of 16S rRNA genes of bacterial cells recovered from individual single colonies. Approximate 0.5 g fermented feed was used for the analyses. Plating was accomplished by the Eddy Jet Spiral Plater (Neu-tec Group, Farmingdale, NY) with the detection limit of 100 CFU/g digesta or tissue sample. After CFU counting, 20 colonies that represented their community were selected from each plate (containing 30–200 colonies, 4 plates per feed) for microscopic examination and 16S rDAN sequence analysis (Gong et al., 2002a, b) after grown in MRS broth. The abundance of the first and second predominant LAB species was expressed as the percentage of the particular bacterium against total numbers of LAB in each feed.

To determine Salmonella counts, while 0.5 g feces or digesta sample was plated directly on BG Sulfa Agar by the Eddy Jet Spiral Plater after a series of 10-fold dilution in 0.1% peptone water, 0.5 g ICLN or spleen tissue was homogenized in 0.85% saline (1:9 ratio) prior to plating. The plates were incubated at 37°C for 18 h before Salmonella counting.

Serum haptoglobin assay

The concentration of haptoglobin in the serum was determined using a PowerWave TM XS Microplate Reader (BioTeK, Winooski, VT) and enzyme-linked immunosorbent assay kit (Pig Haptoglobin ELISA, Kamiya Biomedical Company, Seattle, WA) according to the manufacturer's manual.

RNA extraction, reverse transcription, and quantitative polymerase chain reaction (PCR) assays

The gene expression of key cytokines associated with Salmonella Typhimurium DT104 infection in the ileum, ICLN, and spleen was determined by quantitative PCR assays after RNA extraction and reverse transcription according to the procedures described previously (Sarson et al., 2009). PCR primers for the reference gene (porcine β-actin) and target genes of interferon-γ (IFN-γ), interleukin-1β (IL-1β), IL-6, IL-10, and tumor necrosis factor (TNF) are listed in Table 1. The relative abundance (fold changes) of target gene was analyzed using the 2^-ΔΔCt method (Arocho et al., 2006).

Table 1.

Polymerase Chain Reaction Primers

Gene	GenBank accession no.	Amplicon size (bp)	Annealing (°C)	Primer sequence (5′-3′)	Reference
IFN-γ	NM_213948.1	410	52	F: GTTTTTCTGGCTCTTACTGC R: CTTCCGCTTTCTTAGGTTAG	Fournout et al., 2000
IL-1β	NM_214055.1	417	57	F: TCAGGCAGATGGTGTCTGTC R: GGTCTATATCCTCCAGCTGC	Cho and Chae, 2003
IL-6	NM_214399.1	493	58	F: ATGAACTCCCTCTCCACAAGC R: TGGCTTTGTCTGGATTCTTTC	Fournout et al., 2000
IL-10	NM_214041.1	446	56	F: GCATCCACTTCCCAACCA R: CTTCCTCATCTTCATCGTCAT	Marin et al., 2002
TNF	NM_214022.1	291	57	F: GCTGTACCTCATCTACTCCC R: TAGACCTGCCCAGATTCAGC	Cho and Chae, 2003
B-actin	XM_003357928.1	187	57	F: TCCCTGGAGAAGAGCTACGA R: TGTTGGCGTAGAGGTCCTTC	Wilkinson et al., 2010

IFN-γ, interferon-γ; IL-1β, interleukin-1β; IL-6, interleukin-6; IL-10, interleukin-10; TNF, tumor necrosis factor.

Statistical analysis

A multivariable regression method in Stata 11.0 (StataCorp, College Station, TX) was used to analyze the data on diarrhea scores, rectal temperature, levels of Salmonella in fecal and digesta samples (fecal and digesta) from Trials 2 and 3, and serum concentration of haptoglobin in Trials 1 and 3. The data on the pH values of fermented feed and the level of Salmonella in the tissue samples from Trial 3 were analyzed by one-way analysis of variance of SAS (SAS Institute, Inc., Cary, NC). The data on the gene expression of key cytokines associated with Salmonella infection in the tissues of ileum, ICLN, and spleen from Trials 1 and 3 were analyzed as a split-plot design for repeated measures using the general linear model procedure of SAS. The comparisons among treatments within tissues were made when a significant F test (p<0.05) for the treatment×tissue interaction was observed. The multiple comparisons were tested by the Tukey–Kramer method to determine differences among treatment means. A p<0.05 was used to assess a statistical significance.

Results

pH values, short-chain organic acid production, and LAB population in fermented feed

The pH values of feed were all significantly decreased after fermentation regardless of whether they had been inoculated or not. Lactate and acetate were the two major acids produced during the fermentation. The lactate concentrations of the LZ-F feed for the 3 animal trials were 263, 308, and 320 mmol/L, respectively. A significantly higher (p<0.05) production of this acid was detected in the LZ-F feed compared to other fermented feed for Trials 1 and 2, but only numerically higher for Trial 3. The LC-F feed tended to produce the highest level of acetate (64, 78, and 87 mmol/L, respectively, in the 3 trials); the level of acetate in the LC-F feed was significantly higher (p<0.05) than that in the NF feed, but only numerically higher (p>0.05) compared with the LZ-F feed (data not shown). Total counts of LAB in each fermented feed were up to 9 log CFU/g feed. The most predominant species were Pediococcus pentosaceus, L. zeae, L. casei in NF, LZ-F, and LC-F feed, respectively (Table 2).

Table 2.

Population of Lactic Acid–Producing Bacteria in Fermented Feed

	Fermented feed
Bacterial population	NF	LZ-F	LC-F
First predominant	Pediococcus pentosaceus	Lactobacillus zeae	Lactobacillus casei
	1.58×10⁹ CFU/mL	5.48×10⁹ CFU/mL	3.75×10⁹ CFU/mL
Second predominant	Weissella cibaria	Lactobacillus curvatus	Lactococcus lactis
	1.98×10⁸ CFU/mL	2.41×10⁸ CFU/mL	2.08×10⁸ CFU/mL

CFU, colony-forming units; LC-F, Lactobacillus casei fermented feed; LZ-F, Lactobacillus zeae fermented feed; NF, naturally fermented feed (fermented by indigenous microbes in feed).

Clinical signs

Nearly all pigs in Trials 1 and 3 showed typical clinical signs of salmonellosis, such as anorexia, depression, fever, and diarrhea after infection with Salmonella Typhimurium DT104. However, the severity of infection differed between trials and treatments. For example, one pig in the BD-fed group in Trial 1 was euthanized on d 2 PI due to watery diarrhea and high fever. Pigs on the NF, LZ-F, and LC-F feed had lower (p≤0.01) diarrhea scores compared with the pigs on BD. Compared to Trial 1, the effect on reducing diarrhea scores by the fermented feed was more obvious in Trials 2 and 3. The rectal temperatures of the pigs receiving the NF, LZ-F, and LC-F feed were lower (p<0.01) than those on the BD. However, no significant differences were observed in the pigs treated with different fermented feed (Table 3).

Table 3.

Effect of Lactobacillus Isolates on Reducing Salmonella Infection in Pigs Analyzed by Multivariable Regression Method

Parameter	Coefficient	Standard error	95% Confidence interval	p-Value
Diarrhea scores
BD	Reference
NF	−0.96	0.27	−1.50, 0.43	<0.01
LZ-F	−0.61	0.24	−1.08, −0.15	0.01
LC-F	−1.00	0.27	−1.53, −0.47	<0.01
Trial 1	Reference
Trial 2	−0.48	0.23	−0.94, −0.02	0.04
Trial 3	−0.49	0.24	−0.96, −0.02	0.04
Rectal temperature (°C)
BD	Reference
NF	−0.50	0.09	−0.67, −0.33	<0.01
LZ-F	−0.49	0.09	−0.66, −0.32	<0.01
LC-F	−0.47	0.09	−0.64, −0.30	<0.01
Trial 1	Reference
Trial 2	0.25	0.08	0.09, 0.41	<0.01
Trial 3	0.47	0.08	0.31, 0.63	<0.01
Salmonella in ileal digesta (log CFU/g)
BD	Reference
NF	−2.82	0.73	−4.33, −1.31	<0.01
LZ-F	−1.35	0.79	−3.00, 0.29	0.10
LC-F	−2.84	0.94	−4.80, −0.88	0.01
Trial 2	Reference
Trial 3	1.65	0.63	0.34, 2.96	0.02
Salmonella in cecal digesta (log CFU/g)
BD	Reference
NF	−0.74	0.59	−1.96, 0.47	0.22
LZ-F	−0.80	0.59	−2.02, 0.41	0.19
LC-F	−1.87	0.59	−3.08, −0.65	<0.01
Trial 2	Reference
Trial 3	1.21	0.42	0.35, 2.07	0.01
Salmonella in feces (log CFU/g)
BD	Reference
NF	−1.14	0.32	−1.76, −0.51	<0.01
LZ-F	−0.95	0.32	−1.57, −0.32	<0.01
LC-F	−1.12	0.32	−1.74, −0.49	<0.01
Trial 2	Reference
Trial 3	1.08	0.23	0.63, 1.53	<0.01
Serum haptoglobin level (mg/L)
BD	Reference
NF	−178.85	22.80	−223.55, −134.15	<0.01
LZ−F	−190.97	22.80	−235.67, −146.28	<0.01
LC-F	−147.90	22.80	−192.60, −103.20	<0.01
Trial 1	Reference
Trial 3	−95.13	16.50	−127.46, −62.80	<0.01

Salmonella counts were not measured in Trial 1.

BD, pigs on basal feed; LC-F, pigs on Lactobacillus casei fermented feed; LZ-F, pigs on Lactobacillus zeae fermented feed; NF, pigs on naturally fermented feed (fermented by indigenous microbes in feed); CFU, colony-forming units. n=4.

Salmonella counts

No Salmonella was detected in any fecal samples collected before challenge. Salmonella counts from digesta, ICLN, and spleen samples are shown in Table 3. The highest reduction of Salmonella counts in the ileal digesta was detected in pigs fed NF or LC-F feed (p≤0.01). Salmonella counts in the cecal digesta were also lower in pigs receiving LC-F feed compared with the pigs on BD (p<0.01). A reduction in Salmonella counts of fecal samples was also observed in pigs fed NF, LZ-F, or LC-F feed compared with the pigs on BD (p<0.01). The effect of the fermented feed on reducing Salmonella counts was greater in Trial 2 than in Trial 3. Salmonella was recovered from the ICLN and spleen of all pigs fed BD, NF, and LC-F feed; however, it was cultured from the spleen of only 50% of the pigs on LZ-F feed.

Serum haptoglobin concentrations

The fermented diets, whether inoculated with Lactobacillus or not, all significantly reduced the level of haptoglobin in the serum of pigs compared to BD (p<0.01) (Table 3). This effect was even greater in Trial 3 than in Trial 1.

Cytokine gene expression

The results of cytokine response to Salmonella infection and dietary treatments are presented in Tables 4 and 5. In general, pigs on fermented feed had a stronger local (ileum) immune response (p<0.05) than the control group, shortly after Salmonella challenge (d 3 PI). Nearly all tested cytokine genes were upregulated (p<0.05) in these pigs. The predominant upregulation was not observed in the ileum from the pigs with the same dietary treatments on d 7 PI. NF feed influenced cytokine expression differently from Lactobacillus-fermented feed. It tended to enhance more cytokines in their expression than Lactobacillus-fermented feed regardless of tissue types and days PI. In particular, the expression of IL-10 (anti-inflammatory cytokine) was always higher (p<0.05) in pigs on NF feed than those on Lactobacillus-fermented feed. Pigs on NF feed also had the highest level expression of INF-γ in all examined tissue samples, with an exception of the spleen from LC-F-feed-fed pigs on d 7 PI (p<0.05). The effect of two Lactobacillus-fermented feed on cytokine gene expression also appeared to be different. Overall, fewer cytokines were enhanced in gene expression by LZ-F feed than by LC-F feed. Notably, four of five examined cytokine genes had significantly upregulated expression (p<0.05) in the spleen from LC-F-feed-fed pigs on d 7 PI.

Table 4.

Changes (N-Fold) of The Expression of Cytokine Genes in the Ileum, Ileo-Cecal Lymph Nodes and Spleen of Salmonella Typhimurium DT104-Challenged Pigs Determined by Quantitative Real Time–Polymerase Chain Reaction Assays on D7 Postinfection (Trial 1)

		Treatment
Tissue	Gene	BD	NF	LZ-F	LC-F	Pooled SEM
Ileum	IFN-γ	1.00^b	1.78^a	0.65^b	0.84^b	0.07
	IL-1β	1.00^b	0.08^c	0.22^c	1.61^a	0.05
	IL-6	1.00^b	0.15^c	0.60^b	3.99^a	0.07
	IL-10	1.00^a	0.78^b	0.64^c	0.54^c	0.02
	TNF	1.00^a	0.86^a,b	0.75^b	0.67^b	0.03
Ileocecal lymph nodes	IFN-γ	1.00^b,c	2.84^a	0.47^c	1.44^b	0.10
	IL-1β	1.00^b	1.96^a	2.18^a	0.32^c	0.10
	IL-6	1.00^b	3.39^a	0.38^c	0.17^c	0.09
	IL-10	1.00^b	2.31^a	0.42^b,c	0.27^c	0.10
	TNF	1.00^a,b	1.89^a	1.97^a	0.86^b	0.15
Spleen	IFN-γ	1.00^b,c	2.15^b	0.32^c	7.88^a	0.16
	IL-1β	1.00^b	1.88^a	0.68^b	0.50^b	0.09
	IL-6	1.00^b	0.62^b,c	0.34^c	2.29^a	0.07
	IL-10	1.00^c	2.10^b	0.45^c	9.56^a	0.15
	TNF	1.00^b	2.47^a	2.15^a	1.93^a	0.14

a–c

Values within a row with different letters differ significantly (p<0.05). n=4.

The relative abundance (fold changes) of target gene was analyzed using the 2^-ΔΔCt method (Arocho et al., 2006). The values derived from 2^-ΔΔCt represent fold changes of samples in the abundance relative to the reference group (BD-fed group). The reference samples have the 2^-ΔΔCt value of 1. ΔCt represents the difference between the Ct value with the primers to a target gene and the Ct value to the housekeeping gene (porcine β-actin). ΔΔCt represents the difference in ΔCt values between the treatment and control (BD-fed) groups. A value of >1 represents upregulation while a value of <1 represents downregulation.

BD, pigs on basal diet; LC-F, pigs on Lactobacillus casei fermented feed; LZ-F, pigs on Lactobacillus zeae fermented feed; NF, pigs on naturally fermented feed (fermented by indigenous microbes in feed); SEM, standard error of the mean; IFN-γ, interferon; IL, interleukin; TNF, tumor necrosis factor.

Table 5.

Changes (N-Fold) of the Expression of Cytokine Genes in the Ileum, Ileocecal Lymph Nodes, and Spleen of Salmonella Typhimurium DT104-Challenged Pigs Determined by Quantitative Real Time–Polymerase Chain Reaction Assays on D3 Postinfection (Trial 3)

		Treatment
Tissue	Gene	BD	NF	LZ-F	LC-F	Pooled SEM
Ileum	IFN-γ	1.00^b	2.15^a	0.89^b	1.97^a	0.07
	IL-1β	1.00^b	1.70^a	1.95^a	1.18^b	0.05
	IL-6	1.00^c	4.36^b	15.58^a	3.08^b	0.57
	IL-10	1.00^b	3.18^a	2.82^a	2.49^a	0.11
	TNF	1.00^c	6.01^a	5.11^a,b	3.98^b	0.24
Ileocecal lymph nodes	IFN-γ	1.00^b,c	3.35^a	1.92^b	0.60^c	0.19
	IL-1β	1.00^a	0.31^c	0.77^b	0.09^d	0.01
	IL-6	1.00^b	0.61^c	1.66^a	0.14^d	0.02
	IL-10	1.00^b	2.82^a	1.24^b	1.39^b	0.11
	TNF	1.00^b	1.50^a	0.66^c	0.75^b,c	0.04
Spleen	IFN-γ	1.00^b	3.52^a	0.69^b	0.73^b	0.10
	IL-1β	1.00^c	2.73^a	0.51^c	2.00^b	0.08
	IL-6	1.00^b	0.71^c	1.58^a	0.80^b,c	0.03
	IL-10	1.00^a	0.69^c	0.76^b,c	0.87^a,b	0.02
	TNF	1.00^b	1.54^a	0.75^b	1.41^a	0.04

a–c

Values within a row with different letters differ significantly (p<0.05). n=4.

Discussion

The infection of Salmonella Typhimurium in animals is a progressive process, which starts from colonization of animal intestines and then spreads to internal organs, such as spleen and liver (Côté et al., 2004). There was a report that lower doses of Salmonella Typhimurium (5.6×10⁵ or 5.6×10⁷ CFU/mL) caused significant clinic signs in young pigs, such as increase of rectal temperature and occurrences of Salmonella Typhimurium in the jejunum, cecum, tonsil, and mesenteric lymph node (Tanaka et al., 2010). In the present study, the doses of Salmonella Typhimurium DT104 for challenge were 1×10⁶ or 6×10⁶ CFU/pig. Notably, the ICLNs from pigs of all treatment groups and the spleen from pigs in BD-, NF-, and LC-F-treated groups were all infected by the pathogen. However, only 50% of pigs were infected in their spleen on d 3 PI when treated with LZ-F feed. The fermented feed with productions of SCOAs can reduce clinic signs of Salmonella infection in pigs (namely, reduction of rectal temperature and Salmonella burden in cecal digesta and feces) (Boyen et al., 2008; Michiels et al., 2012). In the present study, all pigs on fermented feed showed reduced clinic signs, suggesting possible contribution of SCOAs from the fermentation. Studies with more pigs and a standardized experimental design are required to further confirm these results.

Cytokines are a diverse group of secreted proteins that play a critical role in the regulation of innate and adaptive immune responses (Eckmann et al., 2001). Their production can be modulated by commensal bacteria in the gastrointestinal tracts (Corthésy et al., 2007). In the present study, pigs exhibited dynamic spatial and temporal changes in cytokine gene expression in response to Salmonella infection and dietary treatments of fermented feed. The response first appeared in the ileum and then spread to the ICLN and spleen. The initial response to the dietary treatments was indicated by a significant increase in the gene expression of almost all tested cytokines, including both pro- and anti-inflammatory, in the ileum of pigs on fermented feed compared to the control group. The enhanced gene expression of IFN-γ and IL-6 detected in different tissues and organs of the pigs on fermented feed after Salmonella infection implies an increased anti-Salmonella activity in the host, since the clearance of Salmonella in animals has been found to be primarily associated with a Th1-dominated response marked by high levels of IFN-γ (Stoycheva et al., 2005; Withanage et al., 2005), and IL-6 has been shown to have a significant role in the host defense against Salmonella infection (Ramsay et al., 1994; Klimpel et al., 1995).

The LZ and LC isolates were the predominant population of LAB in fermented feed (LZ-F and LC-F), respectively. The feed fermented by these two isolates exhibited some similarities in inducing the changes in cytokine gene expression, but no clear differentiation in promoting the expression of Th1 effectors and immunoregulatory cytokines. For example, pigs on the feed fermented by LZ or LC both had a similar level of IL-10 expression, except for that in the spleen of pigs on LC-F feed on d 7 PI. One general observation over the differences between the effects of two fermented feeds in the present study was the changes of cytokine expression at the earlier stage in the pigs on LZ-F feed compared to LC-F-treated pigs. In particular, there was a significant increase in the expression of IFN-γ, IL-6, IL-10, and TNF in the spleen of pigs fed LC-F feed that were sampled on d 7 PI. The reason for this increase of cytokine expression is unclear. IL-1β is a pro-inflammatory cytokine and is involved in the initiation and amplification of the inflammatory response. There is a clear correlation between the levels of IL-1β and the amount of intestinal inflammation (Strong et al., 1998). An increased IL-1β expression was detected in the ileum of pigs on LC-F feed sampled on d 7 PI, which implied an ongoing intestinal inflammation. Whether there was intestinal inflammation that was responsible for the increase of the cytokine expression remains to be learned.

Conclusions

Fermented feed appeared to benefit pigs in combating Salmonella infection. While LC-F feed was more effective in reducing pig diarrhea and intestinal burden of Salmonella, LZ-F feed was able to lower more local inflammatory/systemically acute-phase responses and Salmonella organ invasion.

Footnotes

Acknowledgments

This research was supported by Agriculture & Agri-Food Canada and University of Guelph-Ontario Ministry of Agriculture and Food Research Partnership Program. FY was a Visiting Fellow to the Canadian Federal Government Laboratories.

Disclosure Statement

No competing financial interests exist.

References

Arocho

, Chen

, Ladanyi

, Pan

. Validation of the 2DeltaDeltaCt calculation as an alternate method of data analysis for quantitative PCR of BCR-ABL P210 transcripts. Diagn Mol Pathol, 2006; 15:56–61.

Boyd

, Peters

, Ng

, Mulvey

. Partial characterization of a genomic island associated with the multidrug resistance region of Salmonella enterica Typhimurium DT104. FEMS Microbiol Lett, 2006; 189:285–291.

Boyen

, Haesebrouck

, Vanparys

, Volf

, Mahu

, van Immerseel

, Rychlik

, Dewulf

, Ducatelle

, Pasmans

. Coated fatty acids alter virulence properties of Salmonella Typhimurium and decrease intestinal colonization of pigs. Vet Microbiol, 2008; 132:319–327.

Casey

, Gardiner

, Casey

, Bradshaw

, Lawlor

, Lynch

, Leonard

, Stanton

, Ross

, Fitzgerald

. A five-strain probiotic combination reduces pathogen shedding and alleviates disease signs in pigs challenged with Salmonella enterica serovar Typhimurium. Appl Environ Microbiol, 2007; 73:1858–1863.

Cho

, Chae

. Expression of inflammatory cytokines (TNF‐α, IL‐1, IL‐6 and IL‐8) in colon of pigs naturally infected with Salmonella Typhimurium and S. Choleraesuis. J Vet Med, 2003; 50:484–487.

Corthésy

, Gaskins

, Mercenier

. Cross-talk between probiotic bacteria and the host immune system. J Nutr, 2007; 137:781S–790S.

Côté

, Letellier

, Lessard

, Quessy

. Distribution of Salmonella in tissues following natural and experimental infection in pigs. Can J Vet Res, 2004; 68:241–248.

Eckmann

, Kagnoff

. Cytokines in host defense against Salmonella . Microb Infect, 2001; 3:1191–1200.

Farzan

, Friendship

, Dewey

, Muckle

, Gray

, Funk

. Distribution of Salmonella serovars and phage types on 80 Ontario swine farms in 2004. Can J Vet Res, 2008; 72:1–6.

10.

Fournout

, Dozois

, Odin

, Desautels

, Pérès

, Hérault

, Daigle

, Segafredo

, Laffitte

, Oswald

, Fairbrother

, Oswald

. Lack of a role of cytotoxic necrotizing factor 1 toxin from Escherichia coli in bacterial pathogenicity and host cytokine response in infected germfree piglets. Infect Immun, 2000; 68:839–847.

11.

Gong

, Forster

, Yu

, Chambers

, Sabour

, Wheatcroft

, Chen

. Diversity and phylogenetic analysis of bacteria in the mucosa of chicken ceca and comparison with bacteria in the cecal lumen. FEMS Microbiol Lett, 2002a;208:1–7.

12.

Gong

, Forster

, Yu

, Chambers

, Wheatcroft

, Sabour

, Chen

. Molecular analysis of bacterial populations in the ileum of broiler chickens and comparison with bacteria in the cecum. FEMS Microbiol Ecol, 2002b;41:171–179.

13.

Klimpel

, Asuncion

, Haithcoat

, Niesel

. Cholera toxin and Salmonella typhimurium induce different cytokine profiles in the gastrointestinal tract. Infect Immun, 1995; 63:1134–1137.

14.

Liu

, Piao

, Kim

, Wang

, Shen

, Lee

, Li

. Effects of chito-oligosaccharide supplementation on the growth performance, nutrient digestibility, intestinal morphology, and fecal shedding of Escherichia coli and Lactobacillus in weaning pigs. J Anim Sci, 2008; 86:2609–2618.

15.

Marin

, Taranu

, Bunaciu

, Pascale

, Tudor

, Avram

, Sarca

, Cureu

, Criste

, Suta

, Oswald

. Changes in performance, blood parameters, humoral and cellular immune responses in weanling piglets exposed to low doses of aflatoxin. J Anim Sci, 2002; 80:1250–1257.

16.

Michiels

, Missotten

, Rasschaert

, Dierick

, Heyndrickx

, De Smet

. Effect of organic acids on Salmonella colonization and shedding in weaned piglets in a seeder model. J Food Prot, 2012; 75:1974–1983.

17.

Moy

, Ball

, Anklesaria

, Casadei

, Lewis

, Ausubel

. Identification of novel antimicrobials using a live-animal infection model. Proc Natl Acad Sci, 2006; 103:10414–10419.

18.

Pascual

, Hugas

, Badiola

, Monfort

, Garriga

. Lactobacillus salivarius CTC2197 prevents Salmonella enteritidis colonization in chickens. Appl Environ Microbiol, 1999; 65:4981–4986.

19.

Poppe

, Ziebell

, Martin

, Allen

. Diversity in antimicrobial resistance and other characteristics among Salmonella Typhimurium DT104 isolates. Microb Drug Resist, 2002; 8:107–122.

20.

Ramsay

, Husband

, Ramshaw

, Bao

, Matthaei

, Koehler

, Kopf

. The role of interleukin-6 in mucosal IgA antibody responses in vivo . Science, 1994; 264:561–563.

21.

Sarson

, Wang

, Kang

, Dowd

, Lu

, Yu

, Han

, Zhou

, Gong

. Gene expression profiling within the spleen of Clostridium perfringens-challenged broilers fed antibiotic-medicated and non-medicated diets. BMC Genom, 2009; 10:260.

22.

Stoycheva

, Murdjeva

. Serum levels of interferon-γ, interleukin-12, tumour necrosis factor-α, and interleukin-10, and bacterial clearance in patients with gastroenteric Salmonella infection. Scand J Infect Dis, 2005; 37:11–14.

23.

Strong

, Pizarro

, Klein

, Cominelli

, Fiocchi

. Proinflammatory cytokines differentially modulate their own expression in human intestinal mucosal mesenchymal cells. Gastroenterology, 1998; 114:1244–1256.

24.

Tanaka

, Imai

, Kumagae

, Sato

. The effect of feeding lactic acid to Salmonella typhimurium experimentally infected swine. J Vet Med Sci, 2010; 72:827–831.

25.

Threlfall

, Ward

, Rowe

. Multiresistant Salmonella Typhimurium DT104 and Salmonella bacteraemia. Lancet, 1998; 352:287–288.

26.

Wang

, Wang

, Gong

, Yu

, Pacan

, Niu

, Si

, Sabour

. Use of Caenorhabditis elegans for preselecting Lactobacillus isolates to control Salmonella Typhimurium. J Food Protect, 2011; 74:86–93.

27.

Wilkinson

, Sargent

, Galina-Pantoja

, Tucker

. Gene expression profiling in the lungs of pigs with different susceptibilities to Glässer's disease. BMC Genom, 2010; 11:455.

28.

Withanage

GSK

, Wigley

, Kaiser

, Mastroeni

, Brooks

, Powers

, Beal

, Barrow

, Maskell

, McConnell

. Cytokine and chemokine responses associated with clearance of a primary Salmonella enterica serovar Typhimurium infection in the chicken and in protective immunity to rechallenge. Infect Immun, 2005; 73:5173–5182.

29.

Ying

, Gong

, Goff

, Yu

, Wang

, Cui

. Effects of pig colonic digesta and dietary fibres on in vitro microbial fermentation profiles. Bioact Carbohydr Diet Fibr, 2013; 1:120–130.