Propidium Monoazide Quantitative Real-Time Polymerase Chain Reaction for Enumeration of Some Viable but Nonculturable Foodborne Bacteria in Meat and Meat Products

Abstract

Foodborne infections due to bacterial pathogens are increasing worldwide. Given the surreptitious nature of viable but nonculturable (VBNC) bacteria, they largely remain a threat to public health and food safety due to their non-detectability through conventional plate count techniques. Hence, species-specific quantitative real-time polymerase chain reaction (PCR) (qPCR) alone and combined with the use of propidium monoazide (PMA) was used along with the plate count method to quantify VBNC Staphylococcus aureus, Bacillus cereus, Clostridium perfringens, and Enterobacteriaceae in fresh and processed meat samples. The major bacterial pathogen isolated was S. aureus (93%) followed by Enterobacteriaceae (80.33%), C. perfringens (26.33%), and B. cereus (21.33%); their total viable counts were mostly recorded in raw meat than examined meat products. PMA quantitative real-time PCR (PMA qRT-PCR) could detect and quantify VBNC bacteria in 90.48% of culture-negative samples. It affirmed the presence of VBNC S. aureus (n = 10), B. cereus (n = 8), C. perfringens (n = 6), and Enterobacteriaceae (n = 12) in either single or mixed bacterial contamination. The log₁₀ mean values of VBNC bacterial counts were highly reported for C. perfringens and S. aureus (9.60 ± 0.449 and 8.27 ± 0.453 CFU/g, respectively) followed by Enterobacteriaceae (6.95 ± 0.564 CFU/g) and B. cereus (6.69 ± 0.749 CFU/g). Sequencing of rpoB gene of Enterobacteriaceae enabled the identification of Klebsiella pneumoniae complex, Enterobacter cloacae complex, and Salmonella Typhi, which have been reported to be capable of entry into the VBNC state. To our knowledge, this is the first report at least in Egypt that records the presence of VBNC cells in meat samples representing a strong threat to public health and food safety. Moreover, PMA qRT-PCR allowed a quick and unequivocal way of enumeration of VBNC foodborne bacteria.

Introduction

The pathogen-contaminating population can trigger various adaptation mechanisms to enhance its capacity of persistence and survival in the hostile environment. One of the well-known adaptation responses is the acquisition of the viable but nonculturable (VBNC) state (Orruño et al., 2017). It is a unique form of dormancy adopted by many bacterial pathogens as a survival strategy in nearly any ecological niche in response to harsh environmental stresses (Ayrapetyan and Oliver, 2016). Since the first report of VBNC bacteria (Xu et al., 1982), more than 60 bacterial species including several human foodborne pathogens could enter the VBNC state.

Cells in the VBNC state typically demonstrate very low levels of metabolic activity and are easily missed while using the conventional plate counting technique despite their viability and retaining their virulent properties. However, resuscitation within the human host allows the cells to regain their cultivability, resume their metabolic activity, and renew their ability to cause infections and diseases, resulting in a serious threat to public health (Oliver, 2010; Ramamurthy et al., 2014). Large amounts of evidence have shown that VBNC pathogens may be involved in foodborne outbreaks. A large outbreak caused by Escherichia coli O104:H4 strain was recorded in Germany in 2011 involving more than 3000 cases of bloody diarrhea and hemolytic uremic syndrome. The pathogen could not be isolated from the contamination source until a small amount of the pathogens were isolated from the patients, indicating that VBNC cells of foodborne pathogenic bacteria may be ignored during most foodborne outbreaks due to their undetectability (Aurass et al., 2011; Scheutz et al., 2011).

Up to date, detection of VBNC foodborne bacteria is problematic. Therefore, culture-independent methods, based on fluorescent staining, DNA hybridization, and mRNA quantitation, are vitally important not only to detect and enumerate bacteria but also to assess their viability and possible harmfulness (Nicolò and Guglielmino, 2012). The membrane-impermeable, DNA intercalating compounds such as propidium monoazide (PMA) combined with species-specific quantitative real-time polymerase chain reaction (qRT-PCR) were successfully used for enumeration of only viable cells with intact membranes (Nocker and Camper, 2009).

Although the existence of VBNC bacteria in food is well documented (Rowan, 2004; Ordax et al., 2009; Elizaquível et al., 2013), this is the first study that reported the presence of some VBNC cells in meat and meat products. So, species-specific qRT-PCR alone and combined with PMA was used along with the plate count technique to quantify VBNC Staphylococcus aureus, Bacillus cereus, Clostridium perfringens, and Enterobacteriaceae in fresh and processed meat, which retains the potential for virulence and could recover cultivability and pathogenicity while being considered a threat to public health and food safety.

Materials and Methods

Samples

Three hundred meat samples including 120 fresh meat [minced beef (75) and chicken meat (45)] and 180 meat products [beef luncheon (40), sausage (50), beef burger (45), beef kofta (25), and corned beef (20)] were randomly collected from different supermarkets in Zagazig city, Sharkia Governorate, Egypt, from March 2015 to October 2016. The samples were transported to the laboratory in an icebox within 4 h to be investigated for the presence of the most incriminated Gram-positive and Gram-negative foodborne bacteria by using the standard microbiological techniques.

Culture-based detection and enumeration of foodborne bacteria

All samples were processed for isolation and enumeration of some foodborne bacteria as previously described (Luo et al., 2017). Briefly, 10 g of each food sample was mixed with 90 mL of buffered peptone water (Oxoid, UK) then blended for 2 min in a stomacher (Stomacher Lab-Blender 400; Seward, London, UK). Tenfold serial dilutions were prepared, and 0.1 mL of each diluted sample was inoculated onto agar plates and incubated. The total viable counts were obtained and calculated as log₁₀ colony-forming units (CFU)/g of the sample. Three independent experiments were performed for each species.

Baird Parker agar (Oxoid, UK) supplemented with an egg yolk–tellurite emulsion (Oxoid, UK) was used to count S. aureus. Identification of the isolates was realized on the base of cultural characteristics, Gram's stain, and biochemical tests (Martinon et al., 2012). The ISO 7932 standard had been followed for detection and enumeration of B. cereus in meat (Anonymous, 1993) by using B. cereus selective agar base (Oxoid, UK). Suspected colonies were confirmed by Gram's stain, catalase, and gelatin liquefaction tests.

For C. perfringens enumeration, enrichment of diluted homogenate into cooked meat medium (Difco, USA) followed by plating onto tryptose sulfite cycloserine agar (Qingdao Hope Bio-Technology Co., Ltd) supplemented with C. perfringens supplement (Cat. 6020; LABORATORIOS CONDA, S.A.) and egg yolk emulsion (Cat. 5152; LABORATORIOS CONDA, S. A.) was applied (Luo et al., 2017). The colonies showing typical characteristics were selected for morphological and biochemical identification as described in Bergey's Manual (Cato et al., 1986). Violet red bile glucose agar (Oxoid, UK) was used for isolation and enumeration of Enterobacteriaceae according to National Standard Method F23 (Health Protection Agency, 2004). For confirmation, oxidase, glucose fermentation, and IMViC tests were applied.

PMA assay and genomic DNA extraction

The PMA-qPCR assay was developed for the detection of some VBNC foodborne bacteria, namely S. aureus, B. cereus, C. perfringens, and Enterobacteriaceae. PMA (phenanthridium, 3-amino-8-azido-5-[3- (diethylmethylammonio) propyl]-6-phenyl dichloride; Biotum, Hayward) was dissolved in 20% dimethyl sulfoxide (Sigma-Aldrich, St. Louis, MO) to obtain a stock solution of 1 mg/mL and stored at −20°C in the dark. Samples were treated as previously described (Li et al., 2016). Briefly, 10 μL PMA stock solution was added to 1 mL of the sample solution in a 1.5 mL light transparent microcentrifuge tube to obtain a final concentration of 10 μg/mL. Samples were incubated at room temperature in the dark for 5 min with constant agitation. After incubation, samples were placed on ice and subsequently exposed to a 500-W halogen light source with a distance of 20 cm for 5 min with occasional shaking and then cooled to room temperature. The samples were centrifuged at 12,000 × g for 5 min and then washed three times with equal volumes of phosphate-buffered saline (pH 7.4) to dispose of the free PMA. Bacterial DNAs (with and without PMA sample treatment) were extracted by using QIAamp DNA mini kit (Qiagen, Germany) according to the manufacturer's instructions.

Real-time qPCR amplification

Twenty-one culture-negative meat samples were examined for detection of some VBNC foodborne bacteria using PMA RT-qPCR. In addition, samples of low foodborne bacteria by standard plate count were examined by species-specific qPCR alone and combined with PMA. PCR amplification reaction mixture contained 12.5 μL QuantiTect SYBR Green PCR Master Mix (Qiagen), 0.5 μL of each primer (20 pmol) (Metabion, Germany), 5 μL template DNA, and 6.5 μL nuclease-free water in a final volume of 25 μL. The RT-PCR reaction was performed in the AB7300 real-time PCR system (Applied Biosystems). Amplification curves and cycle threshold (C_t) values were determined by the Stratagene MX3005P software (Thermo Fisher Scientific, Waltham, MA). The oligonucleotide primers, cycling conditions and melting curve analysis are listed in Table 1.

Table 1.

Oligonucleotide Primers Used for qRT-PCR

Species	Target gene	Primer name	Oligonucleotide sequence (5′-3′)	PCR cycling condition	Melting curve (one cycle)	Reference
Staphylococcus aureus	16S-23S rRNA	16S-2696F	AAGGTGGGGATGACGTCAA	One cycle at 94°C for 3 min; 40 cycles of 94°C, 30 s; 60°C, 40 s; 68°C, 3 min; and a final cycle at 95°C, 3 min.	95°C, 1 min; 60°C, 1 min and 95°C, 30 s.	Soejima et al. (2012)
Staphylococcus aureus	16S-23S rRNA	23S-5238R	TTCTCTCCGAAATAGCTTTAGGGCTAG		95°C, 1 min; 60°C, 1 min and 95°C, 30 s.	Soejima et al. (2012)
Bacillus cereus	groEL	BalF	TGCAACTGTATTAGCACAAGCT	One cycle at 94°C for 2 min; 35 cycles of 94°C, 1 min; 55°C, 1 min; 72°C, 1 min; and finally 72°C for 5 min.	95°C, 1 min; 55°C, 1 min; and 95°C, 30 s.	Chang et al. (2003)
Bacillus cereus	groEL	BalR	TACCACGAAGTTTGTTCACTACT		95°C, 1 min; 55°C, 1 min; and 95°C, 30 s.	Chang et al. (2003)
Clostridium perfringens	cpa	CPAF	GTTGATAGCGCAGGACATGTTAAG	Initial denaturation at 94°C for 5 min; 30 cycles of 94°C, 1 min; 55°C, 1 min; and 72°C, 1 min.	95°C, 1 min; 55°C, 1 min; and 95°C, 30 s.	Yoo et al. (1997)
Clostridium perfringens	cpa	CPAR	CATGTAGTCATCTGTTCCAGCATC		95°C, 1 min; 55°C, 1 min; and 95°C, 30 s.	Yoo et al. (1997)
Enterobacteriaceae	rpoB	Enterobacteriaceae F	CAGGTCGTCACGGTAACAAG	Initial denaturation at 94°C for 5 min; 35 cycles of 94°C, 30 s; 60°C, 30 s; 72°C, 1 min; and an extension step at 72°C for 10 min.	95°C, 1 min; 60°C, 1 min; and 95°C, 30 s.	Fazzeli et al. (2012)
Enterobacteriaceae	rpoB	Enterobacteriaceae R	GTGGTTCAGTTTCAGCATGTAC		95°C, 1 min; 60°C, 1 min; and 95°C, 30 s.	Fazzeli et al. (2012)

qRT-PCR, quantitative real-time polymerase chain reaction.

Construction of standard curves

Standard curves were constructed by using eight 10-fold serial dilutions starting with 10¹⁰ CFU/mL of fresh overnight cultures of S. aureus ATCC^® 25923™, E. coli ATCC 25922™, B. cereus ATCC 14579™, and C. perfringens ATCC 13124™ followed by enumeration of the bacteria by the standard plate count method covering the range from 10¹⁰ to 10³ CFU/mL (Adams, 2007). One milliliter of each dilution was subjected to DNA extraction according to the manufacturer's protocol of the QIAamp DNeasy tissue Kit (Qiagen); then, the specific targets were amplified in three independent experiments. The signals produced (C_t) were plotted against the log₁₀ CFU/mL. Correlation coefficients (R ²) and the amplification efficiencies were calculated as described by Rasmussen (2011). The limit of detection (LOD), accordingly the sensitivity of PMA RT-qPCR, was verified from the 10-fold serial dilution of each prepared standard for all target organisms according to the following formula (Caraguel et al., 2011): Cq (LOD) = Cq (NTC)-3, where Cq is the quantification cycle of the last detectable standard and NTC is the negative control.

DNA sequencing

The amplified products of 12 VBNC Enterobacteriaceae were subjected to rpoB gene sequencing to confirm their identity. Purified PCR products were sequenced with the ABI PRISM 310 Genetic Analyzer by using the BigDye Terminator v3.1 Matrix Standard Kit (Applied Biosystem, Foster City, CA). DNA sequences were compared with those available in NCBI (National Center for Biotechnology Information, www.ncbi.nlm.nih.gov) databases by using Basic Local Alignment Search Tool (BLAST). Nucleotide sequence analysis was performed by MEGA5 program, product version 5.1 (www.megasoftware.net). Nucleotide sequences were deposited in the GenBank under accession numbers MF356683-MF356694.

Statistical analysis

Data were analyzed by using one-way analysis of variance (ANOVA) and Kruskal–Wallis one-way ANOVA using Statistical Package for Social Sciences (SPSS) version 23.0 (IBM Corp., Armonk, NY). The data were shown in means ± standard error, and significance was indicated at p value <0.05.

Results

Incidence and enumeration of foodborne bacteria in meat samples

Examination of raw and processed meat samples (n = 300) obtained from different supermarkets in Zagazig city, Sharkia Governorate, Egypt, indicated high contamination level (n = 279; 93%) by one or more of the foodborne pathogens. S. aureus was highly recorded in chicken meat and beef burger (95.56% each) followed by beef luncheon (95%), minced meat (93%), sausage (92%), corned beef (90%), and beef kofta (84%), with no significant differences among them. The obtained data posed a high contamination level of S. aureus in raw meat comprising minced meat (6.32 log₁₀ CFU/g) and chicken meat (5.28 log₁₀ CFU/g) followed by sausage (4.75 log₁₀ CFU/g), whereas a low level of the pathogen was detected in corned beef (2.61 log₁₀ CFU/g).

B. cereus was isolated from 64 out of 300 examined meat samples (21.33%). It was notable in beef luncheon (33.50%) followed by chicken meat (31.11%), with no significant differences among examined samples. The overall counts of B. cereus in raw meat and meat products ranged from 7.74 × 10² CFU/g (low level) to 1.20 × 10⁵ CFU/g (medium level).

The incidence of C. perfringens in inspected meat and meat products was 26.33%, with the uppermost incidence in minced meat and corned beef (40% each) followed by beef burger (31.11%) showing a reasonably high significant variation among examined meat samples. The mean count of C. perfringens ranged from 2.97 × 10¹ to 2.70 × 10⁴ CFU/g.

All examined chicken meat samples were contaminated by Enterobacteriaceae followed by minced meat (88%), with a significant difference among analyzed samples. The highest Enterobacteriaceae count was found in chicken meat (5.54 log₁₀ CFU/g) and minced meat (5.20 log₁₀ CFU/g) rather than in analyzed meat products, which showed lower levels of the bacteria (2.97–4.23 log₁₀ CFU/g). There is a significant difference in all bacterial concentrations among meat categories (p < 0.05). The incidence and the means of bacterial counts in different meat samples and their logarithmic values are depicted in Tables 2, 3 and Figure 1a, b.

FIG. 1.

The incidence of some foodborne bacterial pathogens (a) and their standard plate counts (b) in various meat types.

Table 2.

Frequency Distribution of Contaminating Bacteria in Meat and Meat Products

	Frequency distribution (%)
Meat samples (No.)	Staphylococcus aureus	Bacillus cereus	Clostridium perfringens	Enterobacteriaceae
Minced meat (75)	70 (93.33)	11 (14.67)	30 (40.00)	66 (88.00)
Chicken meat (45)	43 (95.56)	14 (31.11)	6 (13.33)	45 (100.00)
Beef luncheon (40)	38 (95.00)	13 (33.50)	8 (20.00)	29 (72.50)
Beef burger (45)	43 (95.56)	9 (20.00)	14 (31.11)	31 (68.89)
Beef kofta (25)	21 (84.00)	6 (24.00)	5 (20.00)	16 (64.00)
Corned beef (20)	18 (90.00)	3 (15.00)	8 (40.00)	14 (70.00)
Sausage (50)	46 (92.00)	8 (16.00)	8 (16.00)	40 (80.00)
Chi-square	4.61	8.97	17.63	24.59
DF	6	6	6	6
p	0.595^ns	0.175^ns	0.007^**	0.0004^***

DF, degree of freedom; ns: nonsignificant; ^**, ^***: highly significant.

Table 3.

Standard Plate Counts of Contaminating Bacteria in Meat and Meat Products

	Plate counts
	Staphylococcus aureus		Bacillus cereus		Clostridium perfringens		Enterobacteriaceae
Meat samples	Mean ± SE	Log₁₀ (mean) ± SE^**	Mean ± SE	Log₁₀ (mean) ± SE^***	Mean ± SE	Log₁₀ (mean) ± SE^***	Mean ± SE	Log₁₀ (mean) ± SE^***
Minced meat	2.08 × 10⁶ ± 2.01 × 10⁶	6.32 ± 0.892^a	7.74 × 10² ± 9.61 × 10¹	2.89 ± 0.0523^d	2.91 × 10³ ± 1.05 × 10³	3.46 ± 0.2112^b	1.58 × 10⁵ ± 1.01 × 10⁵	5.20 ± 0.268^ab
Chicken meat	1.91 × 10⁵ ± 1.65 × 10⁵	5.28 ± 0.433^a	1.20 × 10⁵ ± 7.80 × 10⁴	5.08 ± 0.287^a	8.03 × 10² ± 5.02 × 10²	2.90 ± 0.2812^bc	3.50 × 10⁵ ± 2.44 × 10⁵	5.54 ± 0.413^a
Beef luncheon	1.44 × 10³ ± 1.28 × 10³	3.16 ± 0.472^c	1.85 × 10⁴ ± 1.03 × 10⁴	4.27 ± 0.225^ab	2.97 × 10¹ ± 8.21 × 10⁰	1.47 ± 0.1122^d	9.50 × 10² ± 6.30 × 10²	2.98 ± 0.311^d
Beef burger	7.46 × 10² ± 6.29 × 10²	2.87 ± 0.496^c	1.93 × 10⁴ ± 1.71 × 10⁴	4.29 ± 0.523^bc	1.39 × 10³ ± 7.55 × 10²	3.14 ± 0.2222^bc	9.93 × 10² ± 7.55 × 10²	3.00 ± 0.358^d
Beef kofta	1.50 × 10³ ± 5.47 × 10²	3.18 ± 0.233^bc	2.73 × 10⁴ ± 1.01 × 10⁴	4.44 ± 0.216^ab	2.70 × 10⁴ ± 1.38 × 10⁴	4.43 ± 0.2732^a	1.68 × 10⁴ ± 6.50 × 10³	4.23 ± 0.209^bc
Corned beef	4.03 × 10² ± 1.22 × 10²	2.61 ± 0.156^c	1.25 × 10³ ± 5.74 × 10²	3.10 ± 0.183^cd	2.73 × 10² ± 9.39 × 10¹	2.44 ± 0.1562^c	9.40 × 10² ± 7.32 × 10²	2.97 ± 0.385^d
Sausage	5.57 × 10⁴ ± 2.99 × 10⁴	4.75 ± 0.356^ab	8.30 × 10² ± 9.71 × 10¹	2.92 ± 0.0541^d	1.67 × 10³ ± 8.97 × 10²	3.22 ± 0.2682^b	3.97 × 10³ ± 1.71 × 10³	3.60 ± 0.205^cd

Values having different superscripts within the same column are significantly different (p < 0.05).

SE, standard error; ^**, ^***: highly significant.

Quantification of VBNC foodborne bacteria by qRT-PCR

The PMA qRT-PCR was performed by using species-specific primers for quantitative measurement of the VBNC fractions in 21 presumptive meat samples. It is evident from Table 4 that 19 (90.48%) culture-negative meat samples were positive for VBNC bacteria. Microbial populations in examined samples ranged from 1.523 × 10¹⁰−4.198 × 10⁵ CFU/g for S. aureus; 8.479 × 10⁹−7.949 × 10³ CFU/g for B. cereus; 7.303 × 10¹⁰−8.484 × 10⁷ CFU/g for C. perfringens; and 1.415 × 10¹⁰−4.827 × 10⁴ CFU/g for Enterobacteriaceae.

Table 4.

Quantification of Viable but Nonculturable Bacterial Populations in Culture-Negative Meat Samples by Propidium Monoazide Real-Time Polymerase Chain Reaction

		Microbial load
		Staphylococcus aureus		Bacillus Cereus		Clostridium perfringens		Enterobacteriaceae
Sample No.	Source	CFU/g	Log₁₀	CFU/g	Log₁₀	CFU/g	Log₁₀	CFU/g	Log₁₀	Closest relative	Similarity %	Accession No.
1	Beef burger	6.219 × 10⁷	7.79	ND	—	ND	—	3.752 × 10⁹	9.57	Klebsiella pneumoniae subsp. Rhinoscleromatis	99	MF356693
2	Sausage	4.198 × 10⁵	5.62	ND	—	ND	—	7.741 × 10⁴	4.89	K. pneumoniae subsp. pneumonia	98	MF356684
3	Minced meat	1.523 × 10¹⁰	10.18	ND	—	ND	—	1.415 × 10¹⁰	10.15	K. pneumoniae subsp. rhinoscleromatis	98	MF356694
4	Beef luncheon	2.405 × 10⁷	7.38	ND	—	4.402 × 10⁸	8.64	1.689 × 10⁹	9.23	K. pneumoniae subsp. pneumonia	99	MF356683
5	Corned beef	ND	—	ND	—	1.630 × 10¹⁰	10.21	2.583 × 10⁵	5.41	K. pneumoniae subsp. Ozaenae	99	MF356692
6	Beef burger	ND	—	ND	—	ND	—	ND	—	ND	ND	ND
7	Sausage	ND	—	ND	—	ND	—	7.102 × 10⁶	6.85	S. enterica subsp. enterica serovar Typhi	98	MF356690
8	Beef luncheon	ND	—	9.885 × 10⁷	7.99	ND	—	8.142 × 10⁵	5.91	Enterobacter cloacae subsp. cloacae	99	MF356685
9	Corned beef	ND	—	3.002 × 10⁸	8.48	ND	—	1.461 × 10⁵	5.16	K. pneumoniae subsp. pneumonia	99	MF356686
10	Corned beef	ND	—	ND	—	ND	—	4.827 × 10⁴	4.68	K. pneumoniae subsp. Ozaenae	97	MF356691
11	Beef luncheon	ND	—	8.479 × 10⁹	9.93	ND	—	ND	—	ND	ND	ND
12	Sausage	ND	—	2.062 × 10⁴	4.31	ND	—	3.715 × 10⁸	8.57	K. pneumoniae subsp. pneumonia	99	MF356687
13	Beef luncheon	ND	—	1.306 × 10⁵	5.12	ND	—	7.629 × 10⁵	5.88	Enterobacter kobei	98	MF356688
14	Beef burger	ND	—	ND	—	ND	—	ND	—	ND	ND	ND
15	Minced meat	ND	—	7.949 × 10³	3.90	ND	—	1.167 × 10⁷	7.07	K. pneumoniae subsp. pneumonia	100	MF356689
16	Chicken meat	2.409 × 10⁹	9.38	ND	—	8.484 × 10⁷	7.93	ND	—	ND	ND	ND
17	Chicken meat	2.352 × 10⁹	9.37	8.246 × 10⁶	6.92	ND		ND	—	ND	ND	ND
18	Minced meat	5.482 × 10⁹	9.74	8.032 × 10⁶	6.90	6.593 × 10⁹	9.82	ND	—	ND	ND	ND
19	Chicken meat	3.145 × 10⁸	8.50	ND	—	7.303 × 10¹⁰	10.86	ND	—	ND	ND	ND
20	Minced meat	7.864 × 10⁶	6.90	ND	—	ND		ND	—	ND	ND	ND
21	Beef burger	6.219 × 10⁷	7.79	ND	—	1.432 × 10¹⁰	10.16	ND	—	ND	ND	ND
Mean ± SE	—	2.594 × 10⁹ ± 1.513 × 10⁹	8.27 ± 0.453	1.111 × 10⁹ ± 1.053 × 10⁹	6.69 ± 0.749	1.846 × 10¹⁰ ± 1.126 × 10¹⁰	9.60 ± 0.449	1.665 × 10⁹ ± 1.180 × 10⁹	6.95 ± 0.564	—	—	—

C_t, threshold cycle; CFU, colony-forming unit; ND, not detectable; SE, standard error.

Of all the culture-negative meat samples analyzed (n = 21), 12 (57.14%) were positive for VBNC Enterobacteriaceae, 10 (47.62%) were contaminated by VBNC S. aureus, 8 (38.10%) were found to carry VBNC B. cereus, and 6 (28.57%) had VBNC C. perfringens. Overall, four meat samples of different types were associated with a single bacterium, 15 harbored mixed bacterial contamination, and two beef burger samples were negative.

Samples of low foodborne bacteria by culture were examined by qPCR alone and combined with PMA. The results confirmed the presence of viable and culturable, VBNC and dead cells in them. Further, bacteria plate counts were much lower (p < 0.001) than with the PMA qRT-PCR method, suggesting the accumulation of stressed or dead microorganisms that were unable to form colonies (Table 5 and Fig 2).

FIG. 2.

Recovery of foodborne bacteria from meat samples by plate count, qPCR, and PMA qPCR. p-Value represents a highly significant difference in the recovery rate of VBNC bacteria by different methods. PMA, propidium monoazide; VBNC, viable but nonculturable.

Table 5.

Quantification of Viable, Dead, and Viable but Nonculturable Foodborne Bacteria by Dilution Plating, qPCR, and PMA qPCR Methods

		Methods of analysis (Log₁₀ (mean) ± SE)
Species	Source	Plate count	qPCR	PMA qPCR	VBNC cells	Dead cells
Staphylococcus aureus	Chicken meat	4.373 ± 0.016^c	7.723 ± 0.021^a	6.113 ± 0.020^b	6.105 ± 0.021	7.712 ± 0.023
Staphylococcus aureus	Chicken meat	3.486 ± 0.012^c	6.433 ± 0.016^a	5.671 ± 0.011^b	5.669 ± 0.012	6.351 ± 0.017
Bacillus cereus	Beef luncheon	3.909 ± 0.016^c	9.091 ± 0.049^a	7.967 ± 0.013^b	7.967 ± 0.013	9.056 ± 0.052
Bacillus cereus	Beef luncheon	4.597 ± 0.014^b	5.712 ± 0.013^a	4.604 ± 0.011^b	2.580 ± 0.306	5.677 ± 0.013
Clostridium perfringens	Beef burger	2.742 ± 0.036^c	9.500 ± 0.025^a	8.462 ± 0.009^b	8.462 ± 0.009	9.458 ± 0.027
Clostridium perfringens	Beef burger	3.465 ± 0.012^c	9.234 ± 0.024^a	8.620 ± 0.016^b	8.620 ± 0.016	9.112 ± 0.028
Enterobacteriaceae	Minced meat	4.723 ± 0.016^b	5.920 ± 0.018^a	4.808 ± 0.017^b	4.051 ± 0.052	5.885 ± 0.018
Enterobacteriaceae	Minced meat	2.299 ± 0.022^c	8.509 ± 0.018^a	7.662 ± 0.007^b	7.662 ± 0.007	8.442 ± 0.022

Data represent mean values ± SE of at least two independent experiments made in triplicate. Values within the same row with different letters are significantly different (p < 0.001).

PMA, propidium monoazide; qPCR, quantitative real-time polymerase chain reaction; SE, standard error; VBNC, viable but nonculturable.

Standard curves for absolute quantification

PMA qRT-PCR assay showed good linear correlations between C_t values and plate count results, with the R ² values higher than 0.98, indicating that the assay was highly linear over a range of 8 log units (10^3–10¹⁰ CFU/mL). The amplification efficiencies of PMA qRT-PCR assay were more than 100%, whereas the LOD were low: 3.427 × 10¹ for S. aureus, 1.576 × 10² for B. cereus, 4.981 × 10¹ for C. perfringens, and 7.415 × 10¹ for Enterobacteriaceae (Supplementary Table S1 and Supplementary Fig. S1; Supplementary Data are available online at www.liebertpub.com/fpd).

Sequencing of rpoB gene

Direct sequencing of the rpoB conserved fragment of 12 VBNC Enterobacteriaceae could identify them accurately at the species level (Table 4). In BLAST analysis, all members of Enterobacteriaceae had a similarity range of 97–100% with those published in GenBank database. It showed similarity with Klebsiella pneumoniae subsp. pneumonia (n = 5), K. pneumoniae subsp. ozaenae (n = 2), K. pneumoniae subsp. rhinoscleromatis (n = 2), Enterobacter cloacae subsp. cloacae (n = 1), Enterobacter kobei (n = 1), and S. enterica subsp. enterica serovar Typhi (n = 1), which have been proved to exist in the VBNC state.

Discussion

The increase in foodborne outbreaks highlights the necessity for rapid, sensitive, and specific methods for food safety monitoring, enabling specific detection and quantification of incriminated bacteria (Elizaquível et al., 2013). Herein, the occurrence and the enumeration of S. aureus, B. cereus, C. perfringens, and Enterobacteriaceae in either viable or VBNC state in various meat types were recorded. S. aureus was isolated from 95.56% of chicken meat and beef burger followed by beef luncheon (95%), minced meat (93.33%), sausage (92%), corned beef (90%), and beef kofta (84%), which is consistent with a previous study that recorded a high incidence of S. aureus in raw (95.5%) and cooked meat (93.5%) (Tang et al., 2015).

Enumeration of S. aureus by the standard plate count method recorded higher contamination levels of raw meat (minced meat [2.08 × 10⁶ CFU/g] and chicken meat [1.91 × 10⁵ CFU/g]). Similarly, a previous study in the Kingdom of Saudi Arabia reported low levels of S. aureus (<10² CFU/g) in all examined meat samples except minced meat and frankfurter (10⁴ and 10⁶ CFU/g, respectively) (AL-Dughaym and Altabari, 2010). This may be originated from poor hygiene production processes during food handling, packing processes, transport, and storage (Bennett et al., 2013).

B. cereus was remarkable in beef luncheon (33.50%) and this finding was in conformity with several authors (Rather et al., 2012; Tewari et al., 2015). However, a modest level of C. perfringens was found in minced meat and corned beef (40% each). A relatively higher incidence of C. perfringens (38. 5%) was recorded by Atwa and Ei-roos (2011) in meat products in Egypt. In addition, another study in the United States reported higher detection rates of C. perfringens in chicken meat (38%), sausage (24%), ground beef, and beef (23% each) (Wen and Mcclane, 2004). The mean plate count values of B. cereus and C. perfringens were recorded with acceptable limits (lower than 10⁵ CFU/g) from the viewpoint of microbial safety in all examined meat types. Similar contamination levels of meat samples by B. cereus (Rather et al., 2012; Tewari et al., 2015) and C. perfringens (Atwa and Ei-roos, 2011) were previously reported.

In accordance with previous studies of Gwida et al. (2014), Elhawary et al. (2016), our study demonstrated the high contamination level of Enterobacteriaceae (80.33%) in fresh and processed meat. The highest Enterobacteriaceae count was found in chicken meat (5.54 log₁₀ CFU/g) and minced meat (5.20 log₁₀ CFU/g), which was similar to previous works (Al-Mutairi, 2011; Elhawary et al., 2016).

PMA qRT-PCR confirmed that 19 (90.48%) out of 21 culture-negative meat samples were positive for VBNC bacteria in either single or mixed bacterial contamination. In addition, high levels of VBNC foodborne bacterial contamination (up to 10¹⁰ CFU/g) were recorded in most examined samples. Moreover, qPCR was not a reliable enumeration method for the quantification of intact bacterial populations, mixed with large numbers of injured and dead bacteria due to the presence of viable and culturable, VBNC and dead cells in some examined samples.

The underestimation of the total viable cells in food samples, especially in meat products than raw meat by conventional plate count techniques, is due to the nonculturability of VBNC cells on routine media (Li et al., 2014). This could be attributed to the physiochemical characteristics of food, storage conditions, temperature and time, decontamination treatments, preservatives, and packaging that act simultaneously on contaminating bacteria leading to the VBNC state (Ayrapetyan and Oliver 2016).

Evidence of VBNC pathogens was previously involved in foodborne outbreaks. In Japan, VBNC Enterohemorrhagic E. coli O157 and Salmonella Oranienburg were detected in salted salmon roe (Makino et al., 2000) and dried processed squids (Asakura et al., 2002), respectively. Moreover, a large outbreak caused by E. coli O104:H4 strain was recorded in Germany in 2011 (Aurass et al., 2011; Scheutz et al., 2011). Although there is no evidence to confirm that these outbreaks were directly caused by VBNC pathogens, the studies cited earlier adequately demonstrate that the potential presence of VBNC pathogens can pose a serious risk to food safety and public health.

The use of PMA allowed the qPCR technique to reach lower detection limits (up to 1.576 × 10² CFU/mL). Also, it has the great advantage of avoiding the amplification of extracted DNA from dead cells, which is consistent with a previously published work (Lv et al., 2016).

Sequencing of rpoB gene of Enterobacteriaceae enabled its identification and discrimination, that is, K. pneumoniae complex, E. cloacae complex, Enterobacter kobei, and S. enterica subsp. enterica serovar Typhi. All these species, besides S. aureus, B. cereus, and C. perfringens, have been reported to enter the VBNC state (Oliver, 2010; Yang, 2010; Gonçalves and de Carvalho, 2016).

Conclusions

To our knowledge, this is the first article in Egypt that records the existence of VBNC cells, particularly K. pneumoniae complex, E. cloacae complex, and Salmonella Typhi human pathogens in meat and meat products. Moreover, species-specific PMA qRT-PCR re-emphasizes the infectious potential of the VBNC state of some foodborne bacteria in meat samples and is, therefore, able to assess the risk for public health and food safety.

Authors' Contributions

N.K.A. and Y.H.T. contributed equally in the conception and design of the study; carried out the classical microbiological techniques, molecular genetic studies and sequence analysis, and analysis and interpretation of data; wrote the article; and revised it critically for important intellectual content. A.A.G. and A.M.A. participated in the design of the study and in the analysis and interpretation of data.

Footnotes

Acknowledgments

The authors express their deep gratitude to Dr. Rana Mohamed Mahmoud and Dr. Wegdan Ali Ibrahim, MVSc, Faculty of Veterinary Medicine, Zagazig University, Egypt, for their contribution in the collection of samples and isolation of foodborne bacteria.

Disclosure Statement

No competing financial interests exist.

References

Adams

. Data analysis and reporting. In: Real-time PCR, Dorak

(ed). New York: Taylor & Francis Group, 2007, pp. 39–62.

AL-Dughaym

, Altabari

. Safety and quality of some chicken meat products in Al-Ahsa markets-Saudi Arabia. Saudi J Biol Sci, 2010; 17:37–42.

Al-Mutairi

. The incidence of Enterobacteriaceae causing food poisoning in some meat products. Adv J Food Sci Technol, 2011; 3:116–121.

Anonymous. Microbiology—General Guidance for the Enumeration of Bacillus cereus–Colony-Count Technique at 30°C, 2nd edition. Geneva, Switzerland: International Organization for Standardization, 1993.

Asakura

, Makino

, Takagi

, Kuri

, Kurazono

, Watarai

, Shirahata

. Passage in mice causes a change in the ability of Salmonella enterica serovar Oranienburg to survive NaCl osmotic stress: Resuscitation from the viable but non-culturable state. FEMS Microbiol Lett, 2002; 212:87–93.

Atwa

, Ei-roos

NAA

. Incidence of Clostridium perfringens in meat products at some Egyptian Governorates. Int J Microbiol Res, 2011; 2:196–203.

Aurass

, Prager

, Flieger

. EHEC/EAEC O104: H4 strain linked with the 2011 German outbreak of haemolytic uremic syndrome enters into the viable but non-culturable state in response to various stresses and resuscitates upon stress relief. Environ Microbiol, 2011; 13:3139–3148.

Ayrapetyan

, Oliver

. The viable but non-culturable state and its relevance in food safety. Curr Opin Food Sci, 2016; 8:127–133.

Bennett

, Walsh

, Gould

. Foodborne disease outbreaks caused by Bacillus cereus, Clostridium perfringens, and Staphylococcus aureus- United States, 1998–2008. Clin Infect Dis, 2013; 57:425–433.

10.

Caraguel

, Stryhn

, Gagné

, Dohoo

, Hammell

. Selection of a cutoff value for real-time polymerase chain reaction results to fit a diagnostic purpose: Analytical and epidemiologic approaches. J Vet Diagn Invest, 2011; 23:2–15.

11.

Cato

, George

, Finegold

. Genus Clostridium Prazmowski 1880, 23AL. In: Bergey's Manual of Systematic Bacteriology, Volume 2. Sneath

PHA

, Mair

, Sharpe

, Holt

(eds.). Baltimore: Williams & Wilkins, 1986, pp. 1141–1200.

12.

Chang

, Shangkuan

, Lin

, Liu

. PCR assay of the groEL gene for detection and differentiation of Bacillus cereus group cells. Appl Environ Microbiol, 2003; 69:4502–4510.

13.

Elhawary

, Hassanein

, Nazmy Agban

, Ibrahim Elsayh

. Effect of thyme extract on some Enterobacteriaceae isolated from some meat products in Assuit city. Int Clin Pathol J, 2016; 3:1–5.

14.

Elizaquível

, Aznar

, Sánchez

. Recent developments in the use of viability dyes and quantitative PCR in the food microbiology field. J Appl Microbiol, 2013; 116:1–13.

15.

Fazzeli

, Arabestani

, Esfahani

, Khorvash

, Pourshafie

, Moghim

, Safaei

, Faghri

, Narimani

. Development of PCR-based method for detection of Enterobacteriaceae in septicemia. J Res Med Sci, 2012; 17:671–675.

16.

Gonçalves

FDA

, de Carvalho

CCCR

. Phenotypic modifications in Staphylococcus aureus cells exposed to high concentrations of vancomycin and teicoplanin. Front Microbiol, 2016; 7:13.

17.

Gwida

, Hotzel

, Geue

, Tomaso

. Occurrence of Enterobacteriaceae in raw meat and in human samples from Egyptian retail sellers. Int Sch Res Not, 2014; 2014:1–6.

18.

Health Protection Agency. Enumeration of Enterobacteriaceae by the colony count technique. National Standard Method, 2004; F23 Issue 1. Available at: http://hpa-standardmethods.org.uk/pdf_sops.asp, accessed May 22, 2017 .

19.

, Xie

, Zhou

, Yu

, Aguilar

, Wei

, Xu

. Rapid and simultaneous detection of viable Cronobacter sakazakii, Staphylococcus aureus, and Bacillus cereus in infant food products by PMA-mPCR assay with internal amplification control. LWT—Food Sci Technol, 2016; 74:176–182.

20.

, Mendis

, Trigui

, Oliver

, Faucher

. 2014. The importance of the viable but non-culturable state in human bacterial pathogens. Front Microbiol, 2014; 5:258.

21.

Luo

, Wang

, Kim

, Oh

. Experimental studies and modeling the behavior of anaerobic growth of Clostridium perfringens in cooked rice under non-isothermal conditions. Food Control, 2017; 71:137–142.

22.

, Li

, Qiu

, Wu

, Xu

, Liang

, Liu

, Chen

, Rao

, Ni

. Development of propidium monoazide combined with real-time quantitative PCR (PMA-qPCR) assays to quantify viable dominant microorganisms responsible for the traditional brewing of Hong Qu glutinous rice wine. Food Control, 2016; 66:69–78.

23.

Makino

, Kii

, Asakura

, Shirahata

, Ikeda

, Takeshi

, Itoh

. Does enterohemorrhagic Escherichia coli O157:H7 enter the viable but nonculturable state in salted salmon roe?. Appl Environ Microbiol, 2000; 66:5536–5539.

24.

Martinon

, Cronin

, Quealy

, Stapleton

, Wilkinson

. Swab sample preparation and viable real-time PCR methodologies for the recovery of Escherichia coli, Staphylococcus aureus or Listeria monocytogenes from artificially contaminated food processing surfaces. Food Control, 2012; 24:86–94.

25.

Nicolò

, Guglielmino

SPP

. Viable but nonculturable bacteria in food. In: Public Health—Methodology, Environmental and Systems Issues. Maddock

Jay

(ed.). InTech 2012, pp. 190–216. Available at: http://www.intechopen.com/books/public-health-methodologyenvironmental-and-systems-issues/viable-but-not-culturable-bacteria-in-food, accessed December 17, 2017 .

26.

Nocker

, Camper

. Novel approaches toward preferential detection of viable cells using nucleic acid amplification techniques. FEMS Microbiol Lett, 2009; 291:137–142.

27.

Oliver

. Recent findings on the viable but nonculturable state in pathogenic bacteria. FEMS Microbiol Rev, 2010; 34:415–425.

28.

Ordax

, Biosca

, Wimalajeewa

, López

, Marco-Noales

. Survival of Erwinia amylovora in mature apple fruit calyces through the viable but nonculturable (VBNC) state. J Appl Microbiol, 2009; 107:106–116.

29.

Orruño

, Kaberdin

, Arana

. Survival strategies of Escherichia coli and Vibrio spp.: Contribution of the viable but nonculturable phenotype to their stress-resistance and persistence in adverse environments. World J Microbiol Biotechnol, 2017; 33:45.

30.

Ramamurthy

, Ghosh

, Pazhani

, Shinoda

. Current perspectives on viable but non-culturable (VBNC) pathogenic bacteria. Front Public Health, 2014; 2:1–9.

31.

Rasmussen

. Quantification on the LightCycler. In: Rapid Cycle Real-time PCR, Methods and Applications, Meuer

, Wittwer

, Nakagawara

(Eds.). Heidelberg: Springer, 2011, pp. 21e34.

32.

Rather

, Aulakh

, Ghatak

. Enterotoxin gene profile and antibiogram of Bacillus Cereus strains isolated from raw meats. J Food Saf, 2012; 32:22–28.

33.

Rowan

. Viable but non-culturable forms of food and waterborne bacteria: Quo Vadis?. Trends Food Sci Technol, 2004; 15:462–467.

34.

Scheutz

, Nielsen

, Frimodt-Møller

, Boisen

, Morabito

, Tozzoli

, Nataro

, Caprioli

. Characteristics of the enteroaggregative Shiga toxin/verotoxin producing Escherichia coli O104: H4 strain causing the outbreak of haemolytic uraemic syndrome in Germany, May to June 2011. Euro Surveill, 2011; 16:19889.

35.

Soejima

, Minami

, Iwatsuki

. Rapid propidium monoazide PCR assay for the exclusive detection of viable Enterobacteriaceae cells in pasteurized milk. J Dairy Sci, 2012; 95:3634–3642.

36.

Tang

, Zhang

, Chen

, Zhao

. Incidence and characterization of Staphylococcus aureus strains isolated from food markets. Ann Microbiol, 2015; 65:279–286.

37.

Tewari

, Singh

. Incidence and enterotoxigenic profile of Bacillus cereus in meat and meat products of Uttarakhand, India. J Food Sci Technol, 2015; 52:1796–1801.

38.

Wen

, Mcclane

. Detection of enterotoxigenic Clostridium perfringens Type A isolates in American retail foods. Appl Environ Microbiol, 2004; 70:2685–2691.

39.

, Roberts

, Singleton

, Attwell

, Grimes

, Colwell

. Survival and viability of nonculturable Escherichia coli and Vibrio cholerae in the estuarine and marine environment on JSTOR. Microb Ecol, 1982; 8:313–323.

40.

Yang

Fast viability assessment of Clostridium spores: Survival in extreme environments. PhD Thesis, California Institute of Technology, Pasadena, California, 2010.

41.

Yoo

, Lee

, Park

. Molecular typing and epidemiological survey of prevalence of Clostridium perfringens types by multiplex PCR. J Clin Microbiol, 1997; 35:228–232.

Supplementary Material

Please find the following supplemental material available below.

For Open Access articles published under a Creative Commons License, all supplemental material carries the same license as the article it is associated with.

For non-Open Access articles published, all supplemental material carries a non-exclusive license, and permission requests for re-use of supplemental material or any part of supplemental material shall be sent directly to the copyright owner as specified in the copyright notice associated with the article.

0.00 MB

0.03 MB

0.14 MB