Phenotypic and Molecular Characterization of Salmonella Enteritidis SE86 Isolated from Poultry and Salmonellosis Outbreaks

Abstract

Salmonella Enteritidis remains a standout among the leading causes of foodborne diseases worldwide. Previous studies have demonstrated that a unique clonal group of Salmonella Enteritidis, named SE86, is involved in foodborne outbreaks in southern Brazil and is frequently identified among strains isolated from poultry. The aim of this study was to determine the influence of the isolation source (food products involved in salmonellosis outbreaks and poultry sources) on the phenotypic and molecular characteristics of Salmonella Enteritidis SE86. A biofilm formation assay, antimicrobial susceptibility test, polymerase chain reaction identification of virulence-associated genes, and phage type 4 (PT4) assessment were performed to characterize Salmonella Enteritidis SE86. The human strains presented less antimicrobial resistance than the poultry strains. Resistance to some substances was related to the isolation source of the strain. Strains of the same clonal group presented different biofilm production abilities. Biofilm formation was independent of the isolation source at all temperatures. Temperature influenced biofilm formation only by the poultry strains. Most of the investigated genes presented a high frequency and a regular distribution, regardless of the isolation source. The spvB, spiA, pagC, sipB, prgH, spaN, sitC, and lpfC genes were associated with the avian strains, whereas iroN was associated with the strains isolated from food products involved in salmonellosis outbreaks. Most strains belonged to PT4. No relationship was found between biofilm production and antimicrobial resistance or between the virulence profile and biofilm production or antimicrobial resistance.

Introduction

S almonella remains prevalent among the leading causes of foodborne diseases worldwide (CDC, 2013; ECDC and EFSA, 2015). In Brazil, Salmonella is responsible for almost 35% of foodborne diseases according to the Brazilian Ministry of Health (Brasil, 2015). Salmonella Enteritidis is one of the most important serotypes worldwide (Foley and Lynne, 2008; Brasil, 2012; ECDC and EFSA, 2014; Robinsom, 2014), and phage type 4 (PT4) is the most frequent type in strains isolated from both humans and birds in Brazil (Nunes et al., 2003; Ribeiro et al., 2007; Vaz et al., 2010). The majority of foodborne outbreaks are associated with foods of animal origin, particularly poultry products (CDC, 2011; ECDC and EFSA, 2014).

Previous studies have demonstrated close relationships between the Salmonella Enteritidis strains involved in foodborne outbreaks in southern Brazil during the past few years; this specific clonal group is named Salmonella Enteritidis SE86 (Geimba, 2005; Oliveira et al., 2009, 2012; Tondo et al., 2015). A recent study demonstrated the spread of this unique clonal group among strains isolated from poultry and outbreak food samples (Borges et al., 2017).

Resistance of Salmonella strains isolated from both humans and animals to the most commonly used antibiotics has increased over the past decade (EFSA and ECDC, 2015). Salmonella has also developed several other survival mechanisms in addition to antimicrobial resistance. For instance, biofilm formation favors bacterial survival in hostile environments, such as slaughterhouses and food-processing plants, and it is an important problem in public health due to the release of pathogenic microorganisms, such as Salmonella (Costerton et al., 1995; Hung and Henderson, 2009; Steenackers et al., 2012). Salmonella can invade host cells, and its pathogenesis and interaction with the host are complex phenomena that depend on several virulence factors encoded by a large number of genes distributed along its chromosome and in mobile genetic elements (Groisman and Ochman, 1996; Wallis and Galyov, 2000; Skyberg et al., 2006).

Characterization of the Salmonella Enteritidis SE86 is essential to better understand why the incidence of this specific clonal group has increased in southern Brazil since 1999. In this context, the aim of this study was to determine the influence of the isolation source on the phenotypic and molecular characteristics of Salmonella Enteritidis SE86 isolated from food products involved in salmonellosis outbreaks and poultry sources.

Materials and Methods

Bacterial strains

A total of 148 Salmonella Enteritidis strains isolated from food products involved in salmonellosis outbreaks (n = 80) and from poultry sources (n = 68), including chicken meat, internal organs, and cloacal and drag swabs, were selected for this study (Table 1). The strains were serotyped by the Oswaldo Cruz Institute Foundation (Fiocruz, Brazil). These strains were previously classified by polymerase chain reaction (PCR) ribotyping as belonging to the clonal group SE86 (Borges et al., 2017). The bacterial isolates were stored frozen at −80°C in brain heart infusion broth (Oxoid, Basingstoke, United Kingdom) supplemented with 15% glycerin (Synth, Diadema, Brazil).

Table 1.

Salmonella Enteritidis SE86: Identification, Group, and Source of Isolation

Identification	Group	Source of isolation
1	Poultry	Broiler carcass
2	Poultry	Broiler carcass
3	Poultry	Broiler carcass
4	Poultry	Broiler carcass
5	Poultry	Broiler carcass
6	Poultry	Broiler carcass
7	Poultry	Broiler carcass
8	Poultry	Broiler carcass
9	Poultry	Broiler carcass
10	Poultry	Broiler carcass
11	Poultry	Broiler carcass
12	Poultry	Broiler carcass
13	Poultry	Broiler carcass
14	Poultry	Broiler carcass
15	Poultry	Broiler carcass
16	Poultry	Internal organs
17	Poultry	Internal organs
18	Poultry	Internal organs
19	Poultry	Internal organs
20	Poultry	Internal organs
21	Poultry	Internal organs
22	Poultry	Internal organs
23	Poultry	Internal organs
24	Poultry	Internal organs
25	Poultry	Internal organs
26	Poultry	Internal organs
27	Poultry	Internal organs
28	Poultry	Internal organs
29	Poultry	Drag swab
30	Poultry	Drag swab
31	Poultry	Drag swab
32	Poultry	Drag swab
33	Poultry	Drag swab
34	Poultry	Drag swab
35	Poultry	Drag swab
36	Poultry	Drag swab
37	Poultry	Drag swab
38	Poultry	Drag swab
39	Poultry	Internal organs
40	Poultry	Internal organs
41	Poultry	Internal organs
42	Poultry	Internal organs
43	Poultry	Internal organs
44	Poultry	Internal organs
45	Poultry	Internal organs
46	Poultry	Internal organs
47	Poultry	Drag swab
48	Poultry	Drag swab
49	Poultry	Drag swab
50	Poultry	Drag swab
51	Poultry	Drag swab
52	Poultry	Internal organs
53	Poultry	Internal organs
54	Poultry	Drag swab
55	Poultry	Drag swab
56	Poultry	Drag swab
57	Poultry	Internal organs
58	Poultry	Internal organs
59	Poultry	Internal organs
60	Poultry	Drag swab
61	Poultry	Broiler carcass
62	Poultry	Broiler carcass
63	Poultry	Broiler carcass
64	Poultry	Broiler carcass
65	Poultry	Broiler carcass
66	Poultry	Internal organs
67	Poultry	Internal organs
68	Poultry	Internal organs
69	Salmonellosis outbreaks	Homemade mayonnaise
70	Salmonellosis outbreaks	Homemade mayonnaise
71	Salmonellosis outbreaks	Dessert
72	Salmonellosis outbreaks	Homemade mayonnaise
73	Salmonellosis outbreaks	Dessert
74	Salmonellosis outbreaks	Dessert
75	Salmonellosis outbreaks	Homemade mayonnaise
76	Salmonellosis outbreaks	Tomato
77	Salmonellosis outbreaks	Homemade mayonnaise
78	Salmonellosis outbreaks	Beef
79	Salmonellosis outbreaks	Homemade mayonnaise
80	Salmonellosis outbreaks	Poultry meat
81	Salmonellosis outbreaks	Meat (beef + pork)
82	Salmonellosis outbreaks	Eggs
83	Salmonellosis outbreaks	Poultry meat
84	Salmonellosis outbreaks	Homemade mayonnaise
85	Salmonellosis outbreaks	Beef
86	Salmonellosis outbreaks	Sausage and similar
87	Salmonellosis outbreaks	Sauce
88	Salmonellosis outbreaks	Sausage and similar
89	Salmonellosis outbreaks	Eggs
90	Salmonellosis outbreaks	Dessert
91	Salmonellosis outbreaks	Dairy product
92	Salmonellosis outbreaks	Homemade mayonnaise
93	Salmonellosis outbreaks	Homemade mayonnaise
94	Salmonellosis outbreaks	Dessert
95	Salmonellosis outbreaks	Homemade mayonnaise
96	Salmonellosis outbreaks	Vegetable
97	Salmonellosis outbreaks	Homemade mayonnaise
98	Salmonellosis outbreaks	Beef
99	Salmonellosis outbreaks	Homemade mayonnaise
100	Salmonellosis outbreaks	Dessert
101	Salmonellosis outbreaks	Poultry meat
102	Salmonellosis outbreaks	Sausage and similar
103	Salmonellosis outbreaks	Beef
104	Salmonellosis outbreaks	Dairy product
105	Salmonellosis outbreaks	Homemade mayonnaise
106	Salmonellosis outbreaks	Homemade mayonnaise
107	Salmonellosis outbreaks	Vegetable
108	Salmonellosis outbreaks	Beef
109	Salmonellosis outbreaks	Homemade mayonnaise
110	Salmonellosis outbreaks	Vegetable
111	Salmonellosis outbreaks	Eggs
112	Salmonellosis outbreaks	Eggs
113	Salmonellosis outbreaks	Eggs
114	Salmonellosis outbreaks	Hamburger
115	Salmonellosis outbreaks	Hamburger
116	Salmonellosis outbreaks	Hamburger
117	Salmonellosis outbreaks	Hamburger
118	Salmonellosis outbreaks	Hamburger
119	Salmonellosis outbreaks	Sauce
120	Salmonellosis outbreaks	Hamburger
121	Salmonellosis outbreaks	Dessert
122	Salmonellosis outbreaks	Pork
123	Salmonellosis outbreaks	Dessert
124	Salmonellosis outbreaks	Homemade mayonnaise
125	Salmonellosis outbreaks	Dessert
126	Salmonellosis outbreaks	Sausage and similar
127	Salmonellosis outbreaks	Rice
128	Salmonellosis outbreaks	Bean
129	Salmonellosis outbreaks	Fruit
130	Salmonellosis outbreaks	Pork
131	Salmonellosis outbreaks	Sausage and similar
132	Salmonellosis outbreaks	Homemade mayonnaise
133	Salmonellosis outbreaks	Beef
134	Salmonellosis outbreaks	Bean
135	Salmonellosis outbreaks	Beef
136	Salmonellosis outbreaks	Dairy product
137	Salmonellosis outbreaks	Sausage and similar
138	Salmonellosis outbreaks	Homemade mayonnaise
139	Salmonellosis outbreaks	Poultry meat
140	Salmonellosis outbreaks	Beef
141	Salmonellosis outbreaks	Dessert
142	Salmonellosis outbreaks	Sausage and similar
143	Salmonellosis outbreaks	Vegetable
144	Salmonellosis outbreaks	Chicken offal
145	Salmonellosis outbreaks	Chicken salad
146	Salmonellosis outbreaks	Chicken salad
147	Salmonellosis outbreaks	Homemade mayonnaise
148	Salmonellosis outbreaks	Homemade mayonnaise

Antimicrobial susceptibility test

Antimicrobial susceptibility was determined by the disk diffusion technique according to the Clinical and Laboratory Standards Institute method (CLSI, 2014a). The interpretation was based on the criteria described in the approved standards VET01-S2 (CLSI, 2014b) and M100-S26 (CLSI, 2016), as appropriate. An Escherichia coli (ATCC 25922) strain was selected to ensure the validity of the test. The following antibiotic disks (Oxoid) were used: amoxicillin (AMX), 10 μg; ceftiofur (TIO), 30 μg; ciprofloxacin (CIP), 30 μg; chloramphenicol (CHL), 30 μg; enrofloxacin (ENR), 5 μg; gentamicin (GEN), 10 μg; spectinomycin (SPT), 100 μg; sulfafurazole (SOX), 300 μg; sulfamethoxazole with trimethoprim (SXT), 1.25 μg/23.75 μg; and tetracycline (TCY), 30 μg. All strains classified as intermediate were considered nonsusceptible as determined by the WHO (2015). Strains that presented resistance to three or more classes of antimicrobials were considered multidrug resistant (Schwarz et al., 2010).

Biofilm formation assay

The inoculum preparation and biofilm formation assay using a microtiter plate method were performed as previously described (Borges et al., in press). Incubation was performed under the following different temperature conditions: 37°C, optimum temperature for Salmonella growth (Gast, 2008); 28°C, temperature for the expression of the extracellular matrix components (Steenackers et al., 2012); 12°C, required by the Brazilian sanitary service in cutting rooms of broiler processing plants (Brasil, 1998); and 3°C, the ideal average temperature for domestic refrigerators (da Silva et al., 2008). The cutoff optical density (OD) for the microtiter plate test was defined as three standard deviations above the mean OD of the negative control. The strains were classified into four categories: no biofilm producer (OD_S ≤ OD_C), weak biofilm producer (OD_C < OD_S ≤ 2 × OD_C), moderate biofilm producer (2 × OD_C < OD_S ≤ 4 × OD_C), or strong biofilm producer (4 × OD_C < OD_S) (Stepanović et al., 2004).

Detection of virulence-associated genes

DNA extraction was performed by heat treatment as described by Borges et al. (2017). PCRs were conducted to detect the presence of 27 virulence-associated genes in the Salmonella strains. The genes, their descriptions, and the respective references are summarized in Table 2. The cycling conditions and reaction mixtures (25 μL) are described in Table 3. All PCRs were performed with 2.5 μL of 10 × PCR buffer (Centro de Biotecnologia UFRGS, Porto Alegre, Brazil). The cycling program was performed in the Esco Swift MaxPro thermal cycler (Esco, Singapore). The amplified products were separated by electrophoresis in a 1.5% agarose gel and stained with ethidium bromide. The fragments were transilluminated with UV light. Mannheimia haemolytica ATCC 29694 and Salmonella Enteritidis ATCC 13076 were used as the negative and positive control, respectively, for all PCRs except for the cdtB gene, for which a strain of Salmonella Senftenberg (from our laboratory stock collection) was used as the positive control. In all PCRs, a mixture of all constituents of the PCR mixed without the addition of extracted DNA was used as a PCR control.

Table 2.

Characteristics of the Analyzed Genes and Their Primer Sequences for Polymerase Chain Reaction Assay

Gene	Virulence-related function	Primer sequences (5′→3′) ^a	GenBank No.	Amplicon size (pb)	Reference ^b
lpfA	Host recognition and invasion	F: CTTTCGCTGCTGAATCTGGT	NC003197	250	Bäumler and Heffron (1995)
lpfA	Host recognition and invasion	R: CAGTGTTAACAGAAACCAGT	NC003197	250	Bäumler and Heffron (1995)
lpfC	Host recognition and invasion	F: GCCCCGCCTGAAGCCTGTGTTGC	NC003197	641	Skyberg et al. (2006)
lpfC	Host recognition and invasion	R: AGGTCGCCGCTGTTTGAGGTTGGATA	NC003197	641	Skyberg et al. (2006)
agfA (csgA)	Host recognition and invasion, biofilm formation, and cell aggregation	F: GGCGGAAGCTTGAATTCGTACTGTACTCCAGTCAAGTGGGG	NC000913	350	Doran et al. (1993)
agfA (csgA)		R: GGGAAAGGTTGAATTCAGGACGCTACTTGTG	NC000913	350	Doran et al. (1993)
sefA	Host recognition and invasion	F: GATACTGCTGAACGTAGAAGG	L11008	488	Oliveira et al. (2002)
sefA	Host recognition and invasion	R: GCGTAAATCAGCATCTGCAGTAGC	L11008	488	Oliveira et al. (2002)
pefA	Host recognition and invasion	F: GCGCCGCTCAGCCGAACCAG	NC003277	157	Skyberg et al. (2006)
pefA	Host recognition and invasion	R: GCAGCAGAAGCCCAGGAAACAGTG	NC003277	157	Skyberg et al. (2006)
spvC	Changes in the interaction of host immune system	F: CGGAAATACCATCTACAAATA	NC007208	669	Swamy et al. (1996)
spvC	Changes in the interaction of host immune system	R: CCCAAACCCATACTTACTCTG	NC007208	669	Swamy et al. (1996)
spvB	Growth within host	F: CTATCAGCCCCGCACGGAGAGCAGTTTTTA	NC003277	717	Skyberg et al. (2006)
spvB	Growth within host	R: GGAGGAGGCGGTGGCGGTGGCATCATA	NC003277	717	Skyberg et al. (2006)
invA	Host recognition and invasion	F: GTGAAATTATCGCCACGTTCGGGCAA	NC003197	284	Oliveira et al. (2002)
invA	Host recognition and invasion	R: TCATCGCACCGTCAAAGGAACC	NC003197	284	Oliveira et al. (2002)
hilA	Regulation of compounds of type three secretion systems	F: CTGCCGCAGTGTTAAGGATA	NC003197	497	Guo et al. (2000)
hilA	Regulation of compounds of type three secretion systems	R: CTGTCGCCTTAATCGCATGT	NC003197	497	Guo et al. (2000)
avrA	Secreted effector protein	F: GTTATGGACGGAACGACATCGG	NC003197	385	Prager et al. (2003)
avrA	Secreted effector protein	R: ATTCTGCTTCCCGCCGCC	NC003197	385	Prager et al. (2003)
sopB	Host recognition and invasion	F: CGGACCGGCCAGCAACAAAACAAGAAGAAG	NC003197	220	Skyberg et al. (2006)
sopB	Host recognition and invasion	R: TAGTGATGCCCGTTATGCGTGAGTGTATT	NC003197	220	Skyberg et al. (2006)
sopE	Cytoskeletal rearrangements and membrane ruffling	F: ACACACTTTCACCGAGGAAGCG	NC003198	398	Prager et al. (2003)
sopE	Cytoskeletal rearrangements and membrane ruffling	R: GGATGCCTTCTGATGTTGACTGG	NC003198	398	Prager et al. (2003)
orgA	Host recognition and invasion	F: CAGCGCTGGGGATTACCGTTTTG	NC003197	255	Skyberg et al. (2006)
orgA	Host recognition and invasion	R: TTTTTGGCAATGCATCAGGGAACA	NC003197	255	Skyberg et al. (2006)
prgH	Host recognition and invasion	F: GCCCGAGCAGCCTGAGAAGTTAGAAA	NC003197	756	Skyberg et al. (2006)
prgH	Host recognition and invasion	R: TGAAATGAGCGCCCCTTGAGCCAGTC	NC003197	756	Skyberg et al. (2006)
spaN	Entry into nonphagocytic cells, killing of macrophages	F: AAAAGCCGTGGAATCCGTTAGTGAAGT	NC003197	504	Skyberg et al. (2006)
spaN	Entry into nonphagocytic cells, killing of macrophages	R: CAGCGCTGGGGATTACCGTTTTG	NC003197	504	Skyberg et al. (2006)
tolC	Host recognition and invasion	F: TACCCAGGCGCAAAAAGAGGCTATC	NC003197	161	Skyberg et al. (2006)
tolC	Host recognition and invasion	R: CCGCGTTATCCAGGTTGTTGC	NC003197	161	Skyberg et al. (2006)
pagC	Survival within macrophage	F: CGCCTTTTCCGTGGGGTATGC	NC003197	454	Skyberg et al. (2006)
pagC	Survival within macrophage	R: GAAGCCGTTTATTTTTGTAGAGGAGATGTT	NC003197	454	Skyberg et al. (2006)
sifA	Filamentous structure formation	F: TTTGCCGAACGCGCCCCCACACG	NC003197	449	Skyberg et al. (2006)
sifA	Filamentous structure formation	R: GTTGCCTTTTCTTGCGCTTTCCACCCATCT	NC003197	449	Skyberg et al. (2006)
sivH	Colonization of Peyer's patches	F: CAGAATGCGAATCCTTCGCAC	NC003198	763	Kingsley et al. (2003)
sivH	Colonization of Peyer's patches	R: GTATGCGAACAAGCGTAACAC	NC003198	763	Kingsley et al. (2003)
msgA	Survival within macrophage	F: GCCAGGCGCACGCGAAATCATCC	NC003197	189	Skyberg et al. (2006)
msgA	Survival within macrophage	R: GCGACCAGCCACATATCAGCCTCTTCAAAC	NC003197	189	Skyberg et al. (2006)
spiA	Survival within macrophage	F: CCAGGGGTCGTTAGTGTATTGCGTGAGATG	NC003197	550	Skyberg et al. (2006)
spiA	Survival within macrophage	R: CGCGTAACAAAGAACCCGTAGTGATGGATT	NC003197	550	Skyberg et al. (2006)
sitC	Iron acquisition	F: CAGTATATGCTCAACGCGATGTGGGTCTCC	NC003197	768	Skyberg et al. (2006)
sitC	Iron acquisition	R: CGGGGCGAAAATAAAGGCTGTGATGAAC	NC003197	768	Skyberg et al. (2006)
iroN	Iron acquisition	F: CCGCGTTATCCAGGTTGTTGC	NC003197	1205	Skyberg et al. (2006)
iroN	Iron acquisition	R: ACTGGCACGGCTCGCTGTCGCTCTAT	NC003197	1205	Skyberg et al. (2006)
cdtB	Host recognition and invasion	F: ACAACTGTCGCATCTCGCCCCGTCATT	AL627271	268	Skyberg et al. (2006)
cdtB	Host recognition and invasion	R: CAATTTGCGTGGGTTCTGTAGGTGCGAGT	AL627271	268	Skyberg et al. (2006)
sipB	Entry into nonphagocytic cells, killing of macrophages	F: GGACGCCGCCCGGGAAAAACTCTC	NC003197	875	Skyberg et al. (2006)
sipB	Entry into nonphagocytic cells, killing of macrophages	R: ACACTCCCGTCGCCGCCTTCACAA	NC003197	875	Skyberg et al. (2006)
sseL	Secreted effector protein	F: TTCCGCGACAACCGACCTTTCTAA	NC003197	169	Peterson et al. (2010)
sseL	Secreted effector protein	R: TTCTTGAACCAGACCTTGCGTTGC	NC003197	169	Peterson et al. (2010)
stn	Enterotoxin	F: TTGTGTCGCTATCACTGGCAACC	KF032246.1	617	Prager et al. (1995)
stn	Enterotoxin	R: ATTCGTAACCCGCTCTCGTCC	KF032246.1	617	Prager et al. (1995)
PT4	Phage type 4	F: GGCGATATAAGTACGACCATCATGG	—	225	Peterson et al. (2010)
PT4	Phage type 4	R: GCACGCGGCACAGTTAAAA	—	225	Peterson et al. (2010)

Forward (F) and reverse (R).

Reference for primer sequence.

PT4, phage type 4.

Table 3.

Polymerase Chain Reaction Assay Conditions Used in This Study to Detect the 27 Virulence-Associated Genes and Phage Type 4 Gene in Salmonella Enteritidis SE86

PCR protocol	Reaction mixture	Cycling conditions	No. of cycles	Reference ^a
lpfA sefA	2.5 μL dNTPs (2.5 mM), 1 μL of each primer (20 pmol), 2 U Taq polimerase, 2 μL MgCl₂ (4 mM), 5 μL DNA	94°C, 1 s	35	This study.
		56°C, 1 s
		74°C, 21 s
agfA	2 μL dNTPs (2.5 mM), 1 μL of each primer (20 pmol), 1 U Taq polimerase, 1.25 μL MgCl₂ (2.5 mM), 2 μL DNA	94°C, 1 s	35	Borges et al. (2013)
		55°C, 1 s
		74°C, 21 s
invA	2 μL dNTPs (2.5 mM), 1 μL cada primer (20 pmol), 1 U Taq polimerase, 1.25 μL MgCl₂ (2.5 mM), 2 μL DNA	94°C, 1 s	35	Borges et al. (2013)
		55°C, 1 s
		74°C, 1 s
avrA hilA	2 μL dNTPs (2.5 mM), 1 μL of each primer (20 pmol), 1 U Taq polimerase, 1 μL MgCl₂ (2 mM), 3 μL DNA	94°C, 1 min 30 s	30	This study.
		63°C, 1 min
		72°C, 1 min
sopE	2 μL dNTPs (2.5 mM), 1 μL of each primer (20 pmol), 1 U Taq polimerase, 1 μL MgCl₂ (2 mM), 2 μL DNA	94°C, 1 min	30	Borges et al. (2013)
		55°C, 1 min
		72°C, 1 min
sivH	2 μL dNTPs (2.5 mM), 1 μL of each primer (20 pmol), 1 U Taq polimerase, 1 μL MgCl₂ (2 mM), 2 μL DNA	94°C, 30 s	30	Borges et al. (2013)
		56°C, 45 s
		72°C, 45 s
spvC	3 μL dNTPs (2.5 mM), 3.5 μL of each primer (20 pmol), 1 U Taq polimerase, 1 μL MgCl₂ (2 mM), 2 μL DNA	93°C, 1 min	30	Borges et al. (2013)
		42°C, 1 min
		72°C, 2 min
sseL	2 μL dNTPs (2.5 mM), 1 μL of each primer (20 pmol), 1.25 μL MgCl₂ (2.5 mM), 1 U Taq polimerase, 2 μL DNA	94°C, 30 s	35	Peterson et al. (2010)
		62°C, 15 s
		58°C, 15 s
		72°C, 1 min
iron	0.5 μL dNTPs (10 mM), 0.05 μL cada primer (100 pmol), 3 μL MgCl₂ (6 mM), 0,75 U Taq polimerase, 2.5 μL DNA	94°C, 30 s	25	Skyberg et al. (2006) (with modifications)
		66.5°C, 30 s
		72°C, 2 min
msgA	0.5 μL dNTPs (10 mM), 0.05 μL of each primer (100 pmol), 3 μL MgCl₂ (6 mM), 0.75 U Taq polimerase, 2.5 μL DNA	94°C, 30 s 66.5°C, 30 s 72°C, 2 min	25	Skyberg et al. (2006)
cdtB
pagC
spiA
spvB
sitC	0.5 μL dNTPs (10 mM), 0.05 μL of each primer (100 pmol), 3 μL MgCl₂ (6 mM), 0.75 U Taq polimerase, 2.5 μL DNA	94°C, 30 s 66.5°C, 30 s 72°C, 2 min	25	Skyberg et al. (2006)
lpfC
sifA
sopB
pefA
sipB	0.5 μL dNTPs (10 mM), 0.05 μL of each primer (100 pmol), 3 μL MgCl₂ (6 mM), 0.75 U Taq polimerase, 2.5 μL DNA	94°C, 30 s 66.5°C, 30 s 72°C, 2 min	25	Skyberg et al. (2006)
prgH
span
orgA
tolC
stn	2 μL dNTPs (2.5 mM), 1 μL of each primer (20 pmol), 1.25 μL MgCl₂ (2.5 mM), 1 U Taq polimerase, 2.5 μL DNA	94°C, 1 min	25	Barman et al. (2013) (with modifications)
		59°C, 1 min
		72°C, 1 min
PT4	2 μL dNTPs (2.5 mM), 1 μL of each primer (20 pmol), 3 μL MgCl₂ (2 Mm), 1 U Taq DNA polymerase, 2 μL DNA	94°C, 30 s	30	Peterson et al. (2010)
		62°C, 15 s
		58°C, 15 s
		72°C, 1 min

Reference for the reaction mixtures and cycling conditions.

PCR, polymerase chain reaction.

Determination of PT4 by PCR

Primers for PCR phage typing were specific for the amplification of a specific and conserved nucleotide sequence of PT4 by PCR and their sequences are summarized in Table 2. The cycling conditions and reaction mixtures (25 μL) are described in Table 3. PCR was performed as previously described. The positive control was a strain of Salmonella Enteritidis from our laboratory stock collection that was previously identified using a phage typing scheme standard as a PT4 strain.

Statistical analysis

The obtained data were subjected to statistical analysis using the PASW statistic software (IBM, Hong Kong). Descriptive statistics were used to determine the groupings of the samples according to biofilm formation, antimicrobial resistance, presence of virulence genes, and PT4. Student's t-test was performed to analyze biofilm production between origin sources and to determine the relationship between biofilm production, antimicrobial resistance, and the presence of virulence genes. The nonparametric chi-square (χ²) and Fisher's exact tests were used to compare antimicrobial resistance and the presence of virulence genes based on the isolate origins. The McNemar test was used to compare the frequencies of genes associated with virulence within groups separated by function. Significance was defined as p < 0.05.

Results

Antimicrobial susceptibility test

The antimicrobial susceptibility test results are pre-sented in Figure 1. Of the 148 analyzed strains, only 25 (16.9%) were susceptible to all antimicrobials tested, regardless of the isolation source. CIP and SOX presented a significantly higher number of nonsusceptible strains (p < 0.05). A total of 14 (9.5%) strains were classified as multidrug-resistant Salmonella Enteritidis. Most of these strains (10/14) were isolated from avian sources, although the difference between isolation sources was not significant (p > 0.05).

FIG. 1.

Antimicrobial susceptibility (%) of Salmonella Enteritidis SE86 to 10 antimicrobial agents. AMX, amoxicillin; TIO, ceftiofur; CIP, ciprofloxacin; CHL, chloramphenicol; ENR, enrofloxacin; GEN, gentamicin; SPT, spectinomycin; SOX, sulfafurazole; SXT, sulfamethoxazole with trimethoprim; TCY, tetracycline.

The antimicrobial resistance to the tested antimicrobials according to the isolation source is presented in Table 4.

Table 4.

Antimicrobial Resistance (%) of Salmonella Enteritidis SE86 According to Source of Isolation

		Antimicrobial resistance (%)
Source of isolations	Total No. of samples	AMX	TIO	CIP	CHL	ENR	GEN	SPT	SOX	SXT	TCY
Avian sources	68	0	6 (8.8)	26 (38.2)	1 (1.5)	16 (23.5)	8 (11.8)	0	63 (92.6)	1 (1.5)	0
Food products involved in salmonellosis outbreaks	80	0	0	36 (45)	0	10 (12.5)	2 (2.5)	1 (1.3)	48 (60)	1 (1.3)	4 (5)

Bold data indicate a positive association (p < 0.05) between antimicrobial and source of isolation.

AMX, amoxicillin; TIO, ceftiofur; CIP, ciprofloxacin; CHL, chloramphenicol; ENR, enrofloxacin; GEN, gentamicin; SPT, spectinomycin; SOX, sulfafurazole; SXT, sulfamethoxazole with trimethoprim; TCY, tetracycline.

Biofilm formation assay

Of the 148 analyzed strains, 136 (91.9%) produced biofilms at a minimum of one of the tested temperatures, although to various extents (Fig. 2). A total of 107 (72.3%) strains produced biofilms at 37°C, 98 (66.2%) at 28°C, 87 (58.8%) at 12°C, and 52 (35.1%) at 3°C independent of the isolation source.

FIG. 2.

Classification of Salmonella Enteritidis SE86 according to biofilm production at 37°C, 28°C, 12°C, and 3°C (%).

The results obtained for the strains with different isolation sources according to the incubation temperature are shown in Table 5. Strains from both origins produced more biofilms at 37°C. A total of 77 of the 80 strains isolated from salmonellosis outbreaks (96.3%) produced biofilms, whereas 59 (86.8%) of the strains isolated from avian sources produced these structures at a minimum of one of the tested temperatures. However, biofilm production was independent of the isolation sources of the analyzed samples (p > 0.05) for all temperatures.

Table 5.

Biofilm Production (%) of Salmonella Enteritidis SE86 According to Source of Isolation at 37°C, 28°C, 12°C, and 3°C

			Biofilm production
Source of isolation	Total No. of samples	Temperature (°C)	NP (%)	WP (%)	MP (%)	SP (%)	Total No. of producers (%)
Avian sources	68	37	20 (29.4)	22 (32.4)	17 (25)	9 (13.2)	48 (70.6)
		28	22 (32.4)	23 (33.7)	22 (32.4)	1 (1.5)	46 (67.6)
		12	27 (39.7)	40 (58.8)	1 (1.5)	0	41 (60.3)
		3	44 (64.8)	23 (33.7)	1 (1.5)	0	24 (35.3)
Food products involved in salmonellosis outbreaks	80	37	21 (26.3)	43 (53.8)	14 (17.5)	2 (2.4)	59 (76.7)
		28	28 (35)	44 (55)	8 (10)	0	52 (65)
		12	34 (42.5)	39 (48.8)	6 (7.5)	1 (1.2)	46 (57.5)
		3	52 (65)	27 (33.8)	1 (1.2)	0	28 (35)

NP, no biofilm producer; WP, weak biofilm producer; MP, moderate biofilm producer; SP, strong biofilm producer.

Detection of virulence-associated genes

The frequencies for the 27 genes according to the isolation source are described in Table 6. Most of the investigated genes presented a high frequency and a regular distribution regardless of the origin.

Table 6.

Distribution (%) of 27 Virulence-Associated Genes of Salmonella Enteritidis SE86 Detected by Polymerase Chain Reaction According to Source of Isolation

		Total of positive strains (%)
Gene function	Gene	Poultry (n = 68)	Food products involved in salmonellosis outbreaks (n = 80)
Fimbriae
	sefA	68 (100)	80 (100)
	lpfA	68 (100)	80 (100)
	lpfC	68 (100)	74 (92.5)
	agfA	68 (100)	75 (93.8)
	pefA	61 (89.7)	76 (95)
TTSS
Structure	invA	68 (100)	80 (100)
	prgH	68 (100)	63 (78.8)
	orgA	68 (100)	79 (98.8)
	sipB	68 (100)	63 (78.8)
	spaN	68 (100)	63 (78.8)
Effector proteins	sopB	68 (100)	77 (96.3)
	sopE	67 (98.5)	80 (100)
	sivH	68 (100)	77 (96.3)
	avrA	68 (100)	80 (100)
	sifA	67 (98.5)	76 (95)
Regulator protein	hilA	68 (100)	80 (100)
Cellular recognition and survivor
Macrophages	spiA	68 (100)	65 (81.3)
	pagC	68 (100)	65 (81.3)
	msgA	68 (100)	80 (100)
Other cells	tolC	68 (100)	80 (100)
Other cells	sseL	68 (100)	80 (100)
Iron metabolism
	iroN	38 (55.9)	68 (85)
	sitC	68 (100)	68 (85)
Plasmid	spvB	64 (91.4)	58 (72.5)
Plasmid	spvC	62 (91.2)	78 (97.5)
Toxins	cdtB	0 (0)	0 (0)
Toxins	stn	61 (89.7)	74 (92.5)

Bold data indicate significant association (p < 0.05) between gene and source of isolation.

TTSS, type three secretion system.

Determination of PT4 by PCR

Although all Salmonella Enteritidis SE86 strains belong to a unique clonal group, only 142 (95.9%) of the strains were classified as PT4 by PCR. Two strains isolated from food products involved in salmonellosis outbreaks and four strains from poultry sources belonged to PTs other than PT4.

Discussion

High resistance rates to sulfonamides and tetracycline are common in farm animals and humans and are possibly related to the extensive use of these agents (WHO, 2011a, 2011b; EFSA and ECDC, 2015; Ziech et al., 2016; Voss-Rech et al., 2017). In Brazil, the therapeutic use of these substances for veterinary use is not controlled. However, these drugs are banned for use as a feed additive (Brasil, 2009).

A total of 38.5% of the strains were resistant to ENR and CIP simultaneously. Fluoroquinolones are the main antimicrobial agent class for the treatment of salmonellosis in humans (WHO, 2011a; EFSA and ECDC, 2015). Although ENR is used only in animals, microorganisms that are not susceptible to this drug can become resistant to other structurally related substances, such as CIP (Goncagül et al., 2004; Marshall and Levy, 2011; WHO, 2011a, 2011b). In Australia and Finland, where their use has never been allowed in animal production, the rate of CIP-resistant bacteria in humans is very low, particularly compared with the rates in countries where their use is allowed or has been allowed for several years, such as the United States (Collignon, 2005; Cheng et al., 2012).

Because the use of fluoroquinolones is not recommended for children due to their potential adverse effects (EFSA and ECDC, 2015), third-generation cephalosporins are the first choice for the treatment of salmonellosis in these patients (WHO, 2011a; EFSA and ECDC, 2015). Strains that are resistant to TIO may present cross-resistance to ceftriaxone, which is widely used in humans. In this study, only six (4.1%) strains were nonsusceptible to TIO, all of which were isolated from avian sources.

According to the WHO, antimicrobial resistance in humans and animals is the major challenge in public health in the 21st century (WHO, 2011a), and the relationship between resistant bacteria in humans and the use of antibiotics in food animals has been continuously studied. In our study, only 4 (5.9%) strains isolated from poultry were susceptible to all antimicrobial agents, whereas 21 (14.2%) of the strains isolated from outbreaks did not present resistance to any antibiotics. Nineteen antimicrobial resistance profiles were obtained, but only five were common among poultry and outbreak strains: (1) SOX; (2) SOX, CIP; (3) SOX, CIP, ENR; (4) SOX, SXT; and (5) SOX, CIP, ENR, GEN. Profiles (1), (2), and (3) were the most common for both origins. Some authors also found greater resistance in poultry strains than in strains isolated from humans (Oliveira et al., 2005; Cailhol et al., 2006; Vaz et al., 2010). According to Foley and Lynne (2008), strains isolated from different species of farm animals usually present higher resistance than human strains. However, other studies have found different results and demonstrated a higher antimicrobial resistance among human strains (Al-Dawodi et al., 2012; Elgroud et al., 2015).

Our data indicate that resistance to TIO, gentamicin, and SOX is associated (p < 0.05) with strains of avian origin. The exclusive use of TIO in veterinary medicine and the wide use of sulfonamides in poultry production may explain this association. Gentamicin is usually used in Brazilian hatcheries for the treatment of enterobacteria, which may lead to the spread of strains resistant to this antibiotic in the field (Almeida and Palermo-Neto, 2005).

The Salmonella Enteritidis serotype has been described as the strongest biofilm producer (Schonewille et al., 2012; Puffal, 2013). The frequent involvement of Salmonella Enteritidis in salmonellosis outbreaks may be a consequence of the strong capacity of some strains to produce biofilms (Ivana et al., 2015). Salmonella Enteritidis SE86 was previously shown to have higher adhesion capabilities on several surfaces, including different types of stainless steel (AISI 304 or 316), polyethylene, and metal inert gas and tungsten inert gas melts (Casarin et al., 2014, 2016; Tondo et al., 2015). SE86 also demonstrated acid adaptation after sublethal pH exposure and became more resistant to both acid and thermal exposure (Malheiros et al., 2009; Tondo et al., 2015).

Previous studies demonstrated a strong influence of temperature on biofilm production, particularly for some serotypes, including Salmonella Enteritidis (Borges et al., in press). However, in this study, only the avian strains presented a significant difference (p < 0.05) between the four analyzed temperatures. For the outbreak strains, no significant difference (p > 0.05) in biofilm production was found between the different temperatures.

Biofilm production was independent of the sources of isolation at any temperature. However, other authors found significant differences in biofilm production by several microorganisms, including Salmonella, according to the origin of isolation (Trappetti et al., 2013; Almohamad et al., 2014; Doijad et al., 2015; Piras et al., 2015; Lamas et al., 2016).

Our biofilm formation assay demonstrated that strains within the same clonal group isolated from different sources showed variation in biofilm production behavior. These data reinforce the importance of studying these complex structures to better understand the influence of the genetic apparatus involved in the mechanisms underlying biofilm formation.

The frequencies of the screened virulence-associated genes were similar to previous reports (Elemfareji and Thong, 2013; Mezal et al., 2013, 2014; Abdallah et al., 2014; Krawiec et al., 2015). spvB, spiA, pagC, sipB, prgH, spaN, sitC, and lpfC genes were positively associated (p < 0.05) with the avian strains, whereas iroN showed a positive association (p < 0.05) with the strains isolated from salmonellosis outbreaks. However, previous studies did not find a link between the isolation source of a strain and its virulence gene repertoire (Oliveira et al., 2003; Salisbury et al., 2011; Mezal et al., 2013).

Regardless of the isolation source, the comparisons of genes within functional groups showed significant differences (p < 0.05) in the structural proteins of the type three secretion system and iron metabolism genes. orgA gene was the most frequent, possibly because this gene is essential for cellular invasion by Salmonella (Klein et al., 2000). Similarly, sitC presented a higher frequency than iroN. The absence of these genes is unlikely to hinder the survival and multiplication of Salmonella strains due to the presence of several alternative mechanisms (Janakiraman and Slauch, 2000).

Since the introduction of the PT4 in Brazil in 1993, several studies have shown that this PT remains the most identified type in southern Brazil (Ribeiro et al., 2007; Vaz et al., 2010). Our results are similar to the results of previous studies and official data (Pang et al., 2007; Ribeiro et al., 2007; Brasil, 2008, 2012; Kalender et al., 2009; Vaz et al., 2010). According to Mare et al. (2001), strains with high genetic relatedness can be classified as different PTs because they are not always genetically related. However, there are reports of PT conversion after the acquisition or the loss of plasmids (Brown et al., 1999). It has been described that PT4 can be converted to PT7, PT8, or PT24 after plasmid acquisition or mutations (Rankin and Platt, 1995; Brown et al., 1999). This could explain that not all SE86 strains were classified as PT4 in our study.

Finally, we did not confirm the previously described association between biofilm production and resistance to antimicrobials (Wang et al., 2013; Ghasemmahdi et al., 2015; Piras et al., 2015). However, we observed that 92.9% (13/14) of the multidrug-resistant strains were able to produce biofilms. No relationship was found between antimicrobial resistance, biofilm production, and the presence of virulence-associated genes.

Conclusions

Our results indicated that poultry strains presented higher resistance and a greater number of multidrug-resistant strains than strains isolated from food involved in salmonellosis outbreaks. Biofilm production was independent of the isolation source at any temperature. Most of the investigated genes presented a high frequency and a regular distribution regardless of the origin. The majority of the strains were classified as PT4. No relationship was found among biofilm production, antimicrobial resistance, and virulence profile.

Footnotes

Acknowledgment

This work was supported by the Brazilian National Council of Technological and Scientific Development—CNPq [Grant No. 476092/2013-2].

Disclosure Statement

No competing financial interests exist.

References

Abdallah

, Lagha

, Said

, Kallel

, Gharbi

. Detection of cell surface hydrophobicity, biofilm and fimbirae genes in Salmonella isolated from Tunisian clinical and poultry meat. Iran J Public Health, 2014; 43:423–431.

Al-Dawodi

, Farraj

, Essaw

. Antimicrobial resistance in non-typhi Salmonella enterica isolated from humans and poultry in Palestine. J Infect Dev Ctries, 2012; 6:132–136.

Almeida

, Palermo-Neto

. Uso de antimicrobianos em avicultura e o desenvolvimento de resistência bacteriana. In: Farmacologia Aplicada à Avicultura. Spinosa

HDS

, Neto

, Górniak

, eds. São Paulo, Brasil: Roca, 2005, pp. 161–173.

Almohamad

, Somarajan

, Singh

, Nallapareddy

, Murray

. Influence of isolate origin and presence of various genes on biofilm formation by Enterococcus faecium . FEMS Microbiol Lett, 2014; 353:151–156.

Barman

, Saikia

, Bhattacharyya

, Roychoudhury

. Detection of virulence genes of Salmonella by polymerase chain reaction. Indian J Anim Sci, 2013; 83:477–480.

Bäumler

, Heffron

. Identification and sequence analysis of lpfABCDE, a putative fimbrial operon of Salmonella typhimurium . J Bacteriol, 1995; 177:2087–2097.

Borges

, Furian

, Borsoi

, Moraes

HLS

, Salle

CTP

, Nascimento

. Detection of virulence-associated genes in Salmonella Enteritidis isolates from chicken in South of Brazil. Pesqui Vet Bras, 2013; 33:1416–1422.

Borges

, Furian

, Souza

, Menezes

, Tondo

, Salle

CTP

, Moraes

HLS

, Nascimento

. Biofilm formation capacity of Salmonella serotypes at different temperature conditions. Pesqui Vet Bras (in press).

Borges

, Furian

, Souza

, Tondo

, Streck

, Salle

CTP

, Moraes

HLS

, Nascimento

. Spread of a major clone of Salmonella enterica serotype enteritidis in poultry and in salmonellosis outbreaks in Southern Brazil. J Food Prot, 2017; 80:158–163.

10.

Brasil. Agência Nacional de Vigilância Sanitária. Programa Nacional de Monitoramento da Prevalência e da Resistência Bacteriana em Frangos: Relatório do Monitoramento da Prevalência e do Perfil de Suscetibilidade aos Antimicrobianos em Enterococos e Salmonelas Isolados de Carcaças de Frangos Congeladas Comercializadas no Brasil. Brasília, DF, 2008.

11.

Brasil. Agência Nacional de Vigilância Sanitária. Programa Nacional de Monitoramento da Prevalência e da Resistência Bacteriana em Frangos. Monitoramento da Prevalência e do Perfil de Suscetibilidade aos Antimicrobianos em Enterococos e Salmonelas Isolados de Carcaças de Frangos Congeladas Comercializadas no Brasil. Brasília, DF, 2012.

12.

Brasil. Ministério da Agricultura, Pecuária e Abastecimento. Portaria n° 210. Regulamento Técnico da Inspeção Tecnológica e Higiênico-Sanitária de carne de Aves. Brasília, DF: Diário Oficial da União, Poder Executivo, 1998.

13.

Brasil. Ministério da Agricultura, Pecuária e Abastecimento. Instrução Normativa n° 26. Regulamento Técnico para a Fabricação, o Controle de Qualidade, a Comercialização e o Emprego de Produtos Antimicrobianos de Uso Veterinário. Brasília, DF: Diário Oficial da União, Poder Executivo, 2009.

14.

Brasil. Ministério da Saúde. Doenças transmitidas por alimentos-2015. 2015. Available at: http://u.saude.gov.br/images/pdf/2015/novembro/09/Apresenta----o-dados-gerais-DTA-2015.pdf, accessed November 5, 2015 .

15.

Brown

, Baggesen

, Platt

, Olsen

. Phage type conversion in Salmonella enterica serotype Enteritidis caused by the introduction of a resistance plasmid of incompatibility group X (IncX). Epidemiol Infect, 1999; 122:19–22.

16.

Cailhol

, Lailler

, Bouvet

, La Vieille

, Gauchard

, Sanders

, Brisabois

. Trends in antimicrobial resistance phenotypes in non-typhoid Salmonellae from human and poultry origins in France. Epidemiol Infect, 2006; 134:171–178.

17.

Casarin

, Brandelli

, Casarin

, Soave

, Wanke

, Tondo

. Adhesion of Salmonella Enteritidis and Listeria monocytogenes on stainless steel welds. Int J Food Microbiol, 2014; 191:103–108.

18.

Casarin

, Casarin

FDO

, Brandelli

, Novello

, Ferreira

, Tondo

. Influence of free energy on the attachment of Salmonella Enteritidis and Listeria monocytogenes on stainless steels AISI 304 and AISI 316. LWT Food Sci Technol, 2016; 69:131–138.

19.

Center for Disease Control (CDC). Making food safer to eat: Reducing contamination from the farm to the table. 2011. Available at: www.cdc.gov/vitalsigns/foodsafety/, accessed December 5, 2015 .

20.

Center for Disease Control (CDC). Trends in foodborne illness in the United States. 2013. Available at: www.cdc.gov/foodborneburden/trends-in-foodborne-illness.html, accessed November 6, 2016 .

21.

Cheng

, Turnidge

, Collignon

, Looke

, Barton

, Gottlieb

. Control of fluoroquinolone resistance through successful regulation, Australia. Emerg Infect Dis, 2012; 18:1453–1460.

22.

[CLSI] Clinical and Laboratorial Standards Institute. Performance Standards For Antimicrobial Susceptibility Tests for Bacteria Isolated from Animals. Wayne, PA: CLSI, VET01-A4, 2014a.

23.

[CLSI] Clinical and Laboratorial Standards Institute. Performance Standards for Antimicrobial Susceptibility Tests for Bacteria Isolated from Animals-Second Information Supplement. Wayne, PA: CLSI, VET01-S2, 2014b.

24.

[CLSI] Clinical and Laboratorial Standards Institute. Performance Standards for Antimicrobial Susceptibility Tests—Twenty-Sixth Information Supplement. Wayne, PA: CLSI, M100-S126, 2016.

25.

Collignon

. Fluoroquinolone use in food animals. Emerg Infect Dis, 2005; 11:1789–1792.

26.

Costerton

, Lewandowski

, Caldwell

, Korber

, Lappin-Scott

. Microbial biofilms. Annu Rev Microbiol, 1995; 49:711–745.

27.

da Silva

DLD

, Celidonio

FDA

, Oliveira

KMPD

. Verificação da temperatura de refrigeradores domésticos para minimizar a deterioração e possíveis doenças veiculadas por alimentos. Higiene Alimentar, 2008; 22:42–45.

28.

Doijad

, Barbuddhe

, Garg

, Poharkar

, Kalorey

, Kurkure

, Rawool

, Chakraborty

. Biofilm-forming abilities of Listeria monocytogenes serotypes isolated from different sources. PLoS One, 2015; 10:e0137046.

29.

Doran

, Collinson

, Burian

, Sarlos

, Todd

, Munro

, Kay

, Banser

, Peterkin

, Kay

. DNA-based diagnostic tests for Salmonella species targeting agfA, the structural gene for thin, aggregative fimbriae. J Clin Microbiol, 1993; 31:2263–2273.

30.

Elemfareji

, Thong

. Comparative virulotyping of Salmonella Typhi and Salmonella Enteritidis. Indian J Microbiol, 2013; 53:410–417.

31.

Elgroud

, Granier

, Marault

, Kerouanton

, Lezzar

, Bouzitouna-Bentchouala

, Brisabois

, Millemann

. Contribution of avian Salmonella enterica isolates to human salmonellosis cases in Constantine (Algeria). Biomed Res Int, 2015; 2015:1–8.

32.

[ECDC] European Centre for Disease Prevention and Control, [EFSA] European Food Safety Authority. European union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2012. EFSA J, 2014; 12:3547.

33.

ECDC, EFSA. European union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2013. EFSA J, 2015; 13:3991.

34.

EFSA, ECDC. EU summary report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2013. EFSA J, 2015; 13:4036.

35.

Foley

, Lynne

. Food animal-associated Salmonella challenges: Pathogenicity and antimicrobial resistance. J Anim Sci, 2008; 86:E173–E187.

36.

Gast

. Salmonella infections-paratyphoid infections. In: Disease of Poultry. Saif

, ed. Ames: Blackwell Publishing, 2008, pp. 636–665.

37.

Geimba

. Caracterização fenotípica e genotípica de linhagens de Salmonella spp. envolvidas em surtos alimentares ocorridos no Rio Grande do Sul nos anos de 1999 a 2000. PhD Dissertation. Porto Alegre, Brasil: Instituto de Ciência e Tecnologia em Alimentos, UFRGS, 2005, p. 114.

38.

Ghasemmahdi

, Tajik

, Moradi

, Mardani

, Modaresi

, Badali

, Dilmaghani

. Antibiotic resistance pattern and biofilm formation ability of clinically isolates of Salmonella enterica serotype Typhimurium. Int J Enteric Pathog, 2015; 3:e27372.

39.

Goncagül

, Günaydin

, Çarli

. Antibiotic resistance of Salmonella Enteritidis of human and chicken origin. Turk J Vet Anim Sci, 2004; 28:911–914.

40.

Groisman

, Ochman

. Pathogenicity islands: Bacterial evolution in quantum leaps. Cell, 1996; 87:791–794.

41.

Guo

, Chen

, Beuchat

, Brackett

. PCR detection of Salmonella enterica serotype Montevideo in and on raw tomatoes using primers derived from hilA . Appl Environ Microbiol, 2000; 66:5248–5252.

42.

Hung

, Henderson

. Emerging concepts of biofilms in infectious diseases. Mol Med, 2009; 106:292–296.

43.

Ivana

, Marija

, Jovanka

, Bojana

, Nevena

, Dubravka

, Ljiljana

. Biofilm forming ability of Salmonella Enteritidis in vitro . Acta Vet, 2015; 65:371–389.

44.

Janakiraman

, Slauch

. The putative iron transport system SitABCD encoded on SPI1 is required for full virulence of Salmonella Typhimurium. Mol Microbiol, 2000; 35:1146–1155.

45.

Kalender

, Sen

, Hasman

, Hendriksen

, Aarestrup

. Antimicrobial susceptibilities, phage types, and molecular characterization of Salmonella enterica serovar Enteritidis from chickens and chicken meat in Turkey. Foodborne Pathog Dis, 2009; 6:265–271.

46.

Kingsley

, Humphries

, Weening

, De Zoete

, Winter

, Papaconstantinopoulou

, Dougan

, Baumler

. Molecular and phenotypic analysis of the CS54 island of Salmonella enterica serotype Typhimurium: Identification of intestinal colonization and persistence determinants. Infect Immun, 2003; 71:629–640.

47.

Klein

, Fahlen

, Jones

. Transcriptional organization and function of invasion genes within Salmonella enterica serovar typhimurium pathogenicity island 1, including the prgH, prgI, prgJ, prgK, orgA, orgB, and orgC genes. Infect Immun, 2000; 68:3368–3376.

48.

Krawiec

, Kuczkowski

, Kruszewicz

, Wieliczko

. Prevalence and genetic characteristics of Salmonella in free-living birds in Poland. BMC Vet Res, 2015; 11:15.

49.

Lamas

, Miranda

, Vazquez

, Cepeda

, Franco

. Biofilm formation, phenotypic production of cellulose and gene expression in Salmonella enterica decrease under anaerobic conditions. Int J Food Microbiol, 2016; 238:63–67.

50.

Malheiros

, Brandelli

, Noreña

CPZ

, Tondo

. Acid and thermal resistance of a Salmonella Enteritidis strain involved in several foodborne outbreaks. J Food Saf, 2009; 29:302–317.

51.

Mare

, Dick

, van der Walt

. Characterization of south african isolates of Salmonella Enteritidis by phage typing, numerical analysis of RAPD-PCR banding patterns and plasmid profiles. Int J Food Microbiol, 2001; 64:237–245.

52.

Marshall

, Levy

. Food animals and antimicrobials: Impacts on human health. Clin Microbiol Rev, 2011; 24:718–733.

53.

Mezal

, Bae

, Khan

. Detection and functionality of the CdtB, PltA, and PltB from Salmonella enterica serovar Javiana. Pathog Dis, 2014; 72:95–103.

54.

Mezal

, Stefanova

, Khan

. Isolation and molecular characterization of Salmonella enterica serovar Javiana from food, environmental and clinical samples. Int J Food Microbiol, 2013; 164:113–118.

55.

Nunes

, Helmuth

, Schroeter

, Mead

, Santos

, Solari

, Silva

, Ferreira

. Phage typing of Salmonella Enteritidis from different sources in Brazil. J Food Prot, 2003; 66:324–327.

56.

Oliveira

FAD

, Geimba

, Pasqualotto

, Brandelli

, Pasquali

, da Silva

, Tondo

. Clonal relationship among Salmonella enterica serovar Enteritidis involved in foodborne outbreaks in Southern Brazil. Food Control, 2009; 20:606–610.

57.

Oliveira

FAD

, Pasqualotto

, da Silva

, Tondo

. Characterization of Salmonella enteritidis isolated from human samples. Food Res Int, 2012; 45:1000–1003.

58.

Oliveira

, Santos

, Schuch

, Silva

, Salle

, Canal

. Detection and identification of Salmonellas from poultry-related samples by PCR. Vet Microbiol, 2002; 87:25–35.

59.

Oliveira

SDD

, Flores

, dos Santos

, Brandelli

. Antimicrobial resistance in Salmonella Enteritidis strains isolated from broiler carcasses, food, human and poultry-related samples. Int J Food Microbiol, 2005; 97:297–305.

60.

Oliveira

SDD

, Rodenbusch

, Michael

, Cardoso

MIR

, Canal

, Brandelli

. Detection of virulence genes in Salmonella Enteritidis isolated from different sources. Braz J Microbiol, 2003; 34:123–124.

61.

Pang

, Chiu

, Helmuth

, Schroeter

, Guerra

, Tsen

. A pulsed field gel electrophoresis (PFGE) study that suggests a major world-wide clone of Salmonella enterica serovar Enteritidis. Int J Food Microbiol, 2007; 116:305–312.

62.

Peterson

, Gerdes

, Berges

, Nagaraja

, Frye

, Boyle

, Narayanan

. Development of microarray and multiplex polymerase chain reaction assays for identification of serovars and virulence genes in Salmonella enterica of human or animal origin. J Vet Diagn Invest, 2010; 22:559–569.

63.

Piras

, Fois

, Consolati

, Mazza

, Mazzette

. Influence of temperature, source, and serotype on biofilm formation of Salmonella enterica isolates from pig slaughterhouses. J Food Prot, 2015; 78:1875–1878.

64.

Prager

, Fruth

, Tschape

. Salmonella enterotoxin (stn) gene is prevalent among strains of Salmonella enterica, but not among Salmonella bongori and other Enterobacteriaceae . FEMS Immunol Med Microbiol, 1995; 12:47–50.

65.

Prager

, Rabsch

, Streckel

, Voigt

, Tietze

, Tschape

. Molecular properties of Salmonella enterica serotype paratyphi B distinguish between its systemic and its enteric pathovars. J Clin Microbiol, 2003; 41:4270–4278.

66.

Puffal

Investigação de genes de resistência a antimicrobianos e da capacidade de formação de biofilme em isolados de Salmonella Enteritidis. M.Sc. Dissertation. Porto Alegre, Brasil: Faculdade de Biociências. PUCRS, 2013.

67.

Rankin

, Platt

. Phage conversion in Salmonella enterica serotype Enteritidis: Implications for epidemiology. Epidemiol Infect, 1995; 114:227–236.

68.

Ribeiro

, Kellermann

, Santos

LRD

, Bessa

, Nascimento

VPD

. Salmonella spp. in raw broiler parts: Occurrence, antimicrobial resistance profile and phage typing of the Salmonella Enteritidis isolates. Braz J Microbiol, 2007; 38:296–299.

69.

Robinsom

. The big five: Most common Salmonella strains in foodborne illness outbreaks. Food Saf. 2014. Available at: www.foodsafetynews.com/2013/08/the-five-most-common-salmonella-strains/#.UsbJ5dJDunI, accessed March 19, 2016 .

70.

Salisbury

, Bronowski

, Wigley

. Salmonella virchow isolates from human and avian origins in England-molecular characterization and infection of epithelial cells and poultry. J Appl Microbiol, 2011; 111:1505–1514.

71.

Schonewille

, Nesse

, Hauck

, Windhorst

, Hafez

, Vestby

. Biofilm building capacity of Salmonella enterica strains from the poultry farm environment. FEMS Immunol Med Microbiol, 2012; 65:360–365.

72.

Schwarz

, Silley

, Simjee

, Woodford

, van Duijkeren

, Johnson

, Gaastra

. Editorial: Assessing the antimicrobial susceptibility of bacteria obtained from animals. J Antimicrob Chemother, 2010; 65:601–604.

73.

Skyberg

, Logue

, Nolan

. Virulence genotyping of Salmonella spp. with multiplex PCR. Avian Dis, 2006; 50:77–81.

74.

Steenackers

, Hermans

, Vanderleyden

, De Keersmaecker

SCJ

. Salmonella biofilms: An overview on occurrence, structure, regulation and eradication. Food Res Int, 2012; 45:502–531.

75.

Stepanović

, Cirković

, Ranin

, Svabić-Vlahović

. Biofilm formation by Salmonella spp. and Listeria monocytogenes on plastic surface. Lett Appl Microbiol, 2004; 38:428–432.

76.

Swamy

, Barnhart

, Lee

, Dreesen

. Virulence determinants invA and spvC in Salmonellae isolated from poultry products, wastewater, and human sources. Appl Environ Microbiol, 1996; 62:3768–3771.

77.

Tondo

, Ritter

, Casarin

. Involvement in foodborne outbreaks, risk factors and options to control Salmonella Enteritidis SE86: An important food pathogen in Southern Brazil. In: Salmonella: Prevalence, Risk Factors and Treatment Options. Hackett

, ed. New York: Nova Science Publishers, 2015, pp. 65–77.

78.

Trappetti

, Maten

EVD

, Amin

, Potter

, Chen

, Mourik

PMV

, Lawrence

, Paton

. Site of isolation determines biofilm formation and virulence phenotypes of Streptococcus pneumoniae serotype 3 clinical isolates. Infect Immun, 2013; 81:505–513.

79.

Vaz

, Streck

, Michael

, Marks

, Rodrigues

, Dos Reis

, Cardoso

, Canal

. Antimicrobial resistance and subtyping of Salmonella enterica subspecies enterica serovar Enteritidis isolated from human outbreaks and poultry in Southern Brazil. Poult Sci, 2010; 89:1530–1536.

80.

Voss-Rech

, Potter

, Vaz

CSL

, Pereira

DIB

, Sangioni

, Vargas

ÁC

, Botton

. Antimicrobial resistance in nontyphoidal Salmonella isolated from human and poultry-related samples in Brazil: 20-year meta-analysis. Foodborne Pathog Dis, 2017; 14:116–124.

81.

Wallis

, Galyov

. Molecular basis of Salmonella-induced enteritis. Mol Microbiol, 2000; 36:997–1005.

82.

Wang

, Ye

, Wei

, Cao

, Xu

, Zhou

. Occurrence, antimicrobial resistance and biofilm formation of Salmonella isolates from a chicken slaughter plant in China. Food Control, 2013; 33:378–384.

83.

[WHO] WHO. Critically important antimicrobials for human medicine. 2011a. Available at http://apps.who.int/iris/bitstream/10665/77376/1/9789241504485_eng.pdf, accessed February 23, 2016 .

84.

WHO. Data analysis 2. 5. 2015. Available at www.who.int/drugresistance/WHOsoftware/en/, accessed May 20, 2016 .

85.

WHO. Tackling antibiotic resistance from a food safety perspective in Europe. 2011b. Available at: www.euro.who.int/__data/assets/pdf_file/0005/136454/e94889.pdf, accessed February 23, 2016 .

86.

Ziech

, Lampugnani

, Perin

, Sereno

, Sfaciotte

, Viana

, Soares

, Pinto

, Ldos

. Multidrug resistance and ESBL-producing Salmonella spp. isolated from broiler processing plants. Braz J Microbiol, 2016; 47:191–195.